DNA AND CELL BIOLOGY Volume 9, Number 3, 1990 Mary Ann Lieber). Inc., Publishers Pp. 213-220

Isolation and Expression of the Full-Length cDNA Encoding CD59 Antigen of Human Lymphocytes RITSUKO SAW ADA, KENSAKU OHASHI, HIROYUKI ANAGUCHI, HITOAKI OKAZAKI,* MASAKAZU HATTORI.t NAGAHIRO MINATO,* and MASANOBU NARUTO

ABSTRACT To identify the primary structure of CD59 antigen and to elucidate its function, a full-length cDNA clone of CD59 was isolated. The cDNA sequence contained an open reading frame that encodes an 128-amino-acid peptide. The amino-terminal 25 amino acids represented a typical signal peptide sequence and the carboxyterminal hydrophobic amino acids were characteristic for phosphatidylinositol-anchored proteins. The predicted mature protein sequence showed 35% homology with murine Ly-6C.l and 31% with Ly-6A.2. The number and the distribution of cysteine residues were conserved, implying that the CD59 represented a human homologue of murine Ly-6. RNA blot hybridization analysis revealed the expression of CD59 mRNA in placen tal, lung, and pancreatic tissues. The mRNA was not only expressed in T-cell lines but in some of monocytic, myeloid, and B-cell lines. In all of these tissues and cell lines, at least four mRNA species were detected. DNA blot hybridization analysis revealed a rather simple genomic structure, which suggested a single gene as compared with the complex multigene family of murine Ly-6.

INTRODUCTION defined by

CD59 (Stefanová Leukocyte

of

a

MEM-43 monoclonal

antibody

ai, 1989; 4th International Workshop Differentiation Antigens at Vienna, 1989) is et

a glycoprotein of 18-20 kD expressed on a wide range of leukocytes and lymphocytes; it represents a member of recently accumulating phosphatidyl-inositol (Pl)-anchored proteins. Examination of the amino-terminal amino acid

sequence revealed that 5 out of 6 amino-terminal amino acids were identical to those of murine Ly-6C (Stefanová et ai, 1989). These results imply that CD59 may be the human homologue of murine Ly-6. Murine Ly-6 antigens are also Pl-anchored proteins expressed on the various lymphohematopoietic cells. Recently, cDNAs for murine Ly-6 antigens (LeClair et ai, 1986; Palfree et ai, 1987, 1988) as well as a chromosomal gene of Ly-6C.l (Bothwell et ai, 1988) were cloned, and this revealed that Ly-6 represented a multigene family encoded on murine chromosome 15 (LeClair et ai, 1987). Ly-6 antigens function as signal-transducing molecules on

T cells along with CD2, CD3, and Thy-1 (Malek et ai, 1986; Havran et ai, 1988), although a physiological ligand is yet to be seen. The entire structure and the functions of human CD59 have not yet been determined. Elucidation of the primary structure of CD59 may permit functional studies of this molecule in human lymphoid and myeloid cells. We have already reported the partial sequence of cDNA of CD59, which was cloned by the polymerase chain reaction (PCR) technique (Sawada et ai, 1989). In this paper, we report the isolation and chracterization of a full-length CD59 cDNA from a peripheral blood monocyte cDNA library. The sequence analysis supported the idea that CD59 was a human equivalent of murine LY-6, in that the deduced amino acid sequence showed around 30% homology with Ly-6 with conserved 10 cysteine residues. Southern hybridization experiments, however, revealed that CD59 had rather simple genomic structure compared with the complex multigene family of murine LY-6.

Basic Research Laboratories, Toray Industries, Inc., 1111 Tebiro, Kamakura 248, Japan. 'Division of Clinical Immunology, Jichi Medical School, Tochigi 329-04, Japan. tDepartment of Veterinary Medicine, Hokkaido University, Sapporo 060, Japan.

213

214

SAW ADA ET AL.

„

cDNA

MATERIALS AND METHODS

Partial cDNA cloning by Based

on

PCR

the amino-terminal amino acid sequence of

purified MEM-43 antigen (Stefanová et ai, 1989), pared an oligonucleotide mixture, Ly61.

