Journal of Neuroscience Research 27:441-451 (1990)

Isolation and Localization of a Slow Troponin (TnT) Gene on Chromosome 19 by Subtraction Hybridization of a cDNA Muscle Library Using Myotonic Dystrophy Muscle cDNA F. Samson, J.E. Lee, W.-Y. Hung, T.G. Potter, M. Herbstreith, A.D. Roses, and J.R. Gilbert Departments of Medicine and Neurobiology , Division of Neurology, Duke University Medical Center, Durham. North Carolina

Subtraction hybridization techniques were used to isolate 91 cDNA clones which are overexpressed in normal control skeletal muscle relative to muscle from patients with myotonic muscular dystrophy. The gene responsible for myotonic dystrophy (DM) has been localized to the 19q13.2-13.3 region of chromosome 19. To test as a candidate gene for DM, clones which represent differences in transcription are analyzed for localization to chromosome 19. One clone, designated MSL 366, was found to be on the long arm of chromosome 19 distal to the CKMM gene at 19q13.2. Sequence analysis confirmed that MSL 366 is the cDNA for human slow skeletal muscle troponin T. A genomic clone has been isolated and linkage studies with DM are in progress. Key words: muscle, troponin T, chromosome 19, gene localization INTRODUCTION Myotonic dystrophy (DM) is a multisystemic disease with characteristic myotonia and dystrophy of skeletal muscle. It is the most common muscular dystrophy that affects both children and adults and is inherited as an autosomal dominant trait. The gene has been mapped to the q13.2-qter region of chromosome 19. Several very tightly linked probes that arc centromcric (proximal) to the DM locus are useful for genetic counselling. A distal, tightly linked genetic flanking marker has yet to be isolated and confirmed. In an attempt to identify the DM gene wc have coupled the use of two methodologies: subtraction hybridization of expressed mRNA and gene mapping. Subtraction hybridization is dependent on differential expression of mRNAs in control and DM tissucs. The (C)

1990 Wiley-Liss, Inc.

hypothesis is that the disease-causing gene may be either over- or underexpressed in affected tissues. By identifying and isolating cDNAs that correspond to differentially expressed mRNAs, probes are generated that may be tested by locali7ation to chromosomes. Any cDNA that localizes to the appropriate region of chromosome 19 can be considered a DM candidate gene. In these experiments we havc subtracted normal control skeletal muscle cDNA with cDNA from a DM muscle library. The subtraction method is similar to that described by Travis et al. (Travis and Sutcliffe, 1988) and allows isolation of cDNAs representing low abundance mRNAs. Thus this experiment may detect an altered, underreprcsented or absent transcript in DM muscle that is expressed in normal muscle. We have isolated a cDNA clone that corresponds to the human slow skeletal muscle troponin T (TnT) gene and mapped this gene to the chromosome 19 q13.2-qter region. A genomic clone for the slow TnT gene has been isolated. This report describes the isolation and identification of the cDNA of human slow skeletal muscle troponin T (TnT).

MATERIALS AND METHODS RNA Preparation Total cellular RNAs were prepared from froLen skeletal muscle samples from both normal and DM patients using a modification of the method of llaria (llaria

Received July 16, 1990: revised August 13, 1990; accepted August 17, 1990. Addres\ reprint requests to I-. Samson, Departments of Medicine and Neurobiology, Division of Ncurology, Duke University Medical Centcr. Box 2900, Durham, NC 27710.

442

Samson et al.

et al., 1985). Muscles were shattered on dry ice, immediately dropped into 10 mlig of a 6 M guanidine hydrochloride (Gdn-HC1) solution (final concentration 6 M Gdn-HC1, 20 mM sodium acetate, pH 5, 1 mM dithiothreitol), and homogenized by using an VirTisshear mechanical homogenizer at full speed (25,000 rpm) for 20 sec. Debris was removed with a 10 min centrifugation at 4°C. Ethanol (0.55 vol) was added to the supernatant and the solution reprecipitated overnight. The solution was centrifuged for 30 min, and the pellet resuspended in Gdn-HCI and rcprecipitatcd as before. Protcins were removed by adding a Proteinase K treatment after the second precipitation, the solution extracted with phenolchloroform, and reprecipitated a final time. Enrichment for poly(A)+ RNAs was performed by the procedure of Aviv and Leder (1972) with oligo(dT)-cellulose.

Construction of cDNA Libraries Five human skeletal muscle normal and DM cDNA libraries were prepared during the course of this work. The first was constructed using the Xgtl 1 vector, by standard techniques (Huynh et a]., 198.5). First-strand synthesis used 2 pg. of poly(A)+ RNA from normal skeletal muscle and avian myeloblastosis virus reverse transcriptase (AMVRT) (Pharmacia, NJ) followed by second-strand synthesis with E. coli DNA polymerase I and ribonuclease H (Watson and Jackson, 1985). After methylation: blunting of cDNA ends by T4 polymerase and ligation of phosphatased EcoRl linkers (Pharmacia, NJ), the cDNAs were EcoRI digested, fractionated by size, and excess linkers removed in a single step by running the reaction mixture over a Bio-Gel A-50m column. The fractionated cDNAs were then ligated to EcoRT-digested hgt 1 1 (Stratagene, CA). Packaging reactions were carried out according to Gigapack Gold Stratagene protocols. A library of 2.5 x lo7 recombinants clonesiyg ds cDNA, with inserts ranging from 0.25 to 2 kilobases (kb) (mean 0.6 kb), was generated. An initial library of 260,000 was amplified by plating out the hgtl 1 phage, and frozen in 7% dimethyl sulfoxide (DMSO) after dropping these aliquots in a mixture of dry ice and ethanol and stored at -80°C. A second normal muscle cDNA library was constructed with a kit, using the vector XZapII (Stratagene, CA). This library was carefully fractionated to yield large inserts and plated on recombination deficient lines. After blunting the cDNA ends, EcoRI adaptors were ligated and kinased. The cDNAs were EcoRI and XhoI digested and separated on Sepharose CL-4B column, phenol-extracted, and then ligated into prepared EcoRIi XhoI uni-Zap arms. Packaging reactions were carried out with Gigapack I1 Cold packaging extracts and the library was plated on the mrcA-, mrcB-, PLK-F’ strain. (Average size of insert -1,200 bp.)

