Vol. 32, No. 2
JOURNAL OF VIROLOGY, Nov. 1979, p. 517-522 0022-538X/79/11-0517/06$02.00/0
Isolation and Characterization of Polyoma Virus Genomes with Deletions Between the Origin of Viral DNA Replication and the Site of Initiation of Translation in the Early Region ROBERT D. WELLS,t MARY A. HUTCHINSON, AND WALTER ECKHART* Tumor Virology Laboratory, The Salk Institute, San Diego, California 92112 Received for publication 9 April 1979
We introduced deletions in the early region of the polyoma virus genome near the HaeII restriction enzyme cleavage site, between the origin of viral DNA replication and the site of initiation of translation of the polyoma T antigens. We analyzed the DNA of the deletion mutants by restriction enzyme digestion. Four of the mutants had deletions beginning very close to the HaeII site and extending clockwise toward the site of initiation of translation. The deletions near the HaeII site varied in size from about 10 base pairs to about 55 base pairs. The mutants containing deletions near the HaeII site were capable of lytic growth in mouse 3T6 cells and were capable of transforming rat F2408 cells, as judged by focus formation. The polyoma genome is a circular DNA molecule of approximately 3.4 x 106 daltons. The origin of viral DNA replication is located at about 71 units on the physical map of polyoma DNA, near the junction of the HpaII restriction enzyme fragments 3 and 5 (10). The early region of the viral genome extends clockwise from 71 map units to about 25 map units (10). The first methionine codon for the initiation of translation of the proteins encoded in the early region is located at about 74 map units, 163 nucleotides clockwise from the HpaII-3/5 junction on the 5'3' strand (7). There are three proteins, referred to as T antigens, encoded in the early region of the polyoma genome (12-15, 22, 23, 26). The three T antigens have sizes of approximately 90,000, 60,000, and 22,000 daltons (90K, 60K, and 22K), and apparently share common N-terminal regions of about 12,000 daltons encoded from approximately 74 to 80 map units on the polyoma DNA (12, 13, 23). The three T antigens can be produced by translation of polyoma-specific RNA in vitro (12). The early region of the polyoma genome encodes a protein required for the initiation of viral DNA replication (5). The temperature-sensitive tsA mutations, which affect this protein, are located in the distal portion of the early region of the polyoma genome, between 1 and 25 map units (4, 20). The tsA mutations render the 90K T antigen thermolabile, but do not affect the 60K or 22K T antigens (13, 16). These results t Present address: Department of Biochemistry, University ot Wisconsin, Madison, WI 53706.
517
suggest that the 90K T antigen is the protein required for initiation of viral DNA replication. The tsA mutations also affect transcription of virus-specific RNA in infected cels, causing an overproduction of virus-specific early RNA in cells infected by tsA mutants (2). The tsA mutations of simian virus 40 (SV40) are located in a corresponding region of the SV40 genome and show similar effects on viral DNA replication and transcription (18, 21, 25). The origin of polyoma DNA replication and the region preceding the site of initiation of translation are of particular interest because they may include the sites of action of proteins which control DNA replication, transcription, and translation. We have studied the properties of polyoma genomes containing deletions near the HaeII cleavage site, about midway between the origin of viral DNA replication and the site of initiation of translation in the early region. The HaeII site is located 79 nucleotides clockwise from the HpaII-3/5 junction on the 5'-3' strand and 84 nucleotides counterclockwise from the first methionine codon in the early region (7). Deletion mutants of SV40 have been obtained by infecting cells with linear viral DNA produced by cleavage with single-site cleavage restriction enzymes (1). We used similar methods to produce deletion mutations in polyoma at or near the HaeII site. MATERIALS AND METHODS Cell culture and virus infection. Mouse 3T6 cells were grown in Dulbecco modified Eagle medium, supplemented with 5% calf serum. Wild-type large-plaque
WELLS, HUTCHINSON, AND ECKHART
J. VIROL.
polyoma virus, strain WS (derived from a plaque isolate of the LP strain; 3), was grown in cultures of 3T6 cells. Virus stocks were prepared by one or two undiluted passages from plaque stocks and were generally free of defective genomes as judged by the pattern of fragments obtained by digestion with HpaII. Isolation of polyoma DNA for mutant selection. Polyoma DNA was prepared from cultures of 3T6 cells, infected with wild-type polyoma at a multiplicity of approximately 10 PFU/cell. When cytopathic effect was well advanced, the cultures were extracted, and cellular DNA was precipitated by the method of Hirt (11). Supernatants containing viral DNA were extracted twice with phenol, twice with chloroform-isoamyl alcohol (24:1), and three times with ether. The supernatants were made 0.1 M in sodium acetate and 1 M in Tris, pH 5, and precipitated overnight at 4'C with 2 volumes of 95% ethanol. Precipitated DNA was suspended in 10-2 M Tris-10-3 M EDTA, and supercoiled DNA was isolated by banding to equilibrium in a CsCl solution containing ethidium bromide (EtBr). The EtBr was removed by extraction five times with isopropanol, potassium acetate was added to 0.1 M, and the DNA was precipitated by adding 2 volumes of 95% ethanol and carrier tRNA, 40 ,ug/ml. The DNA was further purified by sedimentation in 5 to 20% neutral sucrose gradients in 1 M NaCl, followed by dialysis against 5 x 10-3 M sodium phosphate-106 M EDTA. Treatment of DNA with HaeII and Si nuclease. Wild-type polyoma DNA (0.3 optical density unit at 260 nm), purified as described above, was treated in a reaction mixture (0.1-ml volume) containing 6 mM Tris-hydrochloride (pH 7.5), 6 mM MgCl2, 6 mM dithiothreitol, and 13 U of the restriction enzyme, HaeII (obtained from Miles Laboratories; specific activity, 30,000 U/mg of protein), for 1.5 h at 370C. (These conditions were shown to result in complete conversion of supercoiled DNA to linear form.) The reaction mixture was then made 30 mM in sodium acetate (pH 4.6) and 1 mM in ZnCl2. SI nuclease was added, and the reaction mixture was kept at 45°C for 30 min. The amount of Sl nuclease used was shown in pilot experiments (no HaeII added) to be sufficient