we

pre-

Ly61: CAATGTTATAATTGTCC G

C

C

C

C

Ly61 (17-mer) and oligo(dT) (15-mer) as priperformed on double-stranded cDNAs of human peripheral blood leukocytes (PBL) and human monocytic leukemia cell line Jill. The cDNAs were prepared from 5 /tg of poly(A)+RNA of PBL and Jill cells according to previously desribed method (Gubler and Hoffman, 1983). One-third of the synthesized cDNA was used in a PCR reaction with 2.5 units of Taq polymerase (Cetus Corp., Emeryville, CA). Double 40 cycles of PCR were done as described (Saiki et ai, 1988) in a DNA thermal cycler (Perkin Elmer-Cetus Corp.). Denaturation at 94°C for 1 min, annealing at 40°C for 2 min, and extension at 72°C for 3 min were performed sequentially. In the final cycle, extension time was prolonged to 7 min. The amplified PCR products were then inserted in vector CDM8 (Seed, 1987) after fractionation and screened with other oligonucleotide Ly62 (Sawada et ai, 1989).

expression

An Eco Rl-Bam HI fragment of cloned cDNA was subcloned into the expression vector pcDL-SR«296 (Takebe et ai, 1988) producing pSRaCD59. Monkey COS-1 cells were transfected with purified plasmid DNA(pSRaCD59) by the DEAE-dextran method (Sompayac and Danna, 1981). After 48 hr, the cells were detached by incubation in 0.5 mM EDTA, 0.02% azide, PBS and analyzed by indirect immunofluorescence and flow cytofluorometry.

PCR with the mers was

Pi-specific phospholipase

C

(PI-PLC)

treatment

Murine A31 cells were co-transfected with pSRaCD59 and pSV2-neo (Southern and Berg, 1982). Then G418-resistant cells were isolated and several CD59 antigen highexpression clones were established. The transformants were detached as described above, suspended in RPMI1640 medium (1 x 106 cells/ml) containing 5% BSA, and incubated for 1 hr at 37°C in the presence or absence of 100 mU/ml of PI-PLC (Funakoshi Pharmaceutical Co., Ltd., Japan). The cells were washed twice with PBS and the presence of the CD59 antigen was examined by indirect immunofluorescence and flow cytofluorometry.

RNA

blotting

Total RNA was isolated with 4 M guanidine isothiocyanate, and purification occurred through a 5.7 M CsCl step

cDNA

library screening

A cDNA library (XgtlO) prepared from LPS-activated human peripheral blood monocytes was purchased from the Clontech Laboratories, Inc. (Palo Alto, CA). Recombinant phages were plated, and nitrocellulose filter lifts were taken in duplicate, soaked for 2 min in 0.5 A/NaOH, 1.5 M NaCl, 5 min in 0.5 M Tris pH 8.0, 1.5 M NaCl in 2x SSC, and then dried and baked for 2 hr at 80° C under vacuum. The filters were prehybridized for 2 hr at 65°C in 5x Denhardt's 5x SSPE, 0.1% NaDodSG,, 0.1 mg/ml carrier DNA (Maniatis et ai, 1982). The 350-bp insert of CDM8-P1 (Sawada et ai, 1989) was nick-translated to a specific activity of 1 x 108 cpm/fig. The probe was denatured by boiling for 5 min and added to the filters. After hybridization for 15 hr at 65°C, filters were washed with several changes of 2x SSC, 0.1% NaDodS04 at 50°C, dried, and exposed to Kodak XAR-5 film (Kodak, Rochester, NY). Positive clones were isolated by two further rounds of hybridization.

DNA

gradients. Poly(A)*RNA was purified on oligo(dT)-cellu(Collaborative Research, Bedford, MA). Human brain, kidney, placenta, and lung poly(A)*RNA were purchased from the Clontech Laboratories, Inc. (Palo Alto, Ca). Total RNA (5 fig) or poly(A)+RNA (1 ^g) samples were electrophoresed in 1% agarose gels containing formaldehyde and transferred to nylon filter. Hybridization was performed at 65°C in the same buffer and with the same probe as cDNA screening. Following hybridization, the fillose

ters were washed with 2 x SSC/.0.1%

DNA

NaDodS04

at 50°C.

blotting

Genomic DNA was isolated from human placenta as described (Maniatis et ai, 1982). The genomic DNA (15 ¿tg) was digested for 15 hr at 37°C with Eco RI, Hind III, and Bam HI, electrophoresed, and transferred to nylon filter. Hybridization was performed at 68°C in the same buffer and with the same probe as cDNA screening. Following hybridization, the filter was washed with 2x SSC/0.1% NaDodS04 at 60°C.

sequencing

Inserts from the positive XgtlO clones were subcloned into plasmid vector pUC19. Appropriate restriction fragments were prepared and subcloned into pUC19. DNA sequence analysis was performed by the dideoxy chain-termination method (Sanger et ai, 1977). The entire sequence was determined on both strands.