Two cDNA libraries were prepared identically in the phage vector XGEM4 (Promega, WI) from neonatal DM muscle (obtained by M.C. Thibault) and normal adult muscle. Library synthesis was exactly as described in the riboclone cDNA synthesis. A normal muscle and a DM muscle library of 2-3 million recombinants each were generated. Approximately 70% of the clones had inserts with an average size of 600 bp. Initial libraries were amplified by plating out the XGEM4 phage. Finally, a plasmid library of neonatal DM muscle was constructed using the vector pT7T3 I8U (Pharmacia, NJ). The cDNAs were synthesized in the same manner as described above, ligated into the ErvRI site of dephosphorylated EcoRI digested plasmid vector pT7T3 18U, and used to transform DHSa competent cells (BRL, MD). The resulting library was estimated to contain at least lo6 recombinants with an average size less than 1 kb; 250,000 recombinants were amplified and stored at -70°C in 30% ( v h ) glycerol.

Construction of the Genornic Library A genomic library was constructed by size fractionating (16-22 kb) an MboI partial digest of human placental DNA, ligating the random fragments into BurnHI digested EMBL 3A A bacteriophage vector (gift from N. Murray) packaging the ligation mix in vitro and plating on NM539, a P2 lysogen that positively selects for EMBL 3A human recombinants (Frischauf et al., 1983). Approximately 10’ recombinants per yg of DNA were obtained. Analytical Procedures Plasmid release, DNA isolation, polymerase chain reaction (PCR). In vivo excision and rescue of double-stranded recombinants pBluescript SK(-) plasmids out of the XZAPII phagemids was performed as described by the manufacturer (Stratagene, CA) with onc modification: before amplification of the rescued phagemid, a single colony was excised, diluted, and respread three times in order to avoid helper phage contamination in the cells. Plasniid DNA and phage DNA were isolated as described (Maniatis et al.. 1982). PCR amplification of the cDNAs inserts was performed by the usual procedure, according to the Perkin-ElmeriCetus protocol. For PCR amplification of a MSL 366 200 bp fragment contained in MSL-2-27 and MSL-(3-14 clones, a 23-mer and a 24-mer primer, rcspectively, located on the 5’-end and the 3‘-end of MSL 366, were specifically designed and synthesized on a Dupont CODER 300 DNA synthesizer. The PCR reaction was performed in 100 ~1 volume: SO mM KCl, 10 niM Tris-HC1 (pH 8.3), 1.5 mM MgCl,, 0.015% gelatin, SO pM (each) dATP, dCTP, dGTP, dTTP, 7 pmol of the primers, 2.5 units of Tlzermus aquaticus (Tag) polymerase (Perkin-ElineriCetus), and

Chromosome 19 Locus of Slow Troponin T

50 ng of DNA template. The cycling conditions were 2 min of denaturation at 94"C, 1 niin of annealing at 55"C, and 1 min of extension at 72°C. The cycle was repeated 30 times (Thermocycler, Perkin-ElmeriCetus). Subtraction hybridization. A 32P cDNA probe was prepared from 2.5 pg of poly(Aj+ normal muscle RNA using oligo(dT) as a primer and 1 mCi of ["PIdCTP (3,000 Ciimmol; 1 Ci = 37 GBq; Amersham, IL). The ["P]dCIP (50% H,O/ethanol) was dried down in the reaction tube under a steady stream of nitrogen gas. The reaction took place in a final volume of 50 pl. The final reaction conditions were 50 mM Tris-HCI, pH 8.3, 75 mM KC1, 10 mM MgCl,, 0.5 mM spermidine, 10 mM DTT, 4 mM Na-pyrophosphate, 1 unitipl RNasin ribonuclease inhibitor, and 1 mM each of dATP, dGTP, and dTTP. No cold dCTP was added to the reaction. The reaction was run at 42°C for 30 min. After this initial cDNA synthesis, a chase reaction was performed by adding cold dCTP to 1 mM and incubating the reaction for an additional 30 min at 42°C. The reaction was stopped by the addition of EDTA. The RNA template was removed by treating with 50 mM NaOH for 30 min at 68°C. DM muscle plasmid cDNA (440 pg) was prepared as a driver by restriction endonucleasc digestion with Sac1 to linearize the plasmid. The cDNA driver was then coprecipitated with the single-strand labeled probe resuspended in TE 10:l and denaturated by heating 10 min at 100°C before hybridization. Hybridization was performed as described by Travis and Sutcliffe ( 1 988) in a phenol-enhanced reaction (PERT) (Kohne et al.. 1977) modified by adding formamide to the reaction mixture to preserve length of the cDNAs (Casna et al., 1986). The final reaction, performed in 800 pl (2 M NaSCN, 14% phenol, 4% formamide) was carried out at 22°C for -26 hr, with continuous agitation on a Vortex mixer to maintain the phenol emulsion throughout the hybridization. After hybridization the mixture was chloroform extracted, ethanol precipitated, and resuspendcd in 1 ml of SO mM phosphate buffer (pH 6.5). This mixture was then loaded onto a jacketed column maintained at 60"C, containing 3 ml bed volume of hydroxylapatite (HAP) (DNA Grade Bio-Gel HTP, BioRad, CA) equilibrated with 50 mM phosphate buffer (PB). The column was washed with 9 ml of 50 mM PB to remove low-molecular-weight cDNA. The single-stranded cDNA (ss cDNA) was eluted with 10 ml of I20 mM PB, and the majority of the double-stranded cDNA was eluted with 10 ml of 140 mM PB. We verified that the 32P ss cDNA did not undergo subsequent degradation during the hybridization procedure by running on an agarose gcl 8 X 10' cpm of samples removed before and after hybridization. Forty thousand plaques of the hgtl 1 normal muscle cDNA library were plated and duplicate plaque lifts were prepared by the method of Benton and Davis