to convert supercoiled polyoma DNA (more than 90%) to a 1:1 mixture of forms II and III with little or no further degradation. The reaction was stopped by adding EDTA to 20 mM. The linear DNA was subjected to three successive cycles of equilibrium centrifugation in CsCl containing EtBr and then extracted and dialyzed as described above. This DNA preparation was used to infect 3T6 cultures for the isolation of deletion mutants. Isolation and characterization of mutant DNA. Serial dilutions of polyoma DNA, treated with HaeII and S1 nuclease and purified as described above, were used to infect 3T6 cultures in a plaque assay. Isolated plaques, one per plate, were picked and plaque purified twice more. Virus stocks were prepared from the third serial plaque isolate. Radiolabeled DNA was prepared by incubating infected 3T6 cultures in phosphate-free medium containing 20 ,uCi of 32p per ml for 24 h during the late stage of infection. Viral DNA was harvested by Hirt extraction, and the superantants were extracted twice with phenol. The aqueous phases were
extracted twice with ether, precipitated with ethanol, and suspended in 10 mM sodium phosphate-10-6 M EDTA. The DNA preparations were partially freed of RNA as described by Kamen and Shure (17) and analyzed by digestion with various restriction enzymes. Digestion with HhaI, HpaII, and HaeIII was carried out by placing a 0.04-ml sample of the viral DNA solution (10 mM sodium phosphate [pH 6.8]-10-6 M EDTA, at a concentration of approximately 1 /Lg/ml) in a total volume of 0.1 ml, containing 6 mM Tris (pH 8), 6 mM MgCl2, 6 mM dithiothreitol, and 1 or 2 U of the restriction enzyme (customarily purchased from Bethesda Research Laboratories). The digestion was carried out overnight at 37°C. The DNA fragments resulting from digestion were analyzed on 5% polyacrylamide gels containing 5% acrylamide-0.25% bisacrylamide-25% glycerol in Tris-borate buffer (0.089 M Trizma base-0.089 M boric acid-103 M EDTA, pH 8.2).
518
RESULTS Cleavage of mutant genomes by HpaII. The physical map of large-plaque wild-type polyoma DNA, showing the sites of cleavage by HaeII, HpaII, HaeIII, and HhaI, is shown in Fig. 1 (6,8). HaeII cleaved polyoma DNA of this strain within HpaII fragment 5, 79 bases from the HpaII-3/5 junction on the 5'-3' strand (7). Deletion mutants induced by cleavage with HaeII would be expected to show alterations in the size of HpaII fragment 5. Individual plaques arising from polyoma DNA treated with HaeII and Si nuclease were picked and purified by two
FIG. 1. Physical map of polyoma DNA. The sites of cleavage by the restriction enzymes EcoRI, HhaI, HaeII, HpaII, and HaeIII are shown. The polyoma genome is divided into 100 map units, with the site of cleavage by EcoRI at 0/100 units (taken from reference 6).
VOL. 32, 1979
POLYOMA DELETION MUTANTS
519
further serial plaque pLurifications. The DNA from each of the final plh%que isolates was tested by cleavage with HpaII. We tested a total of 19 individual plaque isolateZs, all of which showed gel electrophoretic alteirations in HpaII fragment 5. The patterns of fragments produced by digestion of representatiN{e virus stocks (mutants 51-2, -6, -8, -15, and -20) with HpaII are shown in Fig. 2. All the digests eiad an altered fragment 5 compared with wild-type polyoma. The majority of the (digests of the other 15 mutants (not shown) resembled mutant 51-6 (Fig. 2). In some cases, such as mutants 51-15 and 51-20 (Fig. 2), new friagments with mobilities faster than that of the riormal HpaII fragment
6 appeared. The wild-type HpaII fragment 5 of this strain of polyoma contains 390 base pairs (7). The mobilities of the altered fragments of mutants 51-2, 51-6, 51-8, 51-15, and 51-20 indicated that the sizes of the deletions were approximately: 10 to 20 base pairs for 51-2; 5 to 10 base pairs for 51-6; 10 to 20 base pairs for 51-8; 65 base pairs for 51-15; and 20 to 25 base pairs for 51-20. To verify that the new fragments seen in the HpaII digests in Fig. 2 arose from alterations in HpaII fragment 5, we digested the mutant DNAs with HhaI. The recognition site for HhaI is 5'-N-G-C-G-C-N-3', where N is any nucleotide. The recognition site for HaeII is 5'-R-G-C-G-CY-3', where R is a purine and Y is a pyrimidine. genomes lacking the HaeII site would D E F G Therefore, A B C be expected to lack the HhaI site in the same region. Wild-type polyoma DNA gave three fragments upon digestion with HhaI, as expected (9). The mutants, with the exception of 51-6, gave two fragments: a small fragment corresponding to HhaI fragment 3 from wild-type 1Im - polyoma, and a large fragment corresponding to mm 2fused HhaI fragments 1 and 2, as expected if the qm mutants lacked the HhaI site at 72.5 units, which 3.wlm coincides with the HaeII site. Mutant 51-6 4showed a HhaI cleavage pattern indistinguishable from wild-type polyoma. Mutant 51-6 also retained an HaeII cleavage site, whereas all other mutants lacked it (not shown). 5We further analyzed mutants 51-2, 51-8, 516a 15, and 51-20 by digesting the large fused HhaI fragments 1 and 2 with HpaII. The digests showed fragments comigrating with the pre7sumed altered HpaII fragment 5's in the digests of total mutant DNA, confirming that the altered fragments in the mutant DNA's arose from HpaII fragment 5. We conclude that all the mutants contain deletions in HpaII fragment 5, that mutant 51-6 has an HhaI cleavage site in the neighborhood 8-... ..... -. of the HaeII site (see Discussion), and that all 8 mutants with the exception of 51-6 lack a HhaI site in this region. Cleavage of mutant genomes by HaeM. To attempt to locate the mutant deletions more FIG. 2. Gel electrophore>tic analysis of HpaII di- precisely, the mutant DNAs were digested with gests ofpolyoma deletion iutants. Radiolabeledpol- HaeIII. Mutants containing deletions around yoma DNA was prepared from mouse 3T6 cells inthe HaeII site would be expected to contain fected with polyoma deletic4n mutants. The DNA was alterations in HaeIII fragments 2 and 14' (see digested, and fragments weere analyzed by polyacryl- Fig. 1). The patterns produced by HaeIII diges_
ovm _
_oolo -"a
-M
n
described ineMaterias
amide gel electrophoresis ias described in Materials 0 and Methods. Lanes A andire through F are mutants 51-, 20, respectively. The number of base pairs in each of the fragments of the wild -type DNA is: 1, 1,421; 2, 1,133; 3, 883; 4, 702; 5, 390; 6, 377; 7, 275; 8, 112 (7, 10; T. Friedmann, personal co,mmunication).