RESULTS Isolation of human CD59 cDNA and deduced

primary protein We have cloned

structure

partial cDNA for CD59 by PCR techusing synthetic oligonucleotide mixture correspondnique

ISOLATION AND EXPRESSION OF CD59 cDNA

215

the amino-terminal amino acid sequence (Stefanová transfected COS-1 cells. This analysis proved that the as primers. The PCR was percDNA encoded the CD59 molecule. As is also shown in formed on double-stranded cDNA from human peripheral Fig. 2B, the expressed antigen was cleaved by the treatblood leukocytes and human Jill cells. The PCR products ment with PI-PLC (phosphatidylinositol-specific phosphowere subcloned into the vector CDM8 (Seed, 1987) and lipase C), indicating that the CD59 antigen on the transforscreened with the synthetic oligonucleotide. The cDNA se- mants was indeed anchored in the plasma membrane quence of clone PI from human peripheral blood leuko- through PI. cytes has been reported (Sawada et al, 1989), and a schematic of cDNA of clone J6 from human Jill cells is RNA and DNA blotting shown in Fig. 1A. To isolate full-length cDNA for CD59 antigen we RNA blot hybridization was performed to study the exscreened an LPS-activated human monocyte cDNA library pression of CD59 mRNA in human tissues and cell lines. using the partial cDNA fragment (PI) as a probe under Total RNA or poly(A)+RNA was hybridized with 32P-lahigh-stringency conditions. Two independent positive beled CD59 cDNA probe. As shown in Fig. 3, the CD59 clones R5 and R18 were isolated from 1 x 106 plaques. transcripts were detected in placenta, lung, pancreas, tonEach insert of the two positive clones, R5(1.4 kb) and R18- sil, and peripheral blood lymphocytes (PBI), while no tran(1.7 kb), was subcloned into pUC19 and was subjected to script was observed in brain and kidney. High-level expresfurther analysis. The cDNA sequence of the longer clone sion was observed in monocyte cell line Jill. Low-level exR18 is shown in Fig. IB. Clone R5 had an additional 5' un- pression was observed in T-cell line Jurkat, in myeloid cell translated region which did not overlap the 5' end of R18. lines HL60 and ML3, and in erythroid cell line K562. Very Both clones had the same open reading frame of 384 nu- low-level expression was detected in Daudi cells, a B-cell cleotides encoding a predicted polypeptide of 128 amino line (data not shown). No transcript was detectable in myeacids. The first 25 residues of the predicted polypeptide loid cell lines KG1 and U937. In all cases multiple CD59 represented a characteristic signal peptide sequence with an mRNA species were identified, including 0.9, 1.3, 1.8, and initiator methionine. The following 17 amino acid residues 2.0 kb. These multiple bands might be explained by the completely matched to the determined amino-terminal se- fact that poly(A) tail addition was discovered at three difquence of CD59 antigen (Stefanová et al., 1989). The puta- ferent positions, 553, 1,101, and 1,672 (Fig. IB), and that tive mature protein consisted of 103 amino acids including clone R5 had additional 5' untranslated sequence comtwo potential N-glycosylation sites (Asn-8, Asn-18). The pared with R18. The human CD59 cDNA showed no cross-hybridization sequence had a long stretch of hydrophobic residues at the carboxyl terminus, which is typically found in Pi-linked with the transcripts of murine LGL line SPB2.4 (Hattori et molecules (Berger et al, 1988). A poly(A) addition signal al, 1987), which expressed large amount of Ly-6C.l sequence (AATAAA) was found 110 bp downstream from mRNA. the termination codon (TAA) and clone J6 had the To analyze the DNA of CD59 in the human genome, poly(A) tail at position 553 (position number R18 in Fig. DNA blot analysis was performed. Human placental DNA IB). However, both R5 and R18 read through the typical was digested to completion with Eco RI, Hind III, and poly(A) signal, and poly(A) tails were added at different Bam HI. As shown in Fig. 4, this analysis gave a simple positions, 1,101 and 1,672, respectively. Alternative pattern in both high-or low-stringency conditions, consispoly(A) signals were recognized at around 1,036 and 1,641. tent with a single-copy gene. The CD59 nucleotide sequence and the predicted peptide sequence were analyzed for homology to reported sequences in GenBank (release 60.0) and NRBF (release Comparison of human CD59 and murine Ly-6 20.0). No significant homologies at the nucleotide and Based on the biochemical and immunohistochemical peptide levels were noted except for about 30% peptide sestudies, the CD59 molecule has been considered to be the quence homology with murine Ly-6 as described below. human homologue of murine Ly-6C. After excluding the signal peptide sequence, we then compared the putative mature peptide sequence of CD59 with that of murine Ly6C.1 (Fig. 5). When the positions of cysteine (C) residues and CD59 cDNA Expression identification of were aligned with the GENETYX program (Software DeTo confirm that the peptide encoded by the cloned velopment Co., Tokyo), the homology was 35%. That was CD59 cDNA was a functional surface molecule, we trans34% with Ly-6C2 and 32% with Ly-6A and Ly-6E (data fected COS-1 cells with a eukaryotic high-expression vecnot shown). Although the overall homology was not high, tor, pcDL-SRa296 (Takebe et al, 1988), containing the the number of cysteines was same and the distribution of cysteine was almost identical. coding region of the cDNA. After 48 hr, cells were assayed for transient expression In the murine Ly-6 family, it was suggested that the site of CD59 antigen by indirect immunofluorescence method of attachment of Pi-linkage would be the asparagine (N) at •v' with MEM-43 monoclonal antibody (Stefanová et al, position 76 in Ly-6C and at position 79 in Ly-6A/E 1989) using flow cytofluorometry. As shown in Fig. 2A, (Williams et al, 1988). In human CD59, this proximal reanti-CD59 monoclonal antibody specifically stained the gion is highly conserved, and thus it seems most likely that

