G Model
EURO-8516; No. of Pages 6 European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
European Journal of Obstetrics & Gynecology and Reproductive Biology journal homepage: www.elsevier.com/locate/ejogrb
Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis T. Li, H. He, R. Liu, S.-X. Wang, D.-M. Pu * Department of Obstetrics and Gynaecology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 5 January 2014 Received in revised form 3 March 2014 Accepted 2 April 2014
Objective: The recent characterization of possible stem/progenitor cells in the endometrium has shed new light on the origins of ectopic endometrial tissue and the mechanism for the pathogenesis of endometriosis, but has raised new questions. Is it possible that abnormal endometrial stem/progenitor cells increase their capacity to implant and establish themselves as ectopic tissue, or that normal stem cells implant in abnormal peritoneum? This study investigated key stem cell properties in cologenic epithelial and stromal cells obtained from eutopic endometrium of women with endometriosis. Study design: Single cell suspensions of endometrial epithelial and stromal cells were cultured at densities of 20, 50, 100 and 200 cells/cm2. Cloning efficiency (CE) was determined, and stem cell phenotypic surface markers were detected using Western blotting and quantitative real-time polymerase chain reaction. Results: CE was significantly higher in cells cultured at a density of 50 cells/cm2 compared with the other groups. After 15 days of culture, small and large colonies were observed. Large-colony-derived epithelial and stromal cells had high proliferative potentials, producing millions of cells in vitro, with strong expression of epithelial and stromal stem cell phenotypic surface markers EMA, CK, CD49f, THY-1(CD90), collagen type I, 5B5 and vimentin. Conclusion: Adult stem cells were found in eutopic endometrium of women with endometriosis, and this may play an important role in disease development. ß 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: Stem cells Endometriosis Human endometrium Cloning
Introduction Endometriosis is a chronic, benign, gynaecological disease characterized by the presence of endometrial glands and stroma outside the uterine cavity. The origin of the ectopic endometrium has been subject to extensive investigation, and several hypotheses have been proposed, including retrograde menstruation, coelomic metaplasia, the embryonic rest theory and the lymphovascular metastasis theory [1]. The recent characterization of possible stem/progenitor cells in the endometrium has shed new light on the origins of ectopic endometrial tissue and the mechanism for the pathogenesis of endometriosis [2–5]. However, this has also raised new questions. Is it possible that abnormal endometrial stem/progenitor cells increase their capacity to
* Corresponding author at: Department of Obstetrics and Gynaecology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China. Tel.: +86 027 83663851. E-mail address: [email protected] (D.-M. Pu).
implant and establish themselves as ectopic tissue, or that normal stem cells implant in abnormal peritoneum? Stem cells have the potential for self-renewal, playing a critical role in replenishment and regeneration of damaged tissues [6–8]. Similar events occur in the endometrium. During each menstrual cycle, tissue and blood vessels undergo extensive growth and proliferation [9]. It has been hypothesized that adult stem/ progenitor cells are responsible for the cyclical regeneration during a woman’s reproductive phase [10]. New research described briefly below has shown how endometrium-derived stem/progenitor cells residing in the basal layer can be shed through the fallopian tube to the peritoneal cavity during menses, and can establish endometriotic implants [11]. This view is not only supported by findings of a clonal origin of endometrial glands and cultured endometrial cells [12], but also by the demonstration of stem cell marker gene expression, including pluripotencyassociated transcription factors (e.g. Oct4, nanog, KLF4 and Sox2 [13,14]) and adult stem cell markers (e.g. CD146, CD73, CD90, notch1 and Msil [15]). To date, however, no direct evidence has been reported for the role of endometrial stem/progenitor cells in the pathogenesis of
http://dx.doi.org/10.1016/j.ejogrb.2014.04.001 0301-2115/ß 2014 Elsevier Ireland Ltd. All rights reserved.
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 2
T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
human endometriosis. Several lines of experimental evidence suggest that these cells play a role in the development of endometriosis [16–18]. However, the stem cells in these studies were derived from bone marrow or extra-uterine implants of endometriotic models. Micro-array analysis has demonstrated that the gene expression profile from eutopic endometrium of patients with endometriosis differs from that of unaffected controls [17,19,20]. Taken together, these data suggest that the presence of endometriotic implants can alter gene expression profiles within the eutopic endometrium and, by extension, the function of eutopic endometrial tissue. This study found endometrial stem cells in eutopic endometrium of women with endometriosis, and aimed to determine the pathogenesis of endometriosis. Materials and methods Human tissues Human endometrium samples in situ were collected from 21 sterile women, aged 24–42 years [mean standard error (SEM) 32.3 1.2 years], who had been diagnosed with endometriosis but had not taken any exogenous hormones for the 3 months preceding laparoscopy. The study protocol was approved by the Ethics Committee of Tongji Hospital, and informed written consent was obtained from each patient. All endometrial samples were collected in the proliferative phase. The samples were stored in phosphate buffered saline (PBS; pH 7.2) containing 100 IU/ml penicillin G sodium and 100 mg/ml streptomycin sulphate (Sigma–Aldrich, St. Louis, MO, USA) at 4 8C, and processed within 2–18 h. Preparation of single cell suspensions of human endometrial epithelial and stromal cells As soon as the samples were delivered to the laboratory, the endometrial tissue was cut into 1–2 mm3 pieces with sharp scissors and incubated with 0.1% collagenase type IA (GIBCO-BRL) in a humidified 5% CO2/95% air atmosphere at 37 8C. After 1 h, the cell suspensions were filtered using a 40-mm sieve to separate single cells from debris and uncatabolized myometrial tissue fragments. The filtrates were centrifuged at 250 g for 5 min to collect cells. To remove erythrocytes, the cells were resuspended in HEPES-buffered DMEM, supplemented with 10% fetal bovine serum (PAA Laboratories) and 2.5 ml Ficoll-Paque (Pharmacia Biotechnology, Uppsala, Sweden), and centrifuged for 8–10 min at 390 g. Endometrial epithelial cells were obtained by positive selection using BerEP4-coated magnetic Dynabeads (Dynal Biotech, Oslo, Norway). The stromal cells were obtained by negative selection using anti-CD45 antibody-coated Dynabeads for removal of leukocytes, as described by Chan et al. [3]. In vitro colony-forming assay To test the clonogenicity of isolated cells, endometrial epithelial and stromal cells were treated with 0.05% trypsin/0.2% EDTA (PAA Laboratories). In order to obtain single cell suspensions, these cells were adjusted to clonal densities of 20, 50, 100 and 200 cells/cm2, and seeded in 60-mm Petridishes coated with fibronectin 10 mg/ ml (Becton Dickinson, Franklin Lakes, NJ, USA). Cells were cultured in DMEM medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine and antibiotics. The cultures were incubated for 15 days at 37 8C in 5% CO2, and the medium was refreshed every 3– 4 days. Each day, the cells were monitored microscopically to ensure the single cell origin of the clones. At the end of the 15-day incubation period, the cells were washed three times with PBS (pH 7.2) and stained with 0.5% toluidine blue following routine