a51rew51ld8te5LaneadB
**a tion are shown in Fig. 3. The results are consist-
ent with the results of the HpaII digestions: (i) mutants 51-2 and 51-6 had patterns indistinguishable from those wild-type (the small deletions of 10 to 20 base pairs in mutants 51-2 and 51-6 would not be detectable if they were in
520
WELLS, HUTCHINSON, AND ECKHART
J. VIROL.
and 14', resulting in new fused fragments migrating more slowly than fragment 1. The HaelIl fragment 14', 85 nucleotides in length, ran together with a fragment of 87 nucleotides. The size and location on the genome of these fragments was deduced from the polyoma DNA nucleotide sequence (T. Friedmann, personal communication). Because the two fragments were so similar in size, it was not possible to detect changes in fragment 14' in this pattern. Biological properties of the deletion mutants. All 19 mutants tested appeared to be competent for lytic growth. Virus yield as a function of time was similar for the mutants and wild-type after infection at low and high multiplicities. There was no detectable helper virus DNA in the restriction enzyme digests. The number of plaques as a function of dilution was linear over a 100-fold range. Therefore, deletions of viral DNA in the vicinity of the HaeII site at 72.5 map units did not grossly affect the ability of the viral DNA to replicate or to synthesize viral proteins required for replication. We tested the ability of the mutants carrying deletions near the HaeII site to transform rat F2408 cells. Cultures were infected at multiplicities of 20 PFU/cell, trypsinized, reseeded at 104 and 105 cells per 5-cm dish, incubated for 14 days, and examined for the presence of dense foci. Cultures infected with wild-type polyoma and with all mutants showed transformation frequencies of 1 x 10-:3 to 2 x 10-3 under these conditions. We conclude that the mutants carrying deletions near the HaeII site are not defective in their ability to transform rat F2408 cells, as assayed by focus formation.
DISCUSSION We have isolated 19 mutants of polyoma containing deletions in the region of the HaeII site at 72.5 map units, between the origin of viral DNA replication (71 map units) and the beginning of translation (74 map units) in the early region of the viral genome. The precise location and extent of the deletions can be more directly established by DNA sequencing. However, some FIG. 3. Gel electrophoretic analysis of HaeIII di- conclusions can be drawn by comparing the rediDNA was prepared, Radiolabeled polyoma gests. striction enzyme digestion patterns of the mugested with HaeIII, and analyzed as described in tants with the nucleotide sequence of wild-type Materials and Methods. Lanes A through F are wild type and mutants 51-2, 51-6, 51-8, 51-15, and 51-20, polyoma DNA. The nucleotide sequence of polyoma DNA in respectively. The number of base pairs in fragments 1 through 14' of wild-type DNA are: 718, 673, 540, 514, the region of the HaeII site is shown in Fig. 4 488, 405, 314, 209, 199, 170, 134, 117, 109, 95, 87, and (7). HaeII cleaves a subset of HhaI sites, as 85, respectively (7, 24; T. Friedmann, personal com- noted previously. There is a second HhaI cleavmunication). age site 11 nucleotides clockwise from the HhaI site recognized by HaeII on the 5'-3' strand. The HaeIII fragment 2); and (ii) mutants 51-8, 51-15, HaeIII site separating HaeIII fragments 2 (to and 51-20 apparently had deletions that included the right) and 14' (to the left) is 18 nucleotides the HaeIII cleavage site between fragments 2 clockwise from the HaelI site on the 5'-3' strand.
521
POLYOMA DELETION MUTANTS
VOL. 32, 1979
Hpa EE 3/5
HhaI
Hoe]I
Hha I
Hoe I
Hpa II 5/4
-
5' ACAGGACTGGCGCCTTGGAGGCGCGTTGGGGCCACCCAAA 3'
3' TGTCCTGACCGCGGAACCTCCGCGCAACCCCGGTGGGTTT 5' FIG. 4. Polyoma DNA nucleotide sequence in the region of the HaeII site. The HaeII site is located at about 72.5 map units in the early region of the viral genome. The DNA sequence for the wild-type polyoma strain used here is taken from Friedmann et al. (7).