ing to

et

al., 1989) and oligo(dT)

SAWADA ET AL.

216

(A)

EP

y

B

P

B

P

E

l_j_Lj_i_i

R18 -An J6

-An

lÖObp (B)

GGCGCCGCCAGGTTCTGTGGACAATCACA

29

ATG GGA ATC CAA GGA GGG TCT GTC CTG TTC GGG CTG CTG CTC GTC CTG GCT GTC TTC TGC Met Gly Ile Gin Gly Gly Ser Val Leu Phe Gly Leu Leu Leu Val Leu Ala Val Phe Cys -25

89

CAT TCA GGT CAT AGC CTG CAG TGC TAC AAC TGT CCT AAC CCA ACT GCT GAC TGC AAA ACA His Ser Gly His Ser Leu Gin Cys T.yr Asn Cys Pro Asn Pro Thr Ala Asp Cys Lys Thr -1+1 15 O

149

GCC GTC AAT TGT TCA TCT GAT TTT GAT GCG TGT CTC ATT ACC AAA GCT GGG TTA CAA GTG Ala Val Asn Cys Ser Ser Asp Phe Asp Ala Cys Leu Ile Thr Lys Ala Gly Leu Gln Val 35 O

209

TAT AAC AAG TGT TGG AAG TTT GAG CAT TGC AAT TTC AAC GAC GTC ACA ACC CGC TTG AGG Tyr Asn Lys Cys Trp Lys Phe Glu His Cys Asn Phe Asn Asp Val Thr Thr Arg Leu Arg 55

269

GAA AAT GAG CTA ACG TAC TAC TGC TGC AAG AAG GAC CTG TGT AAC TTT AAC GAA CAG CTT Glu Asn Glu Leu Thr Tyr Tyr Cys Cys Lys Lys Asp Leu Cys Asn Phe Asn Glu Gin Leu 75

329

GAA AAT GGT GGG ACA TCC TTA TCA GAG AAA ACA GTT CTT CTG CTG GTG ACT CCA TTT CTG Glu Asn Gly Gly Thr Ser Leu Ser Glu Lys Thr Val Leu Leu Leu Val Thr Pro Phe Leu 95