histological techniques. Clusters of cells were considered to be colonies when they were visible macroscopically and contained >50 cells. Colonies were counted and cloning efficiency (CE) was determined using the formula CE (%) = (number of colonies/ number of cells seeded) 100%. Results are shown as mean SEM SEM of six patient samples. Immunocytochemistry Immunocytochemistry was performed on large clonally derived epithelial and stromal cells. Briefly, the cultured cells were detached and the cell suspension was removed before the sediment was mixed with two to three drops of plasma and two drops of thrombin for 1 min, followed by the addition of 4% buffered formalin to the coagulated cell mass, which was then fixed for 30 min. The sections were deparaffinized in xylene and microwaved in 10 mmol/l citrate buffer (pH 6.0) to unmask the epitopes. Sections were incubated at 4 8C overnight with antibodies raised against CK (goat polyclonal IgG, Santa Cruz Biotechnology, Dallas, TX, USA) and vimentin (goat polyclonal IgG, Santa Cruz Biotechnology), both diluted 1:100. After several washes, the sections were incubated with a peroxidase-labelled polymer, conjugated with diluted (1:200) anti-goat biotinylated antibodies (Vector Laboratories), for 30 min. DAB (Vector Laboratories) was used as a chromogen, and haematoxylin was used as a nuclear counter stain. Known CK- or vimentin-positive seminoma was used as a positive control, and the same concentration of nonimmune goat IgG was used as a negative control. Only cytoplasmic staining was considered as CK or vimentin positive. Each section was scanned using 400 magnification. Three observers evaluated the staining pattern separately and scored the staining intensity signal of each specimen (absent, 0; weak, 1; moderate, 2; strong, 3). On average, 10 sections were observed for each human sample. Western blot analysis Clonal epithelial and stromal cells were lysed with ice-cold RIPA buffers containing freshly added protease inhibitors (Sigma– Aldrich) to detect expression of each protein. After centrifugation, 100 mg of proteins was subjected to SDS-polyacrylamide gel electrophoresis and transferred on to a nitrocellulose membrane in a semi-dry transfer cell (Bio Rad Laboratories, Hercules, CA, USA). Primary antibodies, including anti-EMA (1:1000 diluted), anti-CK (1:2000 diluted), anti-CD49f (1:1000 diluted), anti-THY-1(CD90) (1:500 diluted), anti-collagen type I (1:1000 diluted), anti-5B5 (1:1000 diluted) and anti-vimentin (1:1000 diluted) polyclonal antibodies, were obtained from Santa Cruz Biotechnology Inc. After incubation with each diluted primary antibody at 4 8C overnight, the blots were incubated with horseradish-peroxidase-linked antirabbit antibodies and analyzed using a Hyperfilm-enhanced chemiluminescence detection kit (Amersham Bioscience, Chalfont St Giles, UK). Quantitative real-time polymerase chain reaction analysis Total RNA from clonal epithelial and stromal cells was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions. The transcription levels of epithelial and stromal stem cell phenotypic surface markers EMA, CK, CD49f, THY-1(CD90), collagen type I, 5B5 and vimentin were determined by real-time polymerase chain reaction (PCR) using the Applied Biosystems StepOne Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). The PCR reactions were performed in a total volume of 20 ml/well containing the SYBR master mix reagent kit (Applied Biosystems) using primers shown in Table 1. Relative quantification of DNA of interest was calculated according
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx Table 1 Primer sequences. Sequence (50 to 30 )
Gene name EMA CK CD49f THY-1(CD90) Collagen type I 5B5 Vimentin GAPDH
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
TGGATGTGCTTGATAAGCGG ACCATGTCCTTTCCAGTGTGT GGTCATGGCCGAGCAGAA TTCAGTCCGGCTGGTGAAC CCTGCTGCTGCTCCTCACA GTAACAACTGTTGCGGGTTTAGG ATCGCTCTCCTGCTAACAGTC CTCGTACTGGATGGGTGAACT AATCCTCTCGTCAAAACTGAAGG CCATCTCGCTTATCCAACAATGA TGACAGCGACAAGAAGTG CAGTGAAGCGGTACATAGG CCAAACTTTTCCTCCCTGAACC GTGATGCTGAGAAGTTTCGTTGA GGCTCTCCAGAACATCATCC TGTCATCATATTTGGCAGGT
GAPDH, glyceraldehyde phosphate dehydrogenase.
to the DCt method using glyceraldehyde phosphate dehydrogenase as an endogenous control. Statistical analysis Data (mean SEM) were analyzed using unpaired t-test to determine the statistical significance between two groups. p < 0.05 was considered to indicate significance. Results Clonal culture and clonogenicity of human endometrial epithelial and stromal cells Single cell suspensions of human endometrial epithelial and stromal cells were seeded at densities of 20, 50, 100 and 200 cells/ cm2 in serum medium. Cell growth was monitored by microscopy to ensure that each colony originated from a single cell. Some individual stromal cell epithelium started proliferating after 3–4 days and formed small clusters after 6–8 days in culture. After incubation for 15 days, small and large colonies were observed (Fig. 1A and B). Small colonies had either stopped proliferating or increased in size slowly, while the growth of large colonies, which contained more than 10,000 cells, increased dramatically around 10–12 days. Large epithelial cell colonies contained small, densely packed cells (Fig. 1C), which consisted of epithelium-like cells at
3
the periphery and rather small round cells in the centre. Large stromal cell colonies had tightly packed cells with a dense centre and an overall swirly appearance (Fig. 1D). CE (mean SEM) was 8.8% 0.2% (n = 21), 15.7% 0.4% (n = 21), 7.2% 0.57% (n = 21) and 5.1% 0.21% (n = 21) for epithelial cells (Fig. 1E), and 7.1% 0.16% (n = 21), 14.8% 0.6% (n = 21), 11.6% 0.65% (n = 21) and 3.5% 0.2% (n = 21) (Fig. 1F) for stromal cells when the cells were seeded at concentrations of 20, 50, 100 and 200 cells/cm2, respectively. CE was found to differ significantly between cell densities. CK and vimentin expression in large-colony-derived epithelial and stromal cells Immunohistochemistry was used to appraise the stem cell properties of large-colony-derived epithelial and stromal cells. CKand vimentin-positive immunostaining was observed in largecolony-derived epithelial and stromal cells, respectively. CK staining was significantly more intense in large-colony-derived epithelial cells (Fig. 2B) than in other epithelial cells (Fig. 2A) from the same dish (2.76 0.45 vs 1.24 0.31, respectively). Vimentin staining was stronger in large-colony-derived stromal cells (Fig. 2D) compared with other stromal cells (Fig. 2C) from the same dish (2.88 0.22 vs 1.41 0.37, respectively). Phenotype of large-colony-derived epithelial and stromal cells Non-overlapping single epithelial or stromal cell colonies were harvested from culture dishes using 0.025% trypsin (Invitrogen) and cloning rings (Sigma–Aldrich) after 15 days of culture. Serial clonal passaging was organized as cloning plates containing representative clones, with selections of typical large colonies for the subsequent round of cloning indicated within cloning rings, until stem cell activity was exhausted. Large colonies were examined for typical stem cell phenotypic surface markers. A quantitative PCR analysis of epithelial and stromal stem cell marker expression revealed that EMA, CK, CD49f (Fig. 3A), THY1(CD90), collagen type I, 5B5 and vimentin (Fig. 3B) were expressed at high mRNA levels in large-colony-derived epithelial and stromal cells, based on the average DCt values of other cells cultured in the same dish (p < 0.001). Proteins were isolated and analyzed using Western blot analysis to quantitate the proteinic phenotype for large-colonyderived epithelial and stromal cells. As shown in Fig. 4, the epithelial stem cell markers EMA, CK and CD49f and the stromal stem cell markers THY-1(CD90), collagen type I, 5B5 and vimentin
Fig. 1. Clonogenicity of human endometrial cells cultured in vitro. Plates seeded with epithelial (A) or stromal (B) cells at density of 50 cells/cm2. Culture dishes show the distribution of colonies and variation in colony size after 15 days of culture. Magnified view of the centre of typical large epithelial (C) and stromal (D) colonies. The difference in epithelial (E) and stromal (F) cloning efficiencies at different cell densities was found to be significant (*p < 0.01; **p < 0.05; ***p < 0.001).