The HaeIII fragment 14' shown in Fig. 1 is 85 nucleotides in length (7). Mutant 51-2 is missing the HaeII site and both HhaI sites shown in Fig. 4. The mutant retains a HaeIII site in this region. Because of the small size of the deletion (10 to 20 base pairs, estimated from the alteration in migration of HpaII fragment 5), the deletion must begin very near the HaeII site on the left and terminate very near the second HhaI site on the right (Fig. 4). Mutant 51-6 has retained the HaeII site or generated a new one, and has retained the HaeIII site and at least one of the HhaI sites shown in Fig. 4. The mutant contains a small deletion (5 to 10 base pairs), whose location in HpaII fragment 5 cannot be determined from the information available at present. Mutant 51-8 lacks the HaeII site, both HhaI sites, and the HaeIII site shown in Fig. 4. The estimated size (10 to 20 base pairs) suggests that the deletion must begin very near the HaeII site on the left and end very near the HaeIII site on the right. Mutant 51-15, like 51-8, lacks all four cleavage sites shown in Fig. 4. Preliminary DNA nucleotide sequence analysis (J. Coward, unpublished observations) shows that the deletion begins very close to the HaeII site on the left and extends for about 55 base pairs in a clockwise direction (to the right in Fig. 4) on the polyoma physical map. Mutant 51-20 also lacks all four sites shown in Fig. 4. Its size (20 to 25 base pairs) suggests that it resembles 51-8, beginning near the HaeII site on the left and ending near the HaeIII site on the right. It is interesting to note that all four deletions begin near the HaeII site and extend to the right for varying distances. Whether this reflects a requirement of sequences to the left of the HaeII site for virus replication or reflects some polarity in the process by which the deletions were induced, or occurred by chance, we cannot say from the results obtained so far. A variety of defective polyoma mutants, lacking sequences between 72 and 1 map units, require helper DNA in order to replicate (19). The results presented here show that deletions in the region midway between the origin of viral DNA replication and the beginning of translation do
not necessarily affect the ability of polyoma to replicate or to cause cell transformation. Even mutant 51-15, whose deletion extends for about 55 nucleotides from the HaeII site to within about 30 nucleotides of the beginning of translation, is not impaired. Apparently polyoma can tolerate rather large deletions in this region of the genome. ACKNOWLEDGMENTS This investigation was supported by Public Health Service grants CA-13884 and CA-14195, awarded by the National Cancer Institute. R.D.W. was the recipient of a Guggenheim Fellowship. We are grateful to Theodore Friedmann for providing information about the nucleotide sequence of polyoma DNA before publication and to James Coward for unpublished observations and valuable discussions.
LITERATURE CMD 1. Carbon, J., T. E. Shenk, and P. Berg. 1975. Biochemical procedure for production of small deletions in simian virus 40 DNA. Proc. Natl. Acad. Sci. U.S.A. 72:13921396. 2. Cogen, B. 1978. Virus-specific early RNA in 3T6 cells infected by a tsA mutant of polyoma virus. Virology 85: 222-230. 3. Eckhart, W. 1969. Complementation and transformation by temperature-sensitive mutants of polyoma virus. Virology 38:120-125. 4. Feunteun, J., L. Sompayrac, M. Fluck, and T. Benjamin. 1976. Localization of gene functions in polyoma virus DNA. Proc. Natl. Acad. Sci. U.S.A. 73:4169-4173. 5. Francke, B., and W. Eckhart. 1973. Polyoma gene function required for viral DNA synthesis. Virology 55: 127-135. 6. Fried, M., and B. E. Griffin. 1977. Organization of the genomes of polyoma virus and SV40. Adv. Cancer Res. 24:67-113. 7. Friedmann, T., P. LaPorte, and A. Esty. 1978. Nucleotide sequence studies of polyoma DNA: the Hpa II 3/5 junction to the Hpa II 4/Hae III 18 junction encoding the origin of DNA replication and the 5' end of the early region. J. Biol. Chem. 253:6561-6567. 8. Griffin, B. E. 1977. Fine structure of polyoma virus DNA. J. Mol. Biol. 117:447471. 9. Griffin, B. E., and M. Fried. 1975. Amplification of a specific region of the polyoma virus genome. Nature (London) 256:175-179. 10. Griffin, B. E., M. Fried, and A. Cowie. 1974. Polyoma DNA-a physical map. Proc. Natl. Acad. Sci. U.S.A. 71:2077-2081. 11. Hfrt, B. 1967. Selective eztraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-369. 12. Hunter, T., M. A. Hutchinson, and W. Eckhart. 1978. Translation of polyoma virus T antigens in vitro. Proc. Natl. Acad. Sci. U.S.A. 75:5917-5921. 13. Hutchinson, M. A., T. Hunter, and W. Eckhart. 1978. Characterization of T-antigens in polyoma-infected and transformed cells. Cell 15:65-77. 14. Ito, Y., J. Brocklehurst, and R. Dulbecco. 1977. Virus-
522
15.
16. 17.
18. 19.
20.