389

GCA GCA GCC TGG AGC CTT CAT CCC TAAGTCAACACCAGGAGAGCTTCTCCCAAACTCCCCGTTCCTGCGTA Ala Ala Ala Trp Ser Leu His Pro 103

460

GTCCGCTTTCTCTTGCTGCCACATTCTAAAGGCTTGATATTTTCCAAATGGATCCTGTTGGGAAAGEÄTÄÄ^ATTAGCT

539 618 697 776 855 934 1013 1092 1171 1250 1329 1408 1487 1566 1645

TGAGCAACCTGGCTAAGATAGAGGGGCTCTGGGAGACTTTGAAGACCAGTCCTGTTTGCAGGGAAGCCCCACTTGAAGG AAGAAGTCTAAGAGTGAAGTAGGTGTGACTTGAACTAGATTGCATGCTTCCTCCTTTGCTCTTGGGAAGACCAGCTTTG CAGTGACAGCTTGAGTGGGTTCTCTGCAGCCCTCAGATTATTTTTCCTCTGGCTCCTTGGATGTAGTCAGTTAGCATCA TTAGTACATCTTTGGAGGGTGGGGCAGGAGTATATGAGCATCCTCTCTCACATGGAACGCTTTCATAAACTTCAGGGAT CCCGTGTTGCCATGGAGGCATGCCAAATGTTCCATATGTGGGTGTCAGTCAGGGACAACAAGATCCTTAATGCAGAGCT AGAGGACTTCTGGCAGGGAAGTGGGGAAGTGTTCCAGATAGCAGGGCATGAAAACTTAGAGAGGTACAAGTGGCTGAAA ATCGAGTTTTTCCTCTGTCTTTAAATTTTATATGGGCTTTGTTATCTTCCACTGGAAAAGTGTAATAGCATACATCAAT GGTGTGTTAAAGCTATTTCCTTGCCTTTTTTTATTGGAATGGTAGGATATCTTGGCTTTGCCACACACAGTTACAGAGT GAACACTCTACTACATGTGACTGGCAGTATTAAGTGTGCTTATTTTAAATGTTACTGGTAGAAAGGCAGTTCAGGTATG TGTGTATATAGTATGAATGCAGTGGGGACACCCTTTGTGGTTACAGTTTGAGACTTCCAAAGGTCATCCTTAATAACAA CAGATCTGCAGGGGTATGTTTTACCATCTGCATCCAGCCTCCTGCTAACTCCTAGCTGACTCAGCATAGATTGTATAAA ATACCTTTGTAACGGCTCTTAGCACACTCACAGATGTTTGAGGCTTTCAGAAGCTCTTCTAAAAAATGATACACACCTT TCACAAGGGCAAACTTTTTCCTTTTCCCTGTGTATTCTAGTGAATGAATCTCAAGATTCAGTAGACCTAATGACATTTG TATTTTATGATCTTGGCTGTATTTAATGGCATAGGCTGACTTTTGCAGATGGAGGAATTTCTTGATTAATGTTGAAAAA AAACCCTTGATTATACTCTGTTGGACAAAAAAAAAAAAAAAAAAAA 1691

FIG. 1. Human CD59 cDNA. A. Schematic representation and restriction map of two independent clones of human CD59. J6 was cloned by PCR. R18 was cloned by screening with the partial cDNA as a probe. The closed box indicates the location of the putative signal sequence. The coding region is shown by an open box. Restriction sites used in sequence are indicated as follows: E, Eco RI; B, Bam HI; P, Pst I. An Eco RI site at each end represents the linker site of XgtlO cDNA. B. Nucleotide sequence and deduced amino acid sequence of CD59. The first residue of mature protein is indicated by 1. The sites of potential asparagine-linked glycosylation are marked with lozenges (O)- A polyadenylation signal is boxed. Alternative poly(A) signals can be recognized at around positions 1,036 and 1,641. Amino-terminal amino acids reported previously (Stefanová et al., 1989) are underlined. Clone J6 of 489 nucleotides was completely contained within the sequence of R18 commencing at nucleotide 108, and extends 21 nucleotides beyond the typical poly(A) signal at 526.

ISOLATION AND EXPRESSION OF CD59 cDNA

217

DISCUSSION

(A)

Relative fluorescence

We have cloned and determined the molecular structure of human CD59. The precursor protein encoded by the cDNA consists of 128 amino acids with a typical signal peptide sequence of 25 amino acids (Fig. 1). The aminoterminal 17 amino acid sequence of the predicted mature peptide was completely identical to the reported sequence of purified CD59 antigen (Stefanová et al., 1989). Furthermore, COS-1 cells transfected with the cDNA using a highexpression mammalian vector pcDL-SRa296 (Takebe et al., 1988) were specifically stained with MEM-43 monoclonal antibody (Stefanová et al, 1989; Fig. 2A). These results proved that the cDNA indeed encoded the CD59 anti-

intensity (log )

(B)

gen.

CD59 is strongly suggested to be one of the Pi-anchored proteins (Stefanová et al, 1989). The cloned cDNA for CD59 indeed contained a long stretch of amino acids at the carboxyl terminus characteristic for Pi-anchored proteins (Figs. 1 and 2B). PI anchoring of proteins is reported to accompany carboxy-terminal processing, as indicated in Thy-1 (Tse et al, 1985). In the case of murine LY-6C and Ly-6A/E, it is predicted that the carboxyl terminus of the mature peptide may be Asn-76 and Asn-79, respectively (Williams et al, 1988). It may be expected that CD59 is processed at Asn-70 and the carboxyl terminus of the mature peptide is Asn-70. If that assumption is correct, the mature CD59 peptide on the cell surface should consist of 70 amino acids, with a calculated molecular weight of

pSR*CD59/A31

PI-PLC

(100mU/ml)

8,086. Relative fluorescence

intensity(log)