443

(1977) using nylon membranes (NEN Research Product, Dupont). Both sets of plaques lifts were hybridized with the radiolabeled single-strand cDNA subtracted probes (120 mM elution fraction) ( 5 x 105cpm per filter), 14 hr at 42°C in 50% formamide, 5 X SSPE, 1 X Denhart's, 0.2% SDS. 150 pgiml salmon sperm. Washing after hybridization was performed in 2 X SSC, 30 min at 5S°C, then 1 X SSC, 1% SDS 10 min at 55°C. Plaques demonstrating a positive signal were picked and duplicate plaque-lifts were prepared with these clones for a secondary screening. The same subtractive experiment was repeated with one set of plaques being probed with single-stranded subtracted probe, and the other set with the single-stranded unsubtracted 32P skeletal muscle cDNA probe as a negative control ( 2 x lo6 cpm per filter for both probes). A large excess of driver over probe in the range of 100-fold was used for quantitative subtraction. If cDNA-mRNA subtraction protocols were used, for example, and 1 pg of cDNA probe was prepared from 4 p g of poly(A)+ RNA from normal muscle, than 20-50 p g of poly(A)+ RNA driver from DM muscle would be required for the subtraction steps. This experiment is virtually impossible because this amount of biopsicd DM muscle is unavailable (and unethical). Furthermore, the RNA driver is chemically unstable despite protection from RNases and would be partially degraded during the hybridization step. We attacked this problem by generating high specific activity cDNA probes using the phenol-emulsion enhanced subtraction cDNA cloning method described by Travis and Sutcliffe ( 1 988). Rather than using poly(A) RNA from DM muscle as a subtraction driver, we used double-stranded plasmid cDNA from a DM muscle cDNA library. The plasmid cDNA is less subject to degradation than the mRNAs and unlirnited amounts of cDNA can be produced. It was important to preserve the size of the cDNAs for the subtraction step in order to stabilize the hybrids during hydroxylapatite chromatography and to avoid contamination of the single-stranded elution fraction with shortened doublestranded contaminants during the 120 mM PB elution. To preserve the length of the cDNAs, a chase reaction was performed after synthesis of the labeled probes, as described by Travis and Sutcliffe (1 988). Chromosome mapping and Southern blot analysis. A panel of humanirodent somatic cell hybrids of CHI9 carrying different breakpoints on CH19 was used for regional mapping of the subtracted clones. Somatic cell hybrids which do not contain the q13.2-qter region of CH19 were used as a negative control. Genomic DNA for the parental cell lines and hybrid clones was digested with the restriction enzyme BglII, and each sample (15 pg) was electrophorcsed in 0.8% agarose gel, transferred to Optibind (Amersham, TLj, and baked under vacuum 2 hr at 80°C. Another hybrid panel, spanning all the human

444

Samson et al.

chromosomes (Bios Corp., CT) was used for confirmation of chromosomal assignment and detection of potential cross-hybridization. Inserts of the hgt 11 positive clones were amplified by PCR using the modified hgtl I primers. The hgt primers consisted of the hgtl 1 forward and reverse recognition sequences (Stratagene, CA) coupled at their S'-end. respectively, with T7 or SP6 RNA polymerase recognition sequences. The sequences used were 5'-AAGCTT-

TCATACGATTTAGGTGACACTATAGGGTGGCGACGACTCCTGGAGCCCG-3' and 5'-AAGCTTTAATACGACTCACTATAGGGAGATTGACACCAGACCA ACTGGTAATG-3'. The PCR products were run on 0.8% Seaplaque agarose, excised, and purified with glassmilk (Geneclean Kit, Bio 101, La Jolla, CA) according to the manufacturer's procedure. These DNA templates were used for a transcription reaction (Promega, WI) using T7 polymerase (Stahl and Zinn, 1981), in the presence of ["PIdUTP yielding a '2P-labeled RNA probe (- 1 x 1 0' cpmipg of RNA). After prehybridization of the RNA probe 1 hr with 50 pg/ml of yeast tRNA, hybridization (25 X lo6 cpm per filter) was performed 14 hr at 55°C in a 50% formamide, 5 x SSPE, 2.5 X Denhart's, 0.5% SDS, 10% dextran sulfate solution containing 200 kg/ml of salmon sperm DNA. The filters were washed twice in 1 X SSC, 0.1% SDS 15 min at 55"C, 15 min i n 0 . I X SSC, 0.1% SDS at 55°C and rinsed in 2 X SSC. RNA blot analysis. Total mRNA and poIy(A)+ RNA from normal muscle were electrophoresed on a 1 % agarosc-formaldehyde gel, blotted onto to nitrocellulose, and hybridized to 10 x lo6 cpm of the cDNA probe MSL 366 labeled by random priming (Kleenow, Amersham, 1L). Prehybridization and hybridization were done in 50% formamide, 5 X SSC, 1 XPE, 150 pgiml of salmon sperm DNA at 42°C. The blots were washed at 2 X SSC at 55°C followed by 1 X SSC, 1% SDS at 55°C. Sequence Analysis. The EcoRI insert Prom clone MSL 366 was subcloned into the EcoRI sites of the pT7T3 18U plasmid vector (Pharmacia, NJ). M13 Universal Sequence Primer (27- 1534) was used for sequence analysis by the dideoxy chain-termination method of Sanger et al. (1977) using Sequenase (United States Biochemical, OH) and "S-labeled dATP (Amersham, IL). For sequence analysis of clone MSL-2-27, T3 and T7 primers were used with the Bluescript excised plasmid. Sequence data were analyzed by using DNASIS process GenBank database software (LKB, NJ).