WELLS, HUTCHINSON, AND ECKHART
specific proteins in the plasma membrane of cells lytically infected or transformed by polyoma virus. Proc. Natl. Acad. Sci. U.S.A. 74:4666-4670. Ito, Y., J. Brocklehurst, N. Spurr, M. Griffiths, J. Hurst, and M. Fried. 1977. Polyoma virus wild type and mutant T-antigens, p. 145-151. In Early proteins of oncogenic viruses. Colloques INSERM-EMBO. Ito, Y., N. Spurr, and R. Dulbecco. 1977. Characterization of polyoma virus T antigen. Proc. Natl. Acad. Sci. U.S.A. 74:1259-1263. Kamen, R., and H. Shure. 1976. Topography of polyoma virus messenger RNA molecules. Cell 7:361-371. Lai, C.-J., and D. Nathans. 1974. Mapping temperaturesensitive mutants of simian virus 40: rescue of mutants by fragments of viral DNA. Virology 60:466-475. Lund, E., M. Fried, and B. E. Griffin. 1977. Polyoma virus defective DNA's. I. Physical maps of a related set of defective molecules (D76, D91, D92). J. Mol. Biol. 117:473-495. Miller, L., and M. Fried. 1976. Construction of the genetic map of the polyoma genome. J. Virol. 18:824-
J. VIROL. 832. 21. Reed, S. K., G. R. Stark, and J. C. Alwine. 1976. Autoregulation of simian virus 40 gene A by T antigen. Proc. Natl. Acad. Sci. U.S.A. 73:3083-3087. 22. Schaffhausen, B., J. Silver, and T. Benjamin. 1978. Tumor antigen(s) in cells productively infected by wildtype polyoma virus and mutant NG-18. Proc. Natl. Acad. Sci. U.S.A. 75:79-83. 23. Smart, J. E., and Y. Ito. 1978. Three species of polyoma virus tumor antigens share common peptide probably near the amino termini of the proteins. Cell 15:14271437. 24. Summers, J. 1975. Physical map of polyoma viral DNA fragments produced by cleavage with a restriction enzyme from Haemophilus aegyptius, endonuclease R. HaeIII. J. Virol. 15:946-958. 25. Tegtmeyer, P. 1972. Simian virus 40 deoxyribonucleic acid synthesis: the viral replicon. J. Virol. 10:591-598. 26. Turler, H., and C. Salomon. 1977. Characterization of polyoma T-antigen, p. 131-144. In Early proteins of oncogenic viruses. Colloques INSERM-EMBO.
JOURNAL OF VIROLOGY, Nov. 1979, p. 517-522 0022-538X/79/11-0517/06$02.00/0
Isolation and Characterization of Polyoma Virus Genomes with Deletions Between the Origin of Viral DNA Replication and the Site of Initiation of Translation in the Early Region ROBERT D. WELLS,t MARY A. HUTCHINSON, AND WALTER ECKHART* Tumor Virology Laboratory, The Salk Institute, San Diego, California 92112 Received for publication 9 April 1979
We introduced deletions in the early region of the polyoma virus genome near the HaeII restriction enzyme cleavage site, between the origin of viral DNA replication and the site of initiation of translation of the polyoma T antigens. We analyzed the DNA of the deletion mutants by restriction enzyme digestion. Four of the mutants had deletions beginning very close to the HaeII site and extending clockwise toward the site of initiation of translation. The deletions near the HaeII site varied in size from about 10 base pairs to about 55 base pairs. The mutants containing deletions near the HaeII site were capable of lytic growth in mouse 3T6 cells and were capable of transforming rat F2408 cells, as judged by focus formation. The polyoma genome is a circular DNA molecule of approximately 3.4 x 106 daltons. The origin of viral DNA replication is located at about 71 units on the physical map of polyoma DNA, near the junction of the HpaII restriction enzyme fragments 3 and 5 (10). The early region of the viral genome extends clockwise from 71 map units to about 25 map units (10). The first methionine codon for the initiation of translation of the proteins encoded in the early region is located at about 74 map units, 163 nucleotides clockwise from the HpaII-3/5 junction on the 5'3' strand (7). There are three proteins, referred to as T antigens, encoded in the early region of the polyoma genome (12-15, 22, 23, 26). The three T antigens have sizes of approximately 90,000, 60,000, and 22,000 daltons (90K, 60K, and 22K), and apparently share common N-terminal regions of about 12,000 daltons encoded from approximately 74 to 80 map units on the polyoma DNA (12, 13, 23). The three T antigens can be produced by translation of polyoma-specific RNA in vitro (12). The early region of the polyoma genome encodes a protein required for the initiation of viral DNA replication (5). The temperature-sensitive tsA mutations, which affect this protein, are located in the distal portion of the early region of the polyoma genome, between 1 and 25 map units (4, 20). The tsA mutations render the 90K T antigen thermolabile, but do not affect the 60K or 22K T antigens (13, 16). These results t Present address: Department of Biochemistry, University ot Wisconsin, Madison, WI 53706.
517
suggest that the 90K T antigen is the protein required for initiation of viral DNA replication. The tsA mutations also affect transcription of virus-specific RNA in infected cels, causing an overproduction of virus-specific early RNA in cells infected by tsA mutants (2). The tsA mutations of simian virus 40 (SV40) are located in a corresponding region of the SV40 genome and show similar effects on viral DNA replication and transcription (18, 21, 25). The origin of polyoma DNA replication and the region preceding the site of initiation of translation are of particular interest because they may include the sites of action of proteins which control DNA replication, transcription, and translation. We have studied the properties of polyoma genomes containing deletions near the HaeII cleavage site, about midway between the origin of viral DNA replication and the site of initiation of translation in the early region. The HaeII site is located 79 nucleotides clockwise from the HpaII-3/5 junction on the 5'-3' strand and 84 nucleotides counterclockwise from the first methionine codon in the early region (7). Deletion mutants of SV40 have been obtained by infecting cells with linear viral DNA produced by cleavage with single-site cleavage restriction enzymes (1). We used similar methods to produce deletion mutations in polyoma at or near the HaeII site. MATERIALS AND METHODS Cell culture and virus infection. Mouse 3T6 cells were grown in Dulbecco modified Eagle medium, supplemented with 5% calf serum. Wild-type large-plaque