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
4
Fig. 2. Immunocytochemistry results. CK staining was significantly more intense in large-colony-derived epithelial cells (B) than other epithelial cells (A) from the same dish. Staining for vimentin was stronger in large-colony-derived stromal cells (D) than other stromal cells (C) from the same dish.
Fig. 3. mRNA expression of surface markers. The mRNA expression of each stem cell phenotypic surface marker was higher in large-colony-derived epithelial (A) and stromal (B) cells than other cells cultured in the same dish ($~ §~ p < 0.05).
were expressed at high protein levels in large-colony-derived epithelial or stromal cells in the same manner as mRNA expression described above. Comments Stem cells are undifferentiated cells that have the ability to selfrenew and to produce more differentiated daughter cells [21,22]. Broadly, they can be divided into two categories: embryonic and
adult. Embryonic stem cells are found in the inner cell mass of the blastocyst [23,24]. Adult stem cells, derived from postembryonic cell lineages, have been described in a number of different organ systems and have been best characterized in the haematopoietic system [18,25]. The biological and clinical implications of stem cells have become a research focus in recent years. However, this field is relatively new and is not completely understood. Emerging evidence suggests that human and mouse endometrium may
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
5
Fig. 4. Protein levels of epithelial and stromal cell surface markers. (A) EMA, CK and CD49f protein expression in large-colony-derived epithelial cells analyzed by Western blot. Quantitative data were analyzed for density scanning (objective protein/glyceraldehyde phosphate dehydrogenase). (B) Protein expression of each epithelial stem cell phenotypic surface marker was higher in large-colony-derived epithelial cells than other epithelial cells cultured in the same dish ($~ p < 0.05). (C) THY-1, collagen type I, 5B5 and vimentin protein expression in large-colony-derived stromal cells analyzed by Western blot. Quantitative data were analyzed for density scanning (objective protein/glyceraldehyde phosphate dehydrogenase). (D) Protein expression of each stromal stem cell phenotypic surface marker was higher in large-colony-derived stromal cells than other stromal cells cultured in the same dish ($§ ~ p < 0.05).
contain adult stem cells [21,26,27]. Two cell types were identified from cultured endometrial cells: epithelial and mesenchymal stem cells [28,29]. Endometrial stem cells are likely to play an important role in physiological and pathological uterine biology [30]. Physiologically, they are likely to be involved in the response to tissue injury and disease. However, they may also be involved in the pathology of the reproductive tract, such as endometriosis. Disorders of endometriosis are common, and symptoms often include pelvic pain and infertility [31]. The incidence of endometriosis is between 6% and 10% of all women and 35–50% of women with pelvic pain and infertility [11,32]. Notwithstanding its common occurrence and despite the substantial public health burden of this condition, little is known about its pathogenesis. In combination with the findings that the endometrium basalis contains endometrial stem/progenitor cells [33,34] and that some women have retrograde peritoneal cavities [35], it is possible that more severe endometriotic lesions may develop from endometrial stem/progenitor cells, while lesions that resolve may develop from mature transit amplifying cells [10]. Epithelial cells in some endometriotic lesions are monoclonal, suggesting a single cell origin, possibly an endometrial stem/progenitor cell. Other endometriotic lesions are polyclonal, suggesting contamination with polyclonal stromal cells, repeated seeding of the lesion with
cells from other sources (e.g. bone marrow) or establishment from different fragments of shed endometrium containing several stem/ progenitor cells [10,18,36,37]. Leyendecker et al. [38] showed that significantly more basalis layers are shed in the menstrual flow, suggesting an increased number of stem cells in this layer that may result in a propensity for endometriosis. To explore an alternative hypothesis that extra-uterine stem/ progenitor cells function in the pathogenesis of endometriosis, Du and Taylor generated an experimental model to test whether extra-uterine-derived cells could track and populate endometriotic implants [39]. Endometriosis was generated experimentally by ectopic wild-type endometrial implantation in the peritoneal cavity of hysterectomized LacZ transgenic mice. LacZ-expressing stem cells of extra-uterine origin were incorporated into the endometriosis implants, and were capable of differentiating between epithelial and stromal cell lineages at a frequency of 0.04% and 0.1%, respectively. Extra-uterine stem/progenitor cells, derived from the bone marrow or an alternative source, are likely to travel to distant ectopic sites via the lymphovascular spaces [10]. However, the existence and properties of adult stem cells in eutopic endometrium of women with endometriosis is not clear. As genetic profile and pathological features are very important in
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
6