RESULTS cDNA Cloning Our approach for the isolation of a candidate cDNA for the DM gene was based on thc assumption that the DM gene may code for an expressed transcript which

DM MUSCLE TISSUE

NORMAL MUSCLE TISSUE

I

I

poly A+ RNA

poly A+ RNA

I

DM plasrnid cDNA library

I linearize and denature library

\

32 P ss cDNA

HYBRIDIZE Forrnamide-PERT reaction

/

I

HAP

I 32 P ss cDNA

screen I Normal muscle cDNA library

I

Subtracted clones

Fig. I . Subtraction hybridization strategy. Normal skeletal muscle 32Plabelled single-stranded cDNA was subtracted horn a myotonic dystrophy cDNA library. The hybridization rcaction was a modified formamide-PERT (phenol-enhanced reaction technique) rcaction. Single-stranded cDNA was separated from subtracted double stranded product using a hydroxylapatite column (HAP). 32Psingle-stranded cDNA was then used to screen a normal skeletal muscle cDNA library. may be overabundant, absent, or altered in DM. Subtractive cloning allows isolation of cDNAs representing mRNAs with much lower abundanccs than differential screening (Travis and Sutcliffe, 1988). The initial experiment was based on the hypothesis that DM gene transcripts may be absent or underrepresented in DM muscle relative to normal muscle. The subtraction protocol, a modification of Travis and Sutcliffe ( 1988), is outlined in Figure I . The initial screen used all of the single-stranded elution fraction as a probe. Approximately 40,000 recombinants from the normal skeletal muscle hgtl 1 library were screened and yielded a total of 426 positives. The 426 positives were first blotted onto master plates, lifts taken, and then reprobed using equal amounts of subtracted probe and unsubtracted single stranded cDNA. Ninety-one clones of the 426 recombinants from the first subtraction screening gave a detectable differential hybridization signal with the subtracted probes on the secondary screening. Certain clones did not give any significant hybridization signal with the unsubtracted 32P cDNAs. Inserts from 12 random clones were amplified by PCR reaction. The PCR products varied from 0 . 3 to 2 kb (average size 0.6 kb). Having isolated DM subtracted clones the second step was to begin localization. Any clone which localized to the long arm oC CHI 9 was treated as a DM candidate gene. Amplified DNA from

Chromosome 19 Locus of Slow Troponin T

445

-4.7 kb

I

2 3 4 5

6 7 8 9 10 II

12 13 14 15 16 17 I8 19 20 21 22

Fig. 2 . Chromosomal mapping of MSL 366. Southern blots of BglII digested DNA were hybridized with a "P labelled KNA probe transcribed from MSL 366 as described in methods. In the whole human lanes (lanes 1 and 12) the probe detects a single 4.7 kb band. The same band was detected in lanes 7,8,15,17,18,19 that correspond to humanihamstcr hybrid cell

lines containing human chromosome 19. No bands were detected in the hybrid lines (lane 2,3,4,5,6,9,10,13,14,16,20,21) that did not retain any region of chromosome 19. Chromosome 19 was the only chromosome which accounted for this hybridization pattern. No cross hybridization with hamster DNA was detected (lanes 11 and 22).

the inserts were regularly produced from hgtl 1 clones using the polymerase chain reaction (PCR). This was done in one of two ways: (1) using hgtll primers, purifying the amplified product, and labeling it with [32P]dCTP by random priming; (2) using the hgt 1 1 (T71 SP6) modified primers, purifying the amplified product, and producing an RNA probe transcribed from the T7 promoter in the presence of [32P]UTP. Transcription rcactions were often used to make a 32P-labeled RNA probe to increase the hybrididion signal on the hybrid panel Southern blots. One of the early clones analyzed, designated MSL 366, contained a 241 bp insert and was localized to the q13.2-qter region of chromosome 19.

band. No bands were detected with the other cell hybrids and the hamster parental cell lines (Fig. 2). Further, regional assignment to the q 13,2-qter region of chromosome 19 was demonstrated by analysis of 7 somatic cell hybrids containing different portions of human chromosome 19. The C F 104-22, CF 104-19, and G24B2 somatic cell hybrid lines contain the cen-qter region of chromosome 19. The G1711, the CFl00-10, CF100-5, and 908KlB18 cell lines do not retain this region (Fig. 3) (Bartlett et al., 1987). MSL 366 hybridized to the CF104-22 and CF10419 somatic cell hybrid lines which contain the cen-qter fragment of chromosome 19. The 908KlB18 cell line, which breaks within the CKMM gene (Smeets et al., 1990), the (3171 1 , the CF100-10, and the CF100-5 lines contain only the pter-q13.2 region of chromosome 19 and did not hybridize (Fig. 4). On separate blots (data not shown) MSL 366 also hybridized to the G24B2 cell hybrid. MSL 366 gave a single hybridization fragment with RglII and with Hind111 (data not shown) Southern

Chromosomal Mapping Hybridization of the MSL 366 RNA probe to Bios blots, commercially available southern panels, containing BglII digested DNA from 18 humanihamstcr somatic cell hybrid lincs demonstrated that only the 6 hybrid lines carrying the human chromosome 19 detected a 4.7 kb

446

Samson et al.

p 13.3 p 13.2

p 13.1

P 12 9 12

q 13.1

q 13.2

DM

G 1711 CF 100-10 CF 100-5

q 13.3

q 13.4

CF 104-22 CF 104-19

908KB18

4.7 kb-

G24B2

Fig. 3. Diagram of the chromosome 19 segments contained in somatic cell hybrids used for regional mapping of MSL 366. Cell type with the portion of chromosome 19 present are as follows: 1) CF104: hybrid cell lines with t[ Ipterl-cen: 19cen+qter]; 2) 908KB18 is a CHO cell line that contains a single der (19;X) chromosome. Its long arm is composed of the 19 cen-q13.2 and Xp24-Xqter segments. It is known to break between exon 4 and 5 of the CKMM gene (Smeets et al. 1990). 3) G171 1: hybrid cell line with t[l9pter+q13.3::Xp23+qter]; 4) CFIOO: hybrid cell lines with t[ 19pter+q13.3::Xq23-+ qter]. Arrows indicate the approximate localization of DM.

blots, suggesting that it may correspond to a single gene. Northern blot analysis of normal muscle poIy(A)+ RNAs, detected a 1 kb transcript when hybridized with MSL 366 (Fig. 5). Comparative screening of both normal muscle and DM muscle AGEM4 phage libraries showed that the MSL 366 transcript was in a 3:2 excess in the normal muscle compared to the DM muscle.

1 2 3 4 5 6 7 8 9 1 0 Fig. 4. Regional mapping of MSL 366. Southern blot of BglII digested DNA was hybridized with a 32P labelled RNA probe transcribed from MSL 366 as described in the methods. Lane 1,2,3,4, human lanes; lane 5, (31711; lane 6, CF100-10; lane 7, CF100-5; lane 8, CF104-22; lane 9, CF104-19; lane 10, 908KB18. The cell lines are described in Fig. 3.