WELLS, HUTCHINSON, AND ECKHART
J. VIROL.
polyoma virus, strain WS (derived from a plaque isolate of the LP strain; 3), was grown in cultures of 3T6 cells. Virus stocks were prepared by one or two undiluted passages from plaque stocks and were generally free of defective genomes as judged by the pattern of fragments obtained by digestion with HpaII. Isolation of polyoma DNA for mutant selection. Polyoma DNA was prepared from cultures of 3T6 cells, infected with wild-type polyoma at a multiplicity of approximately 10 PFU/cell. When cytopathic effect was well advanced, the cultures were extracted, and cellular DNA was precipitated by the method of Hirt (11). Supernatants containing viral DNA were extracted twice with phenol, twice with chloroform-isoamyl alcohol (24:1), and three times with ether. The supernatants were made 0.1 M in sodium acetate and 1 M in Tris, pH 5, and precipitated overnight at 4'C with 2 volumes of 95% ethanol. Precipitated DNA was suspended in 10-2 M Tris-10-3 M EDTA, and supercoiled DNA was isolated by banding to equilibrium in a CsCl solution containing ethidium bromide (EtBr). The EtBr was removed by extraction five times with isopropanol, potassium acetate was added to 0.1 M, and the DNA was precipitated by adding 2 volumes of 95% ethanol and carrier tRNA, 40 ,ug/ml. The DNA was further purified by sedimentation in 5 to 20% neutral sucrose gradients in 1 M NaCl, followed by dialysis against 5 x 10-3 M sodium phosphate-106 M EDTA. Treatment of DNA with HaeII and Si nuclease. Wild-type polyoma DNA (0.3 optical density unit at 260 nm), purified as described above, was treated in a reaction mixture (0.1-ml volume) containing 6 mM Tris-hydrochloride (pH 7.5), 6 mM MgCl2, 6 mM dithiothreitol, and 13 U of the restriction enzyme, HaeII (obtained from Miles Laboratories; specific activity, 30,000 U/mg of protein), for 1.5 h at 370C. (These conditions were shown to result in complete conversion of supercoiled DNA to linear form.) The reaction mixture was then made 30 mM in sodium acetate (pH 4.6) and 1 mM in ZnCl2. SI nuclease was added, and the reaction mixture was kept at 45°C for 30 min. The amount of Sl nuclease used was shown in pilot experiments (no HaeII added) to be sufficient to convert supercoiled polyoma DNA (more than 90%) to a 1:1 mixture of forms II and III with little or no further degradation. The reaction was stopped by adding EDTA to 20 mM. The linear DNA was subjected to three successive cycles of equilibrium centrifugation in CsCl containing EtBr and then extracted and dialyzed as described above. This DNA preparation was used to infect 3T6 cultures for the isolation of deletion mutants. Isolation and characterization of mutant DNA. Serial dilutions of polyoma DNA, treated with HaeII and S1 nuclease and purified as described above, were used to infect 3T6 cultures in a plaque assay. Isolated plaques, one per plate, were picked and plaque purified twice more. Virus stocks were prepared from the third serial plaque isolate. Radiolabeled DNA was prepared by incubating infected 3T6 cultures in phosphate-free medium containing 20 ,uCi of 32p per ml for 24 h during the late stage of infection. Viral DNA was harvested by Hirt extraction, and the superantants were extracted twice with phenol. The aqueous phases were
extracted twice with ether, precipitated with ethanol, and suspended in 10 mM sodium phosphate-10-6 M EDTA. The DNA preparations were partially freed of RNA as described by Kamen and Shure (17) and analyzed by digestion with various restriction enzymes. Digestion with HhaI, HpaII, and HaeIII was carried out by placing a 0.04-ml sample of the viral DNA solution (10 mM sodium phosphate [pH 6.8]-10-6 M EDTA, at a concentration of approximately 1 /Lg/ml) in a total volume of 0.1 ml, containing 6 mM Tris (pH 8), 6 mM MgCl2, 6 mM dithiothreitol, and 1 or 2 U of the restriction enzyme (customarily purchased from Bethesda Research Laboratories). The digestion was carried out overnight at 37°C. The DNA fragments resulting from digestion were analyzed on 5% polyacrylamide gels containing 5% acrylamide-0.25% bisacrylamide-25% glycerol in Tris-borate buffer (0.089 M Trizma base-0.089 M boric acid-103 M EDTA, pH 8.2).
518
RESULTS Cleavage of mutant genomes by HpaII. The physical map of large-plaque wild-type polyoma DNA, showing the sites of cleavage by HaeII, HpaII, HaeIII, and HhaI, is shown in Fig. 1 (6,8). HaeII cleaved polyoma DNA of this strain within HpaII fragment 5, 79 bases from the HpaII-3/5 junction on the 5'-3' strand (7). Deletion mutants induced by cleavage with HaeII would be expected to show alterations in the size of HpaII fragment 5. Individual plaques arising from polyoma DNA treated with HaeII and Si nuclease were picked and purified by two
FIG. 1. Physical map of polyoma DNA. The sites of cleavage by the restriction enzymes EcoRI, HhaI, HaeII, HpaII, and HaeIII are shown. The polyoma genome is divided into 100 map units, with the site of cleavage by EcoRI at 0/100 units (taken from reference 6).