the occurrence of endometriosis [16,19,37], there is a need to demonstrate adult stem cells in eutopic endometrium. To the authors’ knowledge, this is the first study to shows that freshly isolated single endometrial epithelial and stromal cells initiate large colonies with high proliferative potential, and produce millions of cells in vitro. After 15 days of culture, large epithelial and stromal colonies were observed at a density of 50 cells/cm2 (p < 0.05). Furthermore, several epithelial and stromal stem cell phenotypic surface markers were detected to confirm the stem cell phenotype and properties of these large-colony-forming cells. This represents very important evidence for the existence of adult stem cells in eutopic endometrium of women with endometriosis. Nevertheless, the number of stem/progenitor cell types in the human endometrium, how they differ in phenotype and function, and interactions with their stem cell niche remain to be determined. Such knowledge will enhance our understanding of the predominant stem cell hypotheses, and has the potential to provide cell-based therapeutic strategies for endometriosis. Conflict of interest We declare no any interest conflict. Funding This study was supported by the National Natural Science Foundation of China (No. 81000240). References [1] Seli E, Berkkanoglu M, Arici A. Pathogenesis of endometriosis. Obstet Gynecol Clin North Am 2003;30:41–61. [2] Du H, Taylor HS. Stem cells and reproduction. Curr Opin Obstet Gynecol 2010;22:235–41. [3] Chan RW, Schwab KE, Gargett CE. Clonogenicity of human endometrial epithelial and stromal cells. Biol Reprod 2004;70:1738–50. [4] Deane JA, Gualano RC, Gargett CE. Regenerating endometrium from stem/ progenitor cells: is it abnormal in endometriosis, Asherman’s syndrome and infertility? Curr Opin Obstet Gynecol 2013;25:193–200. [5] Maruyama T, Yoshimura Y. Stem cell theory for the pathogenesis of endometriosis. Front Biosci (Elite Ed) 2012;1:2854–63. [6] Chen S, Do JT, Zhang Q, et al. Self-renewal of embryonic stem cells by a small molecule. Proc Natl Acad Sci USA 2006;103:17266–71. [7] Golestaneh N, Kokkinaki M, Pant D, et al. Pluripotent stem cells derived from adult human testes. Stem Cells Dev 2009;18:1115–26. [8] Patel AN, Park E, Kuzman M, Benetti F, Silva FJ, Allickson JG. Multipotent menstrual blood stromal stem cells: isolation, characterization, and differentiation. Cell Transplant 2008;17:303–11. [9] Gargett CE, Masuda H. Adult stem cells in the endometrium. Mol Hum Reprod 2010;16:818–34. [10] Sasson IE, Taylor HS. Stem cells and the pathogenesis of endometriosis. Ann N Y Acad Sci 2008;1127:106–15. [11] Dimitrov R, Timeva T, Kyurkchiev D, et al. Characterization of clonogenic stromal cells isolated from human endometrium. Reproduction 2008;135:551–8. [12] Pacchiarotti A, Caserta D, Sbracia M, Moscarini M. Expression of oct-4 and c-kit antigens in endometriosis. Fertil Steril 2011;95:1171–3.
[13] Park JH, Daheron L, Kantarci S, Lee BS, Teixeira JM. Human endometrial cells express elevated levels of pluripotent factors and are more amenable to reprogramming into induced pluripotent stem cells. Endocrinology 2011;152:1080–9. [14] Schwab KE, Hutchinson P, Gargett CE. Identification of surface markers for prospective isolation of human endometrial stromal colony-forming cells. Hum Reprod 2008;23:934–43. [15] Taylor HS. Endometrial cells derived from donor stem cells in bone marrow transplant recipients. J Am Med Assoc 2004;292:81–5. [16] Taylor RN, Lundeen SG, Giudice LC. Emerging role of genomics in endometriosis research. Fertil Steril 2002;78:694–8. [17] Masuda H, Matsuzaki Y, Hiratsu E, et al. Stem cell-like properties of the endometrial side population: implication in endometrial regeneration. PLoS ONE 2010;5:e10387. [18] Giudice LC. Application of functional genomics to primate endometrium: insights into biological processes. Reprod Biol Endocrinol 2006;4(Suppl. 1):S4. [19] Wu Y, Strawn E, Basir Z, et al. Genomic alterations in ectopic and eutopic endometria of women with endometriosis. Gynecol Obstet Invest 2006;62:148–59. [20] Gargett CE. Uterine stem cells: what is the evidence? Hum Reprod Update 2007;13:87–101. [21] Bongso A, Richards M. History and perspective of stem cell research. Best Pract Res Clin Obstet Gynaecol 2004;18:827–42. [22] Choo AB, Tan HL, Ang SN, et al. Selection against undifferentiated human embryonic stem cells by a cytotoxic antibody recognizing podocalyxin-like protein-1. Stem Cells 2008;26:1454–63. [23] Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–7. [24] Gonzalez R, Griparic L, Vargas V, et al. A putative mesenchymal stem cells population isolated from adult human testes. Biochem Biophys Res Commun 2009;385:570–5. [25] Li L, Clevers H. Coexistence of quiescent and active adult stem cells in mammals. Science 2010;327:542–5. [26] Cervello I, Mirantes C, Santamaria X, Dolcet X, Matias-Guiu X, Simon C. Stem cells in human endometrium and endometrial carcinoma. Int J Gynecol Pathol 2011;30:317–27. [27] Gargett CE, Schwab KE, Zillwood RM, Nquyen HP, Wu D. Isolation and culture of epithelial progenitors and mesenchymal stem cells from human endometrium. Biol Reprod 2009;80:1136–45. [28] Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–7. [29] Du H, Taylor HS. Stem cells and female reproduction. Reprod Sci 2009;16:126– 39. [30] Sensky TE, Liu DT. Endometriosis: associations with menorrhagia, infertility, and oral contraceptives. Int J Gynaecol Obstet 1980;17:573–6. [31] Giudice LC, Kao LC. Endometriosis. Lancet 2004;364:1789–99. [32] Surrey ES, Schoolcraft WB. Management of endometriosis-associated infertility. Obstet Gynecol Clin North Am 2003;30:193–208. [33] Padykula HA, Coles LG, Okulicz WC, et al. The basalis of the primate endometrium: a bifunctional germinal compartment. Biol Reprod 1989;40:681–90. [34] Schwab KE, Chan RW, Gargett CE. Putative stem cell activity of human endometrial epithelial and stromal cells during the menstrual cycle. Fertil Steril 2005;84(Suppl. 2):1124–30. [35] Halme J, Hammond MG, Hulka JF, Raj SG, Talbert LM. Retrograde menstruation in healthy women and in patients with endometriosis. Obstet Gynecol 1984;64:151–4. [36] Maruyama T, Masuda H, Ono M, Kajitani T, Yoshimura Y. Human uterine stem/ progenitor cells: their possible role in uterine physiology and pathology. Reproduction 2010;140:11–22. [37] Di W, Guo SW. The search for genetic variants predisposing women to endometriosis. Curr Opin Obstet Gynecol 2007;19:395–401. [38] Leyendecker G, Herbertz M, Kunz G, Mall G. Endometriosis results from the dislocation of basal endometrium. Hum Reprod 2002;17:2725–36. [39] Du H, Taylor HS. Contribution of bone marrow-derived stem cells to endometrium and endometriosis. Stem Cells 2007;25:2082–6.