28S-

-

Sequence Analysis Sequence analysis of MSL 366 using the GenBank TMiEMBL Data Bank showed that in a 244 bp overlap it possessed a 95.5% identity with the clone M1 of human slow skeletal muscle troponin T mRNA (HUMTNTSA), first reported by Gahlmann et al. (1987). This 244 bp overlap is located on the 3'-end of the human slow skeletal muscle troponin T mKNA. To identify the full length cDNA of MSL 366, a large insert muscle DNA library cloned into AZAP I1 vector library was screened with MSL 366. Fivc clones (average size of the insert = 1 kb) gave a strong hybridization signal with MSL 366. One of these, MSL-2-27, contained a 0.9 kb insert that was confirmed by sequence analysis to includc both the 3'-end sequcncc as MSL

18s-

1

2

Fig. 5 . Northern analysis of MSL 366. 20 ~g of total RNAs (lane 1) and 4 Fg. of poly(A)+ RNAs (lane 2) from normal skeletal muscle were separated on an agarose formaldehyde gel, and hybridized with a 32P labelled cDNA probe of clone MSL 366. Thc probe detects a - 1 kb transcript.

366, and the poly(dA) tail. Hybrid panel analysis confirmed that MSL-2-27 was localized to the same q13.2qter region of chromosome 19. This longer cDNA was investigated for RFLPs. No polymorphisms were detected with this cDNA suggesting that this sequence is highly conserved. By screening an EMBL3A genomic

Chromosome 19 Locus of Slow Troponin T

200bp-

1 2 3 4

5 6

Fig. 6. Polymerase Chain Reaction Amplification of MSL 366 and its larger cDNA and genomic clones. Using spccific primers (data not shownj prepared against the MSL 366 cDNA clone, the MSL 366, MSL-2-27 and MSL-G-14 clones were subjected to 30 cycles of PCR amplification. The same -200 bp product was generated in each case. The products were electrophoresed on a 1.8% agarose gel (lane 2,3,4, respectively), and the bands visualized by staining with ethidium bromide. The 200 bp fragment of the DNA ladder (lane 1) is indicated. Lane 5: Hind111 digest A marker. Lane 6: Control: A second PCR amplification of MSL-G- 14 using separate nested MSL 366 primers generates a smaller 130 bp product.

library we identified a genomic clone of MSL 366, MSLG- 14. Thc 15 kb insert of MSL-G- 14 hybridized strongly with MSL 366. Furthermore, PCR amplification performed using MSL-G-14 as a template and the two specific primers designed from both ends of the MSL 366 sequcncc generate the same 200 bp PCR product as MSL 366 and MSL-2-27 (Fig. 6). MSL 366 and clone M 1 (HUMTNTSA) share 96% homology in a 244 bp overlap: a 9.5% homology is shared with clone H22h (HUMTNTS) in a 237 bp ovcrlap. Furthermore the 3' region of MSL 366 is identical to the 57 bp 3' untranslated region of both M1 and H22h clones of Gahlmann et al. ( I 987) (Fig. 7). A single base, the C in position 863, is missing in MSL 366, and may represent allelic variation in the DNA or sequence error of reverse transcriptase or DNA polymerase during DNA cloning. Since the 3' untranslated regions of very closely related genes are divergent, this 3' homology strongly suggests that MSL 366, the cDNA M1, and H22h are products of the same gene. If we compare MSL 366 sequence with the clone H22h published by Gahlmann et al. (1987) a stretch of 48 nucleotides present in clone H22h, but absent in the sequence of clone M I , is also missing in MSL 366. The first 11 bp sequence of the MSL 366 sequence (AACAGCTCCGG) is completely different from the potential homologous region of clone H22h (bp 707 to 717), but matches perfectly with the 627 to 637 bp region of clone M I . This 11 bp sequence

447

corresponds to the end of the TnT cDNA sequence upstream from the optional 48 bp insertion (670-717 bp) in clone H22h (not shown). The downstream sequence following the 48 bp insertion is highly conserved. These data strongly suggest that MSL 366 is likely to correspond to clone MI rather than to clone H22h of the TnT cDNAs. Computer analysis performed by Gahlmann et al. (1987) has shown that this 48 bp insertion in human slow TnT leads to severe disruption in the protein conformation, which results in an alteration of the binding capacity of troponin I and troponin C to this region of slow TnT. Therefore, MSL 366 may be a TnT cDNA coding for the TnT isoform involved in the troponin complex binding.

DISCUSSION The genetic defect in DM is unknown. The strategy of these experiments is to describe candidate genes that are expressed more in control muscle than in DM muscle and are located in a relatively small, well-defined region of chromosome 19. The isolation and identification of human slow ' h T in the appropriate region of chromosome 19 support further examination of this protein as a candidate gene. A third consideration, besides differential tissue expression and appropriate chromosomal location, is the potential relevance of the candidate gene to what is known about the pathophysiology of DM. For example, Gahlmann et al. (1987) demonstrated that transcripts corresponding to human slow TnT cDNA clones are specifically localized in slow-twitch muscle of rabbits. These fibers correspond to type I fibers of human muscle. Selective type I fiber atrophy is a characteristic early change in adult skeletal muscle in DM. Further proof of human slow TnT as a candidate gene for DM will require linkage studies. Should TnT not be excluded by linkage, then direct molecular comparison of the sequence and regulating elements of control and DM TnT will be necessary. The linkage studies of human slow TnT are in progress and will be reported separately. This discussion will briefly discuss the subtraction hybridization experiments reported here, the literature suggesting a membrane-related defect in DM, and the potential pathogenetic consequences of a human slow TnT defect. The first because it formed the experimental rationale for these experiments, the second because suggestions for candidatc membrane-related genes have been tested recently, and the third because human slow TnT is expressed in the right tissue, located in the appropriate chromosome region, and is differentially expressed in control and DM muscle. Our use of the subtraction hybridization strategy reported is based on the hypothesis that the DM gene

448

Samson et al.

..