FIG. 2. A. Flow cytofluorometry analysis of COS-1 cells transfected with pSRaCD59. COS-1 cells transfected with

pSRaCD59

or

pcDL-SRa296 (Takebe

et

al, 1988)

were

stained with MEM-43 monoclonal antibody and FITCanti-mouse IgG. B. Removal of the CD59 antigen from the surface of transfectants after PI-PLC treatment. Murine A31 cells transformed with pSRaCD59 were incubated in the absence (-) or presence (+) of PI-PLC (100 mU/ml) and were stained with MEM-43 monoclonal antibody and FITC-anti-mouse IgG.

the CD59 peptide is processed at this site and a 33-aminoacid peptide at the carboxyl terminal may be removed. The predicted mature peptide of 70 amino acid residues after the probable processing of carboxyl terminus showed as much as 44% homology with Ly-6C.l. The hydropathy profile (Kyte and Doolittle, 1982) of CD59 was next compared with that of Ly-6C (Fig. 6). There was rather striking similarity between the two profiles, especially in the amino-terminal and carboxy-terminal hydrophobic regions.

CD59 is suspected to be a human homologue of murine Ly-6 antigens (Shaw, 1989; Stefanová et al, 1989). Present results indicate that the overall amino acid homology between them is 35% (Fig. 5), which would increase to 44% when comparing the speculated Pl-linked mature proteins. Furthermore, both proteins had 10 cysteine residues, whose positions were practically identical (Fig. 5). Thus, it is strongly suggested that CD59 is structurally related to the murine Ly-6. Nonetheless, several distinct characteristics have been also noted between them. First, CD59 contains two possible N-glycosylation sites, Asn-8 and Asn-18 (Fig. IB) and was indeed reported to have AMinked glycosylation (Stefanová et al, 1989), whereas Ly-6 showed no A/-glycosylation site from the cDNA sequences (LeClair et ah, 1986; Palfree et al, 1987, 1988). Second, the murine Ly-6 system represents a multigene family consisting of a number of closely related and linked genes, as shown by Southern blot analysis (LeClair et al, 1986), and at least two distinct cDNAs have been isolated (Ly-6C and Ly6A/E). Analysis using monoclonal antibodies further indicated that these genes were expressed on various lymphoid or nonlymphoid cells with patterns distinct from each other (Kimura et al, 1984). In contrast, Southern blot analysis with the present CD59 cDNA revealed a rather

simple gene structure using three restriction enzymes, even under the low-stringency conditions, making it rather unlikely that CD59 represents a multigene family comparable to murine Ly-6 (Fig. 4). Analysis with monoclonal antibody MEM-43 indicated that CD59 was expressed ubiqui-

218

SAWADA ET AL.


>

9 > li

c V w

J2 o.

c 3




0.

û H >ï is ° ° (û -i

(O -i

_ "

O

NIRERT-SCCSEDLCNAA-VPTAGSTWTM-AGVLLFSLSSVVLQTLL

maximum

(mouse

Ly-6C1)

matcing: homology 35%

FIG. 5.

Comparison of the deduced amino acid

se-

quences of the mature form of human CD59 and the murine Ly-6C.l (Bothwell et ai, 1988). The positions of cysteine residues were aligned with the GENETYX program. Cysteine residues are marked with a plus; conserved 2.02-

amino acids

are

marked with

an

asterisk (*).

1.380.95OW

tously

Blot analysis of human genomic DNA. Human placental DNA (15 fig) was digested to completion with Eco RI, Hind III, or Bam HI. The fragments were electrophoresed through a 0.8% agarose gel, transferred to nylon membrane, and hybridized with the 32P-labeled CD59 cDNA probe. FIG. 4.

all

lymphohematopoietic cells, including red well as some nonlymphoid tissues (Stefanová et ai, 1989). This is supported by Northern blot analysis (Fig. 3). It should be noted, however, that CD59 showed the same degree of amino acid homology to both Ly-6C and Ly-6A/E (35% vs. 32%), which have 65% homology with each other. This might imply genetic relatedness of CD59 to the tentative prototypic Ly-6 gene. Finally, the expression of murine Ly-6 antigens is reported to be upregulated by biological agents such as LPS and interferons (Bothwell et ai, 1988). Our preliminary experiments, however, failed on

blood cells

as

ISOLATION AND EXPRESSION OF CD59 cDNA

219

REFERENCES BERGER, J., HOWARD, A.D., BRINK, L., GERBER, L., HAUBER, J., CULLEN, B.R., and UDENFRIEND, S.