VOL. 32, 1979
POLYOMA DELETION MUTANTS
519
further serial plaque pLurifications. The DNA from each of the final plh%que isolates was tested by cleavage with HpaII. We tested a total of 19 individual plaque isolateZs, all of which showed gel electrophoretic alteirations in HpaII fragment 5. The patterns of fragments produced by digestion of representatiN{e virus stocks (mutants 51-2, -6, -8, -15, and -20) with HpaII are shown in Fig. 2. All the digests eiad an altered fragment 5 compared with wild-type polyoma. The majority of the (digests of the other 15 mutants (not shown) resembled mutant 51-6 (Fig. 2). In some cases, such as mutants 51-15 and 51-20 (Fig. 2), new friagments with mobilities faster than that of the riormal HpaII fragment
6 appeared. The wild-type HpaII fragment 5 of this strain of polyoma contains 390 base pairs (7). The mobilities of the altered fragments of mutants 51-2, 51-6, 51-8, 51-15, and 51-20 indicated that the sizes of the deletions were approximately: 10 to 20 base pairs for 51-2; 5 to 10 base pairs for 51-6; 10 to 20 base pairs for 51-8; 65 base pairs for 51-15; and 20 to 25 base pairs for 51-20. To verify that the new fragments seen in the HpaII digests in Fig. 2 arose from alterations in HpaII fragment 5, we digested the mutant DNAs with HhaI. The recognition site for HhaI is 5'-N-G-C-G-C-N-3', where N is any nucleotide. The recognition site for HaeII is 5'-R-G-C-G-CY-3', where R is a purine and Y is a pyrimidine. genomes lacking the HaeII site would D E F G Therefore, A B C be expected to lack the HhaI site in the same region. Wild-type polyoma DNA gave three fragments upon digestion with HhaI, as expected (9). The mutants, with the exception of 51-6, gave two fragments: a small fragment corresponding to HhaI fragment 3 from wild-type 1Im - polyoma, and a large fragment corresponding to mm 2fused HhaI fragments 1 and 2, as expected if the qm mutants lacked the HhaI site at 72.5 units, which 3.wlm coincides with the HaeII site. Mutant 51-6 4showed a HhaI cleavage pattern indistinguishable from wild-type polyoma. Mutant 51-6 also retained an HaeII cleavage site, whereas all other mutants lacked it (not shown). 5We further analyzed mutants 51-2, 51-8, 516a 15, and 51-20 by digesting the large fused HhaI fragments 1 and 2 with HpaII. The digests showed fragments comigrating with the pre7sumed altered HpaII fragment 5's in the digests of total mutant DNA, confirming that the altered fragments in the mutant DNA's arose from HpaII fragment 5. We conclude that all the mutants contain deletions in HpaII fragment 5, that mutant 51-6 has an HhaI cleavage site in the neighborhood 8-... ..... -. of the HaeII site (see Discussion), and that all 8 mutants with the exception of 51-6 lack a HhaI site in this region. Cleavage of mutant genomes by HaeM. To attempt to locate the mutant deletions more FIG. 2. Gel electrophore>tic analysis of HpaII di- precisely, the mutant DNAs were digested with gests ofpolyoma deletion iutants. Radiolabeledpol- HaeIII. Mutants containing deletions around yoma DNA was prepared from mouse 3T6 cells inthe HaeII site would be expected to contain fected with polyoma deletic4n mutants. The DNA was alterations in HaeIII fragments 2 and 14' (see digested, and fragments weere analyzed by polyacryl- Fig. 1). The patterns produced by HaeIII diges_
ovm _
_oolo -"a
-M
n
described ineMaterias
amide gel electrophoresis ias described in Materials 0 and Methods. Lanes A andire through F are mutants 51-, 20, respectively. The number of base pairs in each of the fragments of the wild -type DNA is: 1, 1,421; 2, 1,133; 3, 883; 4, 702; 5, 390; 6, 377; 7, 275; 8, 112 (7, 10; T. Friedmann, personal co,mmunication).
a51rew51ld8te5LaneadB
**a tion are shown in Fig. 3. The results are consist-
ent with the results of the HpaII digestions: (i) mutants 51-2 and 51-6 had patterns indistinguishable from those wild-type (the small deletions of 10 to 20 base pairs in mutants 51-2 and 51-6 would not be detectable if they were in
520
WELLS, HUTCHINSON, AND ECKHART
J. VIROL.
and 14', resulting in new fused fragments migrating more slowly than fragment 1. The HaelIl fragment 14', 85 nucleotides in length, ran together with a fragment of 87 nucleotides. The size and location on the genome of these fragments was deduced from the polyoma DNA nucleotide sequence (T. Friedmann, personal communication). Because the two fragments were so similar in size, it was not possible to detect changes in fragment 14' in this pattern. Biological properties of the deletion mutants. All 19 mutants tested appeared to be competent for lytic growth. Virus yield as a function of time was similar for the mutants and wild-type after infection at low and high multiplicities. There was no detectable helper virus DNA in the restriction enzyme digests. The number of plaques as a function of dilution was linear over a 100-fold range. Therefore, deletions of viral DNA in the vicinity of the HaeII site at 72.5 map units did not grossly affect the ability of the viral DNA to replicate or to synthesize viral proteins required for replication. We tested the ability of the mutants carrying deletions near the HaeII site to transform rat F2408 cells. Cultures were infected at multiplicities of 20 PFU/cell, trypsinized, reseeded at 104 and 105 cells per 5-cm dish, incubated for 14 days, and examined for the presence of dense foci. Cultures infected with wild-type polyoma and with all mutants showed transformation frequencies of 1 x 10-:3 to 2 x 10-3 under these conditions. We conclude that the mutants carrying deletions near the HaeII site are not defective in their ability to transform rat F2408 cells, as assayed by focus formation.