M S L 366

AACAGCTCCGGGAGAAAGCCCAGGAGC-GGCGGACTGGATCCACCAGCTGGaGTCTGAGA

SLOW TROPONIN T

AACAGCTCCGGGAGAAAGCCCAGGAGCTGTCGGACTGGATCCACCAGCTGG~GTCTGAGA 630 640 650 660 670 680

M S L 366

AGTTCGACCTGATGGCGAACGTGAAACAGCAGAAATATGaGaTCaACGTGCTGTAC~~CC

SLOW TROPONIN T

AGTTCGACCTGATGGCGAAGCTGAAACAGCAGAAATATGAGATCAaCGTGCTGT~C~ACC

............................ ...........................

.......................................................... .......................................................... 700

690 M S L 366

sLaw TROPONIN

T

.................. .......................

x::::::.....

710

720

730

740

GCATCAGCCFICGCCCCFIGFIFGTTCCGGAA-GGGGCAGGGAFtGGGCCGCGTTTGGGCIGGCG ::::::::::::::::::: :::a : :: GC~TCAGCCFICG-CCCAGAFIGTTCCGGAAGGGGGGCAGGG~AGGGCCGCG-TTGGAGGCCG

............................ 760

750

770

780

790

a00

M S L 366

CTGGaAGTGAGGATGCCGCCCCGGaCAGTGGCCCTGGG~AGCCTGGG~GTGTTTGT-CC

SLOW TROPONIN T

CTGGAAGTGAGGATGCCGCCCCGG~CAGTGGCCCTGGGAAGCCTGGGAGTGTTTGTCCC

M S L 366

ATCG :::X ATCG

......................................................... ........................................................

t SLOW TROPONIN T

Bzo

830

840

850

::

060

t Fig. 7 . The nucleotide sequence of cDNA MSL 366 is conipared with the sequence of the slow TnT cDNA (clone M I ) [Gahlmann et al., 1987). The optional 48 bp insert is indicated on the first lane. Two arrows delineate the 3’ untranslated region of slow TnT.

may code for a transcript that may be overabundant, absent, or altered. This experiment investigates only the possibility of an altered differentially expressed, or absent, transcript in DM. One clone, MSL 366, of the first 12 clones tested for chromosomal localization was confirmed to be localized to the same region of chromosome 19 as the DM gene. MSL-2-27 is a larger cDNA clone (0.9 kb) that contains the MSL366 clone (241 bp) and also was localized identically. Both clones share a high homology with the human slow skeletal muscle troponin T cDNAs described by Gahlmann ct al. (1987) and are likely to be derived from the same gene. The complexity of the TnT gene family, based on the diversity of the TnT isoforms, is still imperfectly known, especially in humans. In other vertebrates TnT exists in several antigenically distinct and multiple isoforms in fast skeletal, slow skeletal, and cardiac muscle cells (Dhoot ct al., 1979). Fast skeletal muscle and cardiac TnT isoforms have been extensively studied. It has been demonstrated that more than 40 and potentially 64 distinct mRNAs are generated in rat fast skeletal muscle by alternative splicing from a singlc gene in a developmentally regulated and tissue-specific manner (Medford et al., 1984; Breitbart et al., 198.5; Imai et al., 1986). A single cardiac TnT gene has been shown to generate an embryonic and an adult isoform of TnT in rat (Jin and Lin 1989), and in chicken (Cooper and Ordahl, 198.5) through developmentally regulated alternative splicing. These isoforms differ by an optional insertion of an in-

ternal highly acidic 10 amino acids fragment near the amino terminus in rat and chicken. Of particular interest is the finding that the embryonic form of chicken cardiac TnT is expressed in both early embryonic skeletal muscle and cardiac muscle (Cooper and Ordahl, 1984, 1985). Unusual features of the variable peptide region suggest that the embryonic form of cardiac TnT may be specific for assembly of new sarcomeres in both cell types and then replaced by the adult form of cardiac TnT and skelctal form of TnT in fully assembled sarcomeres in cardiac and skeletal muscles (Cooper and Ordahl. 1985). Alternative splicing of the slow skeletal isoform of TnT is not as well documented. The first nucleotide sequences of two human slow skeletal isoforms of TnT were provided by Gahlmann et al. (1987), who demonstrated that both isoforms are derived from a single gene by alternative splicing. Comparison of the amino acid sequences derived from both cDNA clones with the fast and cardiac TnT showed 65% conservation of the carboxyl-terminal segments. On the other hand, the completcly different sequences in the 5’ and 3’ untranslated region of rat fast skeletal TnT (Breitbart and Nadal-Ginard, 1986) and rat cardiac TnT suggest that at least rat cardiac and fast skeletal TnTs are encoded by two distinct genes (Jin and Lin, 1989). Our data provide the first chromosomal localization of the human slow TnT gene. It would be interesting to investigate the fast and the cardiac cDNA TnT isoforms for chromosomal localization. The ability of a cardiac

Chromosome 19 Locus of Slow Troponin T

TnT gene to process a transcript expressed in both cardiac and skeletal muscle raises the possibility that different classes of TnTs may be derived from a single gene. This may have relevance to the pathogenesis of DM which affects many tissues including skeletal and cardiac muscle. At this time, however, there is no firm evidence that the slow TnT gene is expressed in other tissues. Our laboratory supported the concept of a sarcolemma or coupling of sarcoplasmic reticulum abnormality being responsible for the pathogenesis of DM (Roses and Appel, 1974a,b). The most compelling data for this concept has been in the literature for many years. Myotonia, the sustained contraction of muscle in response to electrical or percussive stimulation, is a postneuromuscular junction phenomenon involving the skeletal muscle sarcolemma or its coupling to the sarcoplasmic reticulum. Over the years several membrane abnormalities have been described in DM tissues, but none could be confirmed as primary (Lindsey and Curren, 1936; Denny-Brown and Nevin, 1941; Landau, 1952; Floyd, 1955; Roses and Appel, 1974a,b; Wong and Roses, 1979). Our laboratory went to the “reverse genetics” approach to try to establish the biochemical defect. Linkage analysis, for example, quickly eliminated ATPlA3, as well as the Ryanodine receptor gene on chromosome 19, as DM candidate genes (Harley et al., 1988; Mackcnsie et al., 1990). Can a hypothesis based on cell biology, not chromosomal location alone, be generated to explain the role of human slow TnT as a candidate gene for DM? These criteria might be met if the candidate were located in the appropriate place in the involved tissues, expressed at the appropriate time in development, and could fit with established data. A feature of the congenital form of DM, which occurs only when some affected mothers have an affected child: is an abnormal architectural organization of the myofibrils (Farkas et al., 1974; Silver et al., 1984; Samson et al., 1987). The characteristic early adult changes of selective Type 1 atrophy and myotonia are not present early in congenital DM, although they do occur later in the course of the disease. However, there is one common ultrastructural defect in adult and congenital DM muscle: abnormalities in the peripheral distribution and arrangement of the myofibrils and the myofilaments in the muscle fiber (Lapresle and Fardeau, 1965; Mair and Tome, 1972; Farkas et a1. , 1974). Could a TnT defect explain these data’? The Ca2+ cytosolic concentration as well as the presence of the regulatory proteins, troponin and tropomyosin. are essential to control the actin-myosin interaction. Troponin consists of three subunits: troponin I is responsible for the inhibition of the actin-myosin intcraction; troponin C confers the Ca’+ sensitivity to the