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
EURO-8516; No. of Pages 6 European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
European Journal of Obstetrics & Gynecology and Reproductive Biology journal homepage: www.elsevier.com/locate/ejogrb
Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis T. Li, H. He, R. Liu, S.-X. Wang, D.-M. Pu * Department of Obstetrics and Gynaecology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 5 January 2014 Received in revised form 3 March 2014 Accepted 2 April 2014
Objective: The recent characterization of possible stem/progenitor cells in the endometrium has shed new light on the origins of ectopic endometrial tissue and the mechanism for the pathogenesis of endometriosis, but has raised new questions. Is it possible that abnormal endometrial stem/progenitor cells increase their capacity to implant and establish themselves as ectopic tissue, or that normal stem cells implant in abnormal peritoneum? This study investigated key stem cell properties in cologenic epithelial and stromal cells obtained from eutopic endometrium of women with endometriosis. Study design: Single cell suspensions of endometrial epithelial and stromal cells were cultured at densities of 20, 50, 100 and 200 cells/cm2. Cloning efficiency (CE) was determined, and stem cell phenotypic surface markers were detected using Western blotting and quantitative real-time polymerase chain reaction. Results: CE was significantly higher in cells cultured at a density of 50 cells/cm2 compared with the other groups. After 15 days of culture, small and large colonies were observed. Large-colony-derived epithelial and stromal cells had high proliferative potentials, producing millions of cells in vitro, with strong expression of epithelial and stromal stem cell phenotypic surface markers EMA, CK, CD49f, THY-1(CD90), collagen type I, 5B5 and vimentin. Conclusion: Adult stem cells were found in eutopic endometrium of women with endometriosis, and this may play an important role in disease development. ß 2014 Elsevier Ireland Ltd. All rights reserved.
Keywords: Stem cells Endometriosis Human endometrium Cloning
Introduction Endometriosis is a chronic, benign, gynaecological disease characterized by the presence of endometrial glands and stroma outside the uterine cavity. The origin of the ectopic endometrium has been subject to extensive investigation, and several hypotheses have been proposed, including retrograde menstruation, coelomic metaplasia, the embryonic rest theory and the lymphovascular metastasis theory [1]. The recent characterization of possible stem/progenitor cells in the endometrium has shed new light on the origins of ectopic endometrial tissue and the mechanism for the pathogenesis of endometriosis [2–5]. However, this has also raised new questions. Is it possible that abnormal endometrial stem/progenitor cells increase their capacity to
* Corresponding author at: Department of Obstetrics and Gynaecology, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China. Tel.: +86 027 83663851. E-mail address: [email protected] (D.-M. Pu).
implant and establish themselves as ectopic tissue, or that normal stem cells implant in abnormal peritoneum? Stem cells have the potential for self-renewal, playing a critical role in replenishment and regeneration of damaged tissues [6–8]. Similar events occur in the endometrium. During each menstrual cycle, tissue and blood vessels undergo extensive growth and proliferation [9]. It has been hypothesized that adult stem/ progenitor cells are responsible for the cyclical regeneration during a woman’s reproductive phase [10]. New research described briefly below has shown how endometrium-derived stem/progenitor cells residing in the basal layer can be shed through the fallopian tube to the peritoneal cavity during menses, and can establish endometriotic implants [11]. This view is not only supported by findings of a clonal origin of endometrial glands and cultured endometrial cells [12], but also by the demonstration of stem cell marker gene expression, including pluripotencyassociated transcription factors (e.g. Oct4, nanog, KLF4 and Sox2 [13,14]) and adult stem cell markers (e.g. CD146, CD73, CD90, notch1 and Msil [15]). To date, however, no direct evidence has been reported for the role of endometrial stem/progenitor cells in the pathogenesis of
http://dx.doi.org/10.1016/j.ejogrb.2014.04.001 0301-2115/ß 2014 Elsevier Ireland Ltd. All rights reserved.
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 2
T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
human endometriosis. Several lines of experimental evidence suggest that these cells play a role in the development of endometriosis [16–18]. However, the stem cells in these studies were derived from bone marrow or extra-uterine implants of endometriotic models. Micro-array analysis has demonstrated that the gene expression profile from eutopic endometrium of patients with endometriosis differs from that of unaffected controls [17,19,20]. Taken together, these data suggest that the presence of endometriotic implants can alter gene expression profiles within the eutopic endometrium and, by extension, the function of eutopic endometrial tissue. This study found endometrial stem cells in eutopic endometrium of women with endometriosis, and aimed to determine the pathogenesis of endometriosis. Materials and methods Human tissues Human endometrium samples in situ were collected from 21 sterile women, aged 24–42 years [mean standard error (SEM) 32.3 1.2 years], who had been diagnosed with endometriosis but had not taken any exogenous hormones for the 3 months preceding laparoscopy. The study protocol was approved by the Ethics Committee of Tongji Hospital, and informed written consent was obtained from each patient. All endometrial samples were collected in the proliferative phase. The samples were stored in phosphate buffered saline (PBS; pH 7.2) containing 100 IU/ml penicillin G sodium and 100 mg/ml streptomycin sulphate (Sigma–Aldrich, St. Louis, MO, USA) at 4 8C, and processed within 2–18 h. Preparation of single cell suspensions of human endometrial epithelial and stromal cells As soon as the samples were delivered to the laboratory, the endometrial tissue was cut into 1–2 mm3 pieces with sharp scissors and incubated with 0.1% collagenase type IA (GIBCO-BRL) in a humidified 5% CO2/95% air atmosphere at 37 8C. After 1 h, the cell suspensions were filtered using a 40-mm sieve to separate single cells from debris and uncatabolized myometrial tissue fragments. The filtrates were centrifuged at 250 g for 5 min to collect cells. To remove erythrocytes, the cells were resuspended in HEPES-buffered DMEM, supplemented with 10% fetal bovine serum (PAA Laboratories) and 2.5 ml Ficoll-Paque (Pharmacia Biotechnology, Uppsala, Sweden), and centrifuged for 8–10 min at 390 g. Endometrial epithelial cells were obtained by positive selection using BerEP4-coated magnetic Dynabeads (Dynal Biotech, Oslo, Norway). The stromal cells were obtained by negative selection using anti-CD45 antibody-coated Dynabeads for removal of leukocytes, as described by Chan et al. [3]. In vitro colony-forming assay To test the clonogenicity of isolated cells, endometrial epithelial and stromal cells were treated with 0.05% trypsin/0.2% EDTA (PAA Laboratories). In order to obtain single cell suspensions, these cells were adjusted to clonal densities of 20, 50, 100 and 200 cells/cm2, and seeded in 60-mm Petridishes coated with fibronectin 10 mg/ ml (Becton Dickinson, Franklin Lakes, NJ, USA). Cells were cultured in DMEM medium supplemented with 10% fetal bovine serum, 2 mM L-glutamine and antibiotics. The cultures were incubated for 15 days at 37 8C in 5% CO2, and the medium was refreshed every 3– 4 days. Each day, the cells were monitored microscopically to ensure the single cell origin of the clones. At the end of the 15-day incubation period, the cells were washed three times with PBS (pH 7.2) and stained with 0.5% toluidine blue following routine