(1988). COOH-terminal requirements for the correct processing of a phosphatidylinositol-glycan anchored membrane protein. J. Biol. Chemi. 263, 10016-10021. BOTHWELL, A., PACE, P.E., and LECLAIR, K.P. (1988). Isolation and expression of an IFN responsive Ly-6C chromosomal gene. J. Immunol. 140, 2815-2820.

-4.0

Hydropathy profile of the deduced human CD59 (upper) and murine Ly-6C-1 (lower, Bothwell et al, 1988) FIG. 6.

amino acid sequences. Positive values represent increased

hydrophobicity.

obvious increase in CD59 mRNA in several cell lines examined so far. At present, little is known on the function of CD59 in lymphocytes. In the murine system, Ly-6 molecules are involved in the signal transduction of lymphocytes (Malek et al, 1986). Thus, some anti-Ly-6 monoclonal antibodies are capable of inducing Ca2+ influx as well as cellular proliferation of T cells (Malek et al, 1986). Our unpublished results also indicate that an anti-Ly-6C monoclonal antibody strongly potentiates the lymphocyte proliferative response to various cytokines. To examine possible involvement of CD59 in human lymphocyte signal transduction, we are producing a panel of anti-CD59 antibodies. While preparing this manuscript, the cloning of CD59 cDNA was reported from different approaches. A membrane surface molecule which limits lysis of cells by human complement was isolated from human erythrocytes or from human urine, and cDNA for the protein was cloned in three laboratories under different designations, YTH53.1 antigen (Davies et al, 1989), HRF20 (Okada et al, 1989), and MACIF (Sugita et al, 1989). These molecules are identical to each other and to CD59. It is not known whether murine Ly-6 molecules are involved in the complement system and analysis is underway using antiLy-6 monoclonal antibodies, although murine red blood cells apparently lack the expression of Ly-6 antigens. to show an

ACKNOWLEDGMENTS The authors thank I. Stefanová (Institute of Molecular Genetics, Czechoslovak Academy of Sciences) who provided MEM-43 monoclonal antibody and helpful sugges-

tions. We are also grateful to T. Sudo (Biomaterial Research Institute, Japan) for supplying cell lines and helpful discussions, and to T. Tanigawa (Jichi Medical College) for help in material preparation.

DAVIES, A., SIMMONS, D.L., HALE, G., HARRISON, R.A., TIGHE, H., LACHMANN, J., and WALDMANN, H. (1989). CD59, an Ly-6-like protein expressed in human lymphoid cells, regulates the action of the complement membrane attack complex on homologous cells. J. Exp. Med. 170, 637-654. GUBLER, U., and HOFFMAN, B.J. (1983). A simple and very efficient method for generating cDNA libraries. Gene 25, 263269.

HATTORI, M., SUDO, T., IIZUKA, M., KOBAYASHI, S., NISHIO, S., KANO, S., and MINATO, N. (1987). Generation of continuous large granular lymphocyte lines by interleukin 2 from the spleen cells of mice infected with molony leukemia virus. Involvement of interleukin 3. J. Exp. Med. 166, 833-849. HAVRAN, W.L., LANCKI, D.W., MOLDWIN, R.L., DIALYNAS, D.P., and FITCH, F.W. (1988). Characterization of an anti-Ly-6 monoclonal antibody which defines and activates cytolytic T lymphocyte. J. Immunol. 140, 1034-1042. KIMURA, S., TADA, N., LIU-LAM, Y., and HÄMMERLING, U. (1984). Studies of the mouse Ly-6 alloantigen system II. Complexities of the Ly-6 region. Immunogenetics 20, 47-56. KYTE, J., and DOOLITTLE, R.F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157, 105-113. LeCLAIR, K.P., PALFREE, R.G.E., FLOOD, P.M., HÄMMERLING, U., and BOTHWELL, A. (1986). Isolation of a murine Ly-6 cDNA reveals a new multigene family. EMBO J. 5, 3227-3334. LeCLAIR, K.P., RABIN, M., NESBITT, M., PRAVTCHEVA, D., RUDDLE, F., PALFREE, R.G.E., nd BOTHWELL, A. (1987). Murine Ly-6 multigene family is located on chromosome 15. Proc. Nati. Acad. Sei. USA 84, 1638-1642. LeCLAIR, K.P., BRIDGETT, M.M., DUMONT, F.J., PALFREE, R.G.E., HÄMMERLING, U., and BOTHWELL, A. (1989). Kinetic analysis of Ly-6 gene induction in a T lymphoma by interferons and interleukin 1, and demonstration of ly-6 inducibility in diverse cell types. Eur. J. Immunol. 19, 1233-1239.