449

system; and troponin T controls the binding of the troponin complcx to tropomyosin. In the abscnce of these regulatory proteins, the actin-myosin interaction occurs spontaneously and is unaffected by the Ca2+ concentration (Gillis, 1985). Abnormalities of troponin binding to tropomyosin as a result of a defect in a developmentally expressed form of TnT could lead to early ultrastructural abnormalities located in the appropriate anatomy of the muscle fiber. Ultrastructural studies of the sarcoplasmic reticulum (Mussini et al., 1970) have shown that one of the earliest changes in DM fibers was the presence of deposits of very high electron density at the I-band level. Troponin is located at the I-band in the sarcomere (Toyota and Shimada, 1981 ; Lim et al., 1985; Fuldner et al., 1984). DM is a multisystemic disease that can involve skeletal muscle, smooth muscle, heart, brain and other tissues. TnT isoforms may not be restricted to skeletal muscle. Monoclonal antibodies raised against skeletal TnT were demonstrated to cross-react with smooth muscle and non-muscle cells (Lim et al., 1985, 1986). A single gene such as the slow TnT gene may process multiple variants in tissue-specific and/or developmentally regulated programs. The involvement of multiple tissues, the existence of a neonatal form of the disease, and the variable expressivity in multiple tissues during life may have explanations at the molecular level. If disease expression is related to the molecular expression of an abnormal TnT form, rational treatment directed at controlling healthy expression may be a possibility. Examination of the genetic linkage of slow human TnT to DM is in progress using the genomic clone, MSL-(2-14, to develop polymorphisms. A single confirmed crossover could eliminate TnT as a candidate gene. Highly informative polymorphisms segregating in many phase known meiotic events must be tested and analyzed. These data are being collected in parallel with further studies to characterize human slow TnT gene expression.

ACKNOWLEDGMENTS The funding for this research was provided by an MDA Research Fellowship and the Phillipe Foundation (FS), a Clinical Research Grant M01 -RR-30, National Institute of Health Grant NS 19999 (ADR), the Leadership and Excellcnce in Alzheimer’5 Disease (LEAD) Award AG07922, and an MDA Clinical Research Grant (ADR). Special thanks to Dr. James K. Todd and the Piton Foundation whose early support enabled our laboratory to pursue linkage studies in DM as well as Dr. M.C. Thibault (Quebec, Canada) for providing DM tissue samples. Also thanks to Drs. T.K. Mohandas, H.H. Hilger-Ropers, Be Wieringa, Gail Bruns, and Michael

450

Samson et al.

Siciliano for the cell lines. We also thank Dr. Mirta Mihovilovic for her helpful experimental advice and Laurita Melton for preparation of the manuscript.

REFERENCES Aviv H, Leder P (1972): Purification of biologically active globin messenger RNA by chromotrography on oligo thymidylie acidcellulose. Proc Natl Acad Sci USA 69:1408-1412. Bartlett RJ, Pericak-Vance MA, Gilbert J, Yamaoka L, Herbstreith M, Hung W-Y, Lee JE, Mohandas T, Bruns G, Laberge C. Thibault M-C, Ross DA, Roses AD (1987): A new probe for the diagnosis of myotonic muscular dystrophy. Science 235: 16481650. Benton WD, Davis RW (1977): Screening Xgt recombinant clones by hybridization to single plaques in situ. Science 196:180- 182. Breitbart RE, Nguyen HT, Medford RM, Destree AT, Mahdavi V, Nadal-Ginard R (1985): Intricate combinatorial patterns of exon splicing generate rnultiple regulated troponin T isoforms from a single gene. Cell 41:67-82. Breitbart RE, Nadal-Ginard B ( 1 986): Complete nucleotide sequence of the fast skeletal troponin T gene: Alternatively spliced exons exhibits unusual interspecies divergences. J Mol Biol l88:3 13324. Casna NJ, Novack DF, Hsu MT, Ford JF (1986): Genomic analysis 11: isolation of high molecular weight heteroduplex DNA following differential methylasc protection and formamide-PER1 hybridization. Nucleic Acids Res 14:7285-7303. Cooper TA, Ordhal CP (1984): A single troponin T gene rcgulatcd by ’ different programs in cardiac and skeletal muscle development. Science 226:979-982. Cooper TA, Ordhal CP (1985): A single cardiac troponin T gene generates embryonic and adult isofoms via developmentally regulated alternative splicing. J Biol Chem 260: I 1 140-1 1148. Denny-Brown D, Nevin S (1941): The phenomenon of myotonia. Brain 64:1-18. Dhoot GK, Frearson N , Perry SV (1979): Polymorphic forms of troponin T and troponin C and their localization in striated muscle cell types. Exp Cell Res 122:339-350. Farkas E, Tome FMS, Fardeau M, Arsenio-Nudes ML, Dreyfus P, Diebler MF (1974): Histochemical and ultrastructural study of muscle biopsies in 3 cases of dystrophia myotonica in the newborn child. J Neurol Sci 21:273-288. Floyd K, Kent P. Page F (1955): An electromyographic study of myotonia. Electroencephalog Clin Neurophysiol 7 5 2 1-630. Frischauf A, Lehrach H, Poustka A, Murray N (1983): Lambda replacement vectors carrying polylinker sequences. J Mol Biol 170:827- 842. Fuldner R A , Lim SS, Greaser ML, Lemanski LF (1984): Aceumulation and localization of troponin T in developing hearts of Ambystoma mexicanum. J Embryo1 Exp Morphol 84:l-17. Gahlntann R, Troutt AB, Wade RP, Gunning P, Kedes L (1987): Alternative splicing generates variants in important functional domains of human slow skeletal troponin T. J Biol Chem 262: 16122- I 6 126. Gillis JM (1985): Relaxation of vertebrate skeletal muscle. A synthesis of the biochemical and physiological approaches. Biochim Biophys Acta 81 1:97-145. Harley HG, Brook JD, Jackson CL, Glaser T, Walsh KV, Sarfarazi M , Kent R, Lager M , Koch M, Harper PS, Levenson R, Housman DE. Shaw DJ (1988): Localization of a human N a + , K t ATPase subunit gene to chromosome 19912-q13.2 and linkage to the myotonic dystrophy locus. Genomics 3:380-384.