histological techniques. Clusters of cells were considered to be colonies when they were visible macroscopically and contained >50 cells. Colonies were counted and cloning efficiency (CE) was determined using the formula CE (%) = (number of colonies/ number of cells seeded) 100%. Results are shown as mean SEM SEM of six patient samples. Immunocytochemistry Immunocytochemistry was performed on large clonally derived epithelial and stromal cells. Briefly, the cultured cells were detached and the cell suspension was removed before the sediment was mixed with two to three drops of plasma and two drops of thrombin for 1 min, followed by the addition of 4% buffered formalin to the coagulated cell mass, which was then fixed for 30 min. The sections were deparaffinized in xylene and microwaved in 10 mmol/l citrate buffer (pH 6.0) to unmask the epitopes. Sections were incubated at 4 8C overnight with antibodies raised against CK (goat polyclonal IgG, Santa Cruz Biotechnology, Dallas, TX, USA) and vimentin (goat polyclonal IgG, Santa Cruz Biotechnology), both diluted 1:100. After several washes, the sections were incubated with a peroxidase-labelled polymer, conjugated with diluted (1:200) anti-goat biotinylated antibodies (Vector Laboratories), for 30 min. DAB (Vector Laboratories) was used as a chromogen, and haematoxylin was used as a nuclear counter stain. Known CK- or vimentin-positive seminoma was used as a positive control, and the same concentration of nonimmune goat IgG was used as a negative control. Only cytoplasmic staining was considered as CK or vimentin positive. Each section was scanned using 400 magnification. Three observers evaluated the staining pattern separately and scored the staining intensity signal of each specimen (absent, 0; weak, 1; moderate, 2; strong, 3). On average, 10 sections were observed for each human sample. Western blot analysis Clonal epithelial and stromal cells were lysed with ice-cold RIPA buffers containing freshly added protease inhibitors (Sigma– Aldrich) to detect expression of each protein. After centrifugation, 100 mg of proteins was subjected to SDS-polyacrylamide gel electrophoresis and transferred on to a nitrocellulose membrane in a semi-dry transfer cell (Bio Rad Laboratories, Hercules, CA, USA). Primary antibodies, including anti-EMA (1:1000 diluted), anti-CK (1:2000 diluted), anti-CD49f (1:1000 diluted), anti-THY-1(CD90) (1:500 diluted), anti-collagen type I (1:1000 diluted), anti-5B5 (1:1000 diluted) and anti-vimentin (1:1000 diluted) polyclonal antibodies, were obtained from Santa Cruz Biotechnology Inc. After incubation with each diluted primary antibody at 4 8C overnight, the blots were incubated with horseradish-peroxidase-linked antirabbit antibodies and analyzed using a Hyperfilm-enhanced chemiluminescence detection kit (Amersham Bioscience, Chalfont St Giles, UK). Quantitative real-time polymerase chain reaction analysis Total RNA from clonal epithelial and stromal cells was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with the manufacturer’s instructions. The transcription levels of epithelial and stromal stem cell phenotypic surface markers EMA, CK, CD49f, THY-1(CD90), collagen type I, 5B5 and vimentin were determined by real-time polymerase chain reaction (PCR) using the Applied Biosystems StepOne Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA). The PCR reactions were performed in a total volume of 20 ml/well containing the SYBR master mix reagent kit (Applied Biosystems) using primers shown in Table 1. Relative quantification of DNA of interest was calculated according
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx Table 1 Primer sequences. Sequence (50 to 30 )
Gene name EMA CK CD49f THY-1(CD90) Collagen type I 5B5 Vimentin GAPDH
Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense Sense Antisense
TGGATGTGCTTGATAAGCGG ACCATGTCCTTTCCAGTGTGT GGTCATGGCCGAGCAGAA TTCAGTCCGGCTGGTGAAC CCTGCTGCTGCTCCTCACA GTAACAACTGTTGCGGGTTTAGG ATCGCTCTCCTGCTAACAGTC CTCGTACTGGATGGGTGAACT AATCCTCTCGTCAAAACTGAAGG CCATCTCGCTTATCCAACAATGA TGACAGCGACAAGAAGTG CAGTGAAGCGGTACATAGG CCAAACTTTTCCTCCCTGAACC GTGATGCTGAGAAGTTTCGTTGA GGCTCTCCAGAACATCATCC TGTCATCATATTTGGCAGGT
GAPDH, glyceraldehyde phosphate dehydrogenase.
to the DCt method using glyceraldehyde phosphate dehydrogenase as an endogenous control. Statistical analysis Data (mean SEM) were analyzed using unpaired t-test to determine the statistical significance between two groups. p < 0.05 was considered to indicate significance. Results Clonal culture and clonogenicity of human endometrial epithelial and stromal cells Single cell suspensions of human endometrial epithelial and stromal cells were seeded at densities of 20, 50, 100 and 200 cells/ cm2 in serum medium. Cell growth was monitored by microscopy to ensure that each colony originated from a single cell. Some individual stromal cell epithelium started proliferating after 3–4 days and formed small clusters after 6–8 days in culture. After incubation for 15 days, small and large colonies were observed (Fig. 1A and B). Small colonies had either stopped proliferating or increased in size slowly, while the growth of large colonies, which contained more than 10,000 cells, increased dramatically around 10–12 days. Large epithelial cell colonies contained small, densely packed cells (Fig. 1C), which consisted of epithelium-like cells at
3
the periphery and rather small round cells in the centre. Large stromal cell colonies had tightly packed cells with a dense centre and an overall swirly appearance (Fig. 1D). CE (mean SEM) was 8.8% 0.2% (n = 21), 15.7% 0.4% (n = 21), 7.2% 0.57% (n = 21) and 5.1% 0.21% (n = 21) for epithelial cells (Fig. 1E), and 7.1% 0.16% (n = 21), 14.8% 0.6% (n = 21), 11.6% 0.65% (n = 21) and 3.5% 0.2% (n = 21) (Fig. 1F) for stromal cells when the cells were seeded at concentrations of 20, 50, 100 and 200 cells/cm2, respectively. CE was found to differ significantly between cell densities. CK and vimentin expression in large-colony-derived epithelial and stromal cells Immunohistochemistry was used to appraise the stem cell properties of large-colony-derived epithelial and stromal cells. CKand vimentin-positive immunostaining was observed in largecolony-derived epithelial and stromal cells, respectively. CK staining was significantly more intense in large-colony-derived epithelial cells (Fig. 2B) than in other epithelial cells (Fig. 2A) from the same dish (2.76 0.45 vs 1.24 0.31, respectively). Vimentin staining was stronger in large-colony-derived stromal cells (Fig. 2D) compared with other stromal cells (Fig. 2C) from the same dish (2.88 0.22 vs 1.41 0.37, respectively). Phenotype of large-colony-derived epithelial and stromal cells Non-overlapping single epithelial or stromal cell colonies were harvested from culture dishes using 0.025% trypsin (Invitrogen) and cloning rings (Sigma–Aldrich) after 15 days of culture. Serial clonal passaging was organized as cloning plates containing representative clones, with selections of typical large colonies for the subsequent round of cloning indicated within cloning rings, until stem cell activity was exhausted. Large colonies were examined for typical stem cell phenotypic surface markers. A quantitative PCR analysis of epithelial and stromal stem cell marker expression revealed that EMA, CK, CD49f (Fig. 3A), THY1(CD90), collagen type I, 5B5 and vimentin (Fig. 3B) were expressed at high mRNA levels in large-colony-derived epithelial and stromal cells, based on the average DCt values of other cells cultured in the same dish (p < 0.001). Proteins were isolated and analyzed using Western blot analysis to quantitate the proteinic phenotype for large-colonyderived epithelial and stromal cells. As shown in Fig. 4, the epithelial stem cell markers EMA, CK and CD49f and the stromal stem cell markers THY-1(CD90), collagen type I, 5B5 and vimentin
Fig. 1. Clonogenicity of human endometrial cells cultured in vitro. Plates seeded with epithelial (A) or stromal (B) cells at density of 50 cells/cm2. Culture dishes show the distribution of colonies and variation in colony size after 15 days of culture. Magnified view of the centre of typical large epithelial (C) and stromal (D) colonies. The difference in epithelial (E) and stromal (F) cloning efficiencies at different cell densities was found to be significant (*p < 0.01; **p < 0.05; ***p < 0.001).