MALEK, T.R., ORTEGA, G., CHAN, C, KROCZEK, R.A., and SHEVACH, E.M. (1986). Role of Ly-6 in lymphocyte activation II. Induction of T cell activation by monoclonal antiLy-6 antibodies. J. Exp. Med. 164, 709-722. MANIATIS, T., FRITSCH, E.F., and SAMBROOK, J. (1982). Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor Laboratory, Cold Spring harbor, NY). OKADA, H., NAGAM1, Y., TAKAHASHI, K., OKADA, N., HIDESHIMA, T., TAKIZAWA, H., and KONDO, J. (1989). 20 KDa homologous restriction factor of complement resembles T cell activating protein. Biochem. Biophys. Res. Commun. 162, 1553-1559. PALFREE, R.G.E., LeCLAIR, K.P., BOTHWELL, A., and HÄMMERLING, U. (1987). cDNA characterization of a Ly-6.2 gene expressed in BW5147 tumor cells. Immunogenetics 26, 389-391. PALFREE, R.G.E., SIRLIN, S., DUMONT, F.J., and HÄMMERLING, U. (1988). N-terminal and cDNA characterization

220

SAWADA ET AL.

of murine 305-310.

lymphocyte antigen Ly-6C2. J. Immunol. 140,

SAIKI, R.K., GELFAND, D.H., STOFFEL, S., SCHARF, S.J., HIGUCHI, R., HORN, G.T., MULLÍS, K.B., and ERLICH, H.A. (1988). Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487-491. SANGER, F., NICKLEN, S., and COULSON, A.R. (1977). with chain-terminating inhibitors. Proc. Nati. 74, 5463-5467. SAWADA, R., OHASHI, K., OKANO, K., HATTORI, M., MINATO, N., and NARUTO, M. (1989). Complementary DNA sequence and deduced peptide sequence for CD59/MEM43 antigen, the human homologue of murine lymphocyte antigen Ly-6C Nucleic Acids Res. 17, 6728. SEED, B. (1987). An LFA-3 cDNA encodes a phospholipidlinked membrane protein homologous to its receptor CD2. Nature 329, 840-842. SHAW, S. (1989). Not all in a name. Nature 338, 539-540. SHEVACH, E.M., and KORTY, P.E. (1989). Ly-6: A multigene family in search of a function. Immunol. Today 10, 195-200. SOMPAYRAC, L.M., and DANNA, K.J. (1981). Efficient infection of monkey cells with DNA of simian virus 40. Proc. Nati. Acad. Sei. USA 78, 7575-7578. SOUTHERN, P.J., and BERG, P. (1982). Transformation of DNA

sequencing

Acad. Sei. USA

SUGITA, Y., TOBE, T., ODA, E., TOMITA, M., YASUKAWA, K., YAMAJI, N., TAKEMOTO, T., FURUICHI, K., TAKAYAMA, M., and YANO, S. (1989). Molecular cloning and characterization of MACIF, an inhibitor of membrane channel formation of complement. J. Biochem. 106, 555-557. TAKEBE, Y., SEIKI, M., FUJISAWA, J., HOY, P., YOKOTA, K., ARAI, K., YOSHIDA, M., and ARAI, N. (1988). SRa promoter: An efficient and versatile mammalian cDNA expression system composed of the simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell. Biol. 4, 466-472. TSE, E.T.H., BARCLAY, N., WATTS, A., and WILLIAMS, A.F. (1985). A glycophospholipid tail at the carboxyl terminus of the Thy-1 glycoprotein of neurons and thymocytes. Science 230, 1003-1008. VAN DE RUN, M., HEIMFELD, S., SPANGRUDE, G.J., and WEISSMAN, I.L. (1989). Mouse hematopoietic stem-cell antigen Sca-1 is a member of the Ly-6 antigen family. Proc. Nati. Acad. Sei. USA 86, 4634-4638. WILLIAMS, A.F., TSE, A.G.D., and GAGNON, J. (1988). Squid glycoproteins with structural similarities to Thy-1 and Ly-6 antigens. Immunogenetics 27, 265-272.

Address reprint requests to: Dr. Masanobu Naruto Basic Research Laboratories Toray Industries, Inc. 1111 Tebiro, Kamakura 248, Japan

mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J. Mol. Appl. Genet. 1, 327-341.

STEFANOVÁ, I., HILGERT, I., KRISTOFAVÁ, H., BROWN, R., LOW, G.M., and HOREJSÍ, V. (1989). Characterization of a broadly expressed human leucocyte surface antigen MEM43 anchored in membrane through phosphatidylinositol. Mol. Immunol. 26, 153-161.ms

Received for

publication January 2,

1990.