Huynh TV, Young RA, Davis RW ( 1 98.5): “DNA Cloning, Vol. I . A Practical Approach.” Oxford: IRL Press, pp 49-77. llaria R, Wines D, Pardue S, Jamison S, Ojeda SR, Snider J, Morrisson MR (1985): Rapid microprocedure for isolating RNA from multiple samples of human and rat brain. J Neurosci Methods 15: 165-1 74. lmai H, Hirai S, Hirono H, Hirabayashi T (1986): Many isoforms of fast muscle troponin T from chicken legs. J Biochem 99:923930. Jin JP, Lin JJC (1989): Isolation and characterization of cDNA clones encoding embryonic and adult isoforms of rat cardiac troponin T. J Biol Chem 264:14471-14477. Kohne DE, Levison SA, Byers MJ (1977): Room temperature method for increasing the rate of DNA reassociation by many thousandfold: The phenol emulsion reassociation technique. Biochemistry 165329-5341. Landau WM (1952): The essential mechanism in myotonia: An electromyographic study. Neurology 2:369-388. Lapresle J , Fardeau M (1965): Diagnostic histologique des atrophies et hypertrophies musculaires. In “Proceedings of the 8th International Congress o f Neurology, Vol. 2, Neuromuscular Diseases.” Vienna: Wiener Medi~inischeAkademie, pp 47-66. Lim SS, Hering GE, Borisy GG (1985): A monoclonal antitroponin-T cross-reacts with smooth muscle and non-muscle cells. Can J Biochem Cell Biol 63:470-478. Lim SS, Hering GE, Borisy GG (1986): Widespread occurrence of anti-troponin T cross reactive components in non-muscle cells. J Cell Sci 85:1-19. Lindsley DB, Curren EC ( 1 936): An electromyographic study of myotonia. Arch Neurol Psychiat 35:253-269. Mackensie AE, Korneluk RG, Zorzato F, Fujii J , Phillips M, Iles D, Wieringa B, Leblond S, Bailly J, Willard HF, Duff C, Worton RG, MacLennan DH (1990): The human ryanodine receptor gene: its mapping to 19q13.1, placcment in a chromosome 19 linkage group, and exclusion as the gene causing myotonic dystrophy. Am J Hum Genet 46:1082-1089. Mair WGP, Tom6 FMS (1972): “Atlas of the Ultrastructure of Disease Human Muscle. ” Edinbourg: Churchill Livingstone. Maniatis T, Fritsch EF, Sarnbrook J (1982): “Molecular Cloning, A Laboratory Manual.” Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. Medford RM, Nguyen HT, Destree AT, Summers E, Nadal-Ginard B (1984): A novel mechanism of alternative RNA splicing for the developmentally regulated generation of troponin T isoforms from a single gene. Cell 38:409-421. Mussini I , DiMauro S, Angelini C (1970): Early ultrastructural and biochemical changes in muscle in dystrophia myotonica. J Neurol Sci 10:585-604. Roses AD, Appel SH (1974a): Muscular dystrophies (letter). Lancet 2: 1400. Roses AD, Appel SH (1974b): Muscle membrane protein kinase in myotonic muscular dystrophy. Nature (London) 250:245-247. Samson F, Tome FMS, Chevallay M, Fardeau M (1987): Forme neonatale de la dystrophie myotonique. In Serratrice G, Pelissier JF, Pouget J (eds): “Maladies de la m o c k epiniere, des nerfs peripheriques et des muscles: acquisitions recentes. Paris: Expansion Scientifique Francaise, pp 81-87. Sangcr F, Nicklen S, Coulson AR (1977): DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463 -5467. Silver MM, Vilos GA, Silver MD, Shaheed WS, Turner KL (1984): Morphologic and morphometric analyses of muscle in the neonatal myotonic dystrophy syndrome. Hum Pathol 16:207-220. Smeets H, Bachinski L, Coerwinkel M, Schepens J, Hoeijmakers J, ”

Chromosome 1 Y Locus of Slow Troponin T van Duin M, Grzeschik K-H, Weber CA, de Jong P, Siciliano MJ, Wieringa B& (1990): .A long-rangc restriction map of thc human chromosome 19q13 region: Close physical linkage between CKMM and the ERCCl and ERCC2 genes. Am J Hum Genet 46:492-501. Stahl S , Zinn K (1981): Nucleotide sequence of the cloned gene for bacteriophage T 7 RNA polymerase. J Mol Biol 148:481. Toyota N, Shimada Y (1981): Differentiation of troponin in cardiac and skeletal muscles in chicken embryos as studied by immunofluorescence microscopy. J Cell Biol 9 1 :497-504.

451

Travis GH, Sutcliffe JG (1988): Phenol emulsion-enhanced DNAdriven subtractive cDNA cloning: isolation of low-abundance nionkey cortex-specific niRNAs. Proc Natl Acad Sci USA 85: 1696 -1700. Watson C, Jackson JF (1985): “DNA Cloning, Vol. I . A Practical Approach.” Oxford: IRL Press, pp 79-88. Wong P, Roses AD (1979): Isolation of an abnormally phosphorylated erythrocyte membrane hand 3 glycoprotein from patients with myotonic muscular dystrophy. J Membrane Biol 45:147-166.