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
4
Fig. 2. Immunocytochemistry results. CK staining was significantly more intense in large-colony-derived epithelial cells (B) than other epithelial cells (A) from the same dish. Staining for vimentin was stronger in large-colony-derived stromal cells (D) than other stromal cells (C) from the same dish.
Fig. 3. mRNA expression of surface markers. The mRNA expression of each stem cell phenotypic surface marker was higher in large-colony-derived epithelial (A) and stromal (B) cells than other cells cultured in the same dish ($~ §~ p < 0.05).
were expressed at high protein levels in large-colony-derived epithelial or stromal cells in the same manner as mRNA expression described above. Comments Stem cells are undifferentiated cells that have the ability to selfrenew and to produce more differentiated daughter cells [21,22]. Broadly, they can be divided into two categories: embryonic and
adult. Embryonic stem cells are found in the inner cell mass of the blastocyst [23,24]. Adult stem cells, derived from postembryonic cell lineages, have been described in a number of different organ systems and have been best characterized in the haematopoietic system [18,25]. The biological and clinical implications of stem cells have become a research focus in recent years. However, this field is relatively new and is not completely understood. Emerging evidence suggests that human and mouse endometrium may
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
5
Fig. 4. Protein levels of epithelial and stromal cell surface markers. (A) EMA, CK and CD49f protein expression in large-colony-derived epithelial cells analyzed by Western blot. Quantitative data were analyzed for density scanning (objective protein/glyceraldehyde phosphate dehydrogenase). (B) Protein expression of each epithelial stem cell phenotypic surface marker was higher in large-colony-derived epithelial cells than other epithelial cells cultured in the same dish ($~ p < 0.05). (C) THY-1, collagen type I, 5B5 and vimentin protein expression in large-colony-derived stromal cells analyzed by Western blot. Quantitative data were analyzed for density scanning (objective protein/glyceraldehyde phosphate dehydrogenase). (D) Protein expression of each stromal stem cell phenotypic surface marker was higher in large-colony-derived stromal cells than other stromal cells cultured in the same dish ($§ ~ p < 0.05).
contain adult stem cells [21,26,27]. Two cell types were identified from cultured endometrial cells: epithelial and mesenchymal stem cells [28,29]. Endometrial stem cells are likely to play an important role in physiological and pathological uterine biology [30]. Physiologically, they are likely to be involved in the response to tissue injury and disease. However, they may also be involved in the pathology of the reproductive tract, such as endometriosis. Disorders of endometriosis are common, and symptoms often include pelvic pain and infertility [31]. The incidence of endometriosis is between 6% and 10% of all women and 35–50% of women with pelvic pain and infertility [11,32]. Notwithstanding its common occurrence and despite the substantial public health burden of this condition, little is known about its pathogenesis. In combination with the findings that the endometrium basalis contains endometrial stem/progenitor cells [33,34] and that some women have retrograde peritoneal cavities [35], it is possible that more severe endometriotic lesions may develop from endometrial stem/progenitor cells, while lesions that resolve may develop from mature transit amplifying cells [10]. Epithelial cells in some endometriotic lesions are monoclonal, suggesting a single cell origin, possibly an endometrial stem/progenitor cell. Other endometriotic lesions are polyclonal, suggesting contamination with polyclonal stromal cells, repeated seeding of the lesion with
cells from other sources (e.g. bone marrow) or establishment from different fragments of shed endometrium containing several stem/ progenitor cells [10,18,36,37]. Leyendecker et al. [38] showed that significantly more basalis layers are shed in the menstrual flow, suggesting an increased number of stem cells in this layer that may result in a propensity for endometriosis. To explore an alternative hypothesis that extra-uterine stem/ progenitor cells function in the pathogenesis of endometriosis, Du and Taylor generated an experimental model to test whether extra-uterine-derived cells could track and populate endometriotic implants [39]. Endometriosis was generated experimentally by ectopic wild-type endometrial implantation in the peritoneal cavity of hysterectomized LacZ transgenic mice. LacZ-expressing stem cells of extra-uterine origin were incorporated into the endometriosis implants, and were capable of differentiating between epithelial and stromal cell lineages at a frequency of 0.04% and 0.1%, respectively. Extra-uterine stem/progenitor cells, derived from the bone marrow or an alternative source, are likely to travel to distant ectopic sites via the lymphovascular spaces [10]. However, the existence and properties of adult stem cells in eutopic endometrium of women with endometriosis is not clear. As genetic profile and pathological features are very important in
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
G Model
EURO-8516; No. of Pages 6 T. Li et al. / European Journal of Obstetrics & Gynecology and Reproductive Biology xxx (2014) xxx–xxx
6
the occurrence of endometriosis [16,19,37], there is a need to demonstrate adult stem cells in eutopic endometrium. To the authors’ knowledge, this is the first study to shows that freshly isolated single endometrial epithelial and stromal cells initiate large colonies with high proliferative potential, and produce millions of cells in vitro. After 15 days of culture, large epithelial and stromal colonies were observed at a density of 50 cells/cm2 (p < 0.05). Furthermore, several epithelial and stromal stem cell phenotypic surface markers were detected to confirm the stem cell phenotype and properties of these large-colony-forming cells. This represents very important evidence for the existence of adult stem cells in eutopic endometrium of women with endometriosis. Nevertheless, the number of stem/progenitor cell types in the human endometrium, how they differ in phenotype and function, and interactions with their stem cell niche remain to be determined. Such knowledge will enhance our understanding of the predominant stem cell hypotheses, and has the potential to provide cell-based therapeutic strategies for endometriosis. Conflict of interest We declare no any interest conflict. Funding This study was supported by the National Natural Science Foundation of China (No. 81000240). References [1] Seli E, Berkkanoglu M, Arici A. Pathogenesis of endometriosis. Obstet Gynecol Clin North Am 2003;30:41–61. [2] Du H, Taylor HS. Stem cells and reproduction. Curr Opin Obstet Gynecol 2010;22:235–41. [3] Chan RW, Schwab KE, Gargett CE. Clonogenicity of human endometrial epithelial and stromal cells. Biol Reprod 2004;70:1738–50. [4] Deane JA, Gualano RC, Gargett CE. Regenerating endometrium from stem/ progenitor cells: is it abnormal in endometriosis, Asherman’s syndrome and infertility? Curr Opin Obstet Gynecol 2013;25:193–200. [5] Maruyama T, Yoshimura Y. Stem cell theory for the pathogenesis of endometriosis. Front Biosci (Elite Ed) 2012;1:2854–63. [6] Chen S, Do JT, Zhang Q, et al. Self-renewal of embryonic stem cells by a small molecule. Proc Natl Acad Sci USA 2006;103:17266–71. [7] Golestaneh N, Kokkinaki M, Pant D, et al. Pluripotent stem cells derived from adult human testes. Stem Cells Dev 2009;18:1115–26. [8] Patel AN, Park E, Kuzman M, Benetti F, Silva FJ, Allickson JG. Multipotent menstrual blood stromal stem cells: isolation, characterization, and differentiation. Cell Transplant 2008;17:303–11. [9] Gargett CE, Masuda H. Adult stem cells in the endometrium. Mol Hum Reprod 2010;16:818–34. [10] Sasson IE, Taylor HS. Stem cells and the pathogenesis of endometriosis. Ann N Y Acad Sci 2008;1127:106–15. [11] Dimitrov R, Timeva T, Kyurkchiev D, et al. Characterization of clonogenic stromal cells isolated from human endometrium. Reproduction 2008;135:551–8. [12] Pacchiarotti A, Caserta D, Sbracia M, Moscarini M. Expression of oct-4 and c-kit antigens in endometriosis. Fertil Steril 2011;95:1171–3.
[13] Park JH, Daheron L, Kantarci S, Lee BS, Teixeira JM. Human endometrial cells express elevated levels of pluripotent factors and are more amenable to reprogramming into induced pluripotent stem cells. Endocrinology 2011;152:1080–9. [14] Schwab KE, Hutchinson P, Gargett CE. Identification of surface markers for prospective isolation of human endometrial stromal colony-forming cells. Hum Reprod 2008;23:934–43. [15] Taylor HS. Endometrial cells derived from donor stem cells in bone marrow transplant recipients. J Am Med Assoc 2004;292:81–5. [16] Taylor RN, Lundeen SG, Giudice LC. Emerging role of genomics in endometriosis research. Fertil Steril 2002;78:694–8. [17] Masuda H, Matsuzaki Y, Hiratsu E, et al. Stem cell-like properties of the endometrial side population: implication in endometrial regeneration. PLoS ONE 2010;5:e10387. [18] Giudice LC. Application of functional genomics to primate endometrium: insights into biological processes. Reprod Biol Endocrinol 2006;4(Suppl. 1):S4. [19] Wu Y, Strawn E, Basir Z, et al. Genomic alterations in ectopic and eutopic endometria of women with endometriosis. Gynecol Obstet Invest 2006;62:148–59. [20] Gargett CE. Uterine stem cells: what is the evidence? Hum Reprod Update 2007;13:87–101. [21] Bongso A, Richards M. History and perspective of stem cell research. Best Pract Res Clin Obstet Gynaecol 2004;18:827–42. [22] Choo AB, Tan HL, Ang SN, et al. Selection against undifferentiated human embryonic stem cells by a cytotoxic antibody recognizing podocalyxin-like protein-1. Stem Cells 2008;26:1454–63. [23] Thomson JA, Itskovitz-Eldor J, Shapiro SS, et al. Embryonic stem cell lines derived from human blastocysts. Science 1998;282:1145–7. [24] Gonzalez R, Griparic L, Vargas V, et al. A putative mesenchymal stem cells population isolated from adult human testes. Biochem Biophys Res Commun 2009;385:570–5. [25] Li L, Clevers H. Coexistence of quiescent and active adult stem cells in mammals. Science 2010;327:542–5. [26] Cervello I, Mirantes C, Santamaria X, Dolcet X, Matias-Guiu X, Simon C. Stem cells in human endometrium and endometrial carcinoma. Int J Gynecol Pathol 2011;30:317–27. [27] Gargett CE, Schwab KE, Zillwood RM, Nquyen HP, Wu D. Isolation and culture of epithelial progenitors and mesenchymal stem cells from human endometrium. Biol Reprod 2009;80:1136–45. [28] Pittenger MF, Mackay AM, Beck SC, et al. Multilineage potential of adult human mesenchymal stem cells. Science 1999;284:143–7. [29] Du H, Taylor HS. Stem cells and female reproduction. Reprod Sci 2009;16:126– 39. [30] Sensky TE, Liu DT. Endometriosis: associations with menorrhagia, infertility, and oral contraceptives. Int J Gynaecol Obstet 1980;17:573–6. [31] Giudice LC, Kao LC. Endometriosis. Lancet 2004;364:1789–99. [32] Surrey ES, Schoolcraft WB. Management of endometriosis-associated infertility. Obstet Gynecol Clin North Am 2003;30:193–208. [33] Padykula HA, Coles LG, Okulicz WC, et al. The basalis of the primate endometrium: a bifunctional germinal compartment. Biol Reprod 1989;40:681–90. [34] Schwab KE, Chan RW, Gargett CE. Putative stem cell activity of human endometrial epithelial and stromal cells during the menstrual cycle. Fertil Steril 2005;84(Suppl. 2):1124–30. [35] Halme J, Hammond MG, Hulka JF, Raj SG, Talbert LM. Retrograde menstruation in healthy women and in patients with endometriosis. Obstet Gynecol 1984;64:151–4. [36] Maruyama T, Masuda H, Ono M, Kajitani T, Yoshimura Y. Human uterine stem/ progenitor cells: their possible role in uterine physiology and pathology. Reproduction 2010;140:11–22. [37] Di W, Guo SW. The search for genetic variants predisposing women to endometriosis. Curr Opin Obstet Gynecol 2007;19:395–401. [38] Leyendecker G, Herbertz M, Kunz G, Mall G. Endometriosis results from the dislocation of basal endometrium. Hum Reprod 2002;17:2725–36. [39] Du H, Taylor HS. Contribution of bone marrow-derived stem cells to endometrium and endometriosis. Stem Cells 2007;25:2082–6.
Please cite this article in press as: Li T, et al. Isolation and identification of epithelial and stromal stem cells from eutopic endometrium of women with endometriosis. Eur J Obstet Gynecol (2014), http://dx.doi.org/10.1016/j.ejogrb.2014.04.001