DISCUSSION We have isolated 19 mutants of polyoma containing deletions in the region of the HaeII site at 72.5 map units, between the origin of viral DNA replication (71 map units) and the beginning of translation (74 map units) in the early region of the viral genome. The precise location and extent of the deletions can be more directly established by DNA sequencing. However, some FIG. 3. Gel electrophoretic analysis of HaeIII di- conclusions can be drawn by comparing the rediDNA was prepared, Radiolabeled polyoma gests. striction enzyme digestion patterns of the mugested with HaeIII, and analyzed as described in tants with the nucleotide sequence of wild-type Materials and Methods. Lanes A through F are wild type and mutants 51-2, 51-6, 51-8, 51-15, and 51-20, polyoma DNA. The nucleotide sequence of polyoma DNA in respectively. The number of base pairs in fragments 1 through 14' of wild-type DNA are: 718, 673, 540, 514, the region of the HaeII site is shown in Fig. 4 488, 405, 314, 209, 199, 170, 134, 117, 109, 95, 87, and (7). HaeII cleaves a subset of HhaI sites, as 85, respectively (7, 24; T. Friedmann, personal com- noted previously. There is a second HhaI cleavmunication). age site 11 nucleotides clockwise from the HhaI site recognized by HaeII on the 5'-3' strand. The HaeIII fragment 2); and (ii) mutants 51-8, 51-15, HaeIII site separating HaeIII fragments 2 (to and 51-20 apparently had deletions that included the right) and 14' (to the left) is 18 nucleotides the HaeIII cleavage site between fragments 2 clockwise from the HaelI site on the 5'-3' strand.
521
POLYOMA DELETION MUTANTS
VOL. 32, 1979
Hpa EE 3/5
HhaI
Hoe]I
Hha I
Hoe I
Hpa II 5/4
-
5' ACAGGACTGGCGCCTTGGAGGCGCGTTGGGGCCACCCAAA 3'
3' TGTCCTGACCGCGGAACCTCCGCGCAACCCCGGTGGGTTT 5' FIG. 4. Polyoma DNA nucleotide sequence in the region of the HaeII site. The HaeII site is located at about 72.5 map units in the early region of the viral genome. The DNA sequence for the wild-type polyoma strain used here is taken from Friedmann et al. (7).
The HaeIII fragment 14' shown in Fig. 1 is 85 nucleotides in length (7). Mutant 51-2 is missing the HaeII site and both HhaI sites shown in Fig. 4. The mutant retains a HaeIII site in this region. Because of the small size of the deletion (10 to 20 base pairs, estimated from the alteration in migration of HpaII fragment 5), the deletion must begin very near the HaeII site on the left and terminate very near the second HhaI site on the right (Fig. 4). Mutant 51-6 has retained the HaeII site or generated a new one, and has retained the HaeIII site and at least one of the HhaI sites shown in Fig. 4. The mutant contains a small deletion (5 to 10 base pairs), whose location in HpaII fragment 5 cannot be determined from the information available at present. Mutant 51-8 lacks the HaeII site, both HhaI sites, and the HaeIII site shown in Fig. 4. The estimated size (10 to 20 base pairs) suggests that the deletion must begin very near the HaeII site on the left and end very near the HaeIII site on the right. Mutant 51-15, like 51-8, lacks all four cleavage sites shown in Fig. 4. Preliminary DNA nucleotide sequence analysis (J. Coward, unpublished observations) shows that the deletion begins very close to the HaeII site on the left and extends for about 55 base pairs in a clockwise direction (to the right in Fig. 4) on the polyoma physical map. Mutant 51-20 also lacks all four sites shown in Fig. 4. Its size (20 to 25 base pairs) suggests that it resembles 51-8, beginning near the HaeII site on the left and ending near the HaeIII site on the right. It is interesting to note that all four deletions begin near the HaeII site and extend to the right for varying distances. Whether this reflects a requirement of sequences to the left of the HaeII site for virus replication or reflects some polarity in the process by which the deletions were induced, or occurred by chance, we cannot say from the results obtained so far. A variety of defective polyoma mutants, lacking sequences between 72 and 1 map units, require helper DNA in order to replicate (19). The results presented here show that deletions in the region midway between the origin of viral DNA replication and the beginning of translation do
not necessarily affect the ability of polyoma to replicate or to cause cell transformation. Even mutant 51-15, whose deletion extends for about 55 nucleotides from the HaeII site to within about 30 nucleotides of the beginning of translation, is not impaired. Apparently polyoma can tolerate rather large deletions in this region of the genome. ACKNOWLEDGMENTS This investigation was supported by Public Health Service grants CA-13884 and CA-14195, awarded by the National Cancer Institute. R.D.W. was the recipient of a Guggenheim Fellowship. We are grateful to Theodore Friedmann for providing information about the nucleotide sequence of polyoma DNA before publication and to James Coward for unpublished observations and valuable discussions.
LITERATURE CMD 1. Carbon, J., T. E. Shenk, and P. Berg. 1975. Biochemical procedure for production of small deletions in simian virus 40 DNA. Proc. Natl. Acad. Sci. U.S.A. 72:13921396. 2. Cogen, B. 1978. Virus-specific early RNA in 3T6 cells infected by a tsA mutant of polyoma virus. Virology 85: 222-230. 3. Eckhart, W. 1969. Complementation and transformation by temperature-sensitive mutants of polyoma virus. Virology 38:120-125. 4. Feunteun, J., L. Sompayrac, M. Fluck, and T. Benjamin. 1976. Localization of gene functions in polyoma virus DNA. Proc. Natl. Acad. Sci. U.S.A. 73:4169-4173. 5. Francke, B., and W. Eckhart. 1973. Polyoma gene function required for viral DNA synthesis. Virology 55: 127-135. 6. Fried, M., and B. E. Griffin. 1977. Organization of the genomes of polyoma virus and SV40. Adv. Cancer Res. 24:67-113. 7. Friedmann, T., P. LaPorte, and A. Esty. 1978. Nucleotide sequence studies of polyoma DNA: the Hpa II 3/5 junction to the Hpa II 4/Hae III 18 junction encoding the origin of DNA replication and the 5' end of the early region. J. Biol. Chem. 253:6561-6567. 8. Griffin, B. E. 1977. Fine structure of polyoma virus DNA. J. Mol. Biol. 117:447471. 9. Griffin, B. E., and M. Fried. 1975. Amplification of a specific region of the polyoma virus genome. Nature (London) 256:175-179. 10. Griffin, B. E., M. Fried, and A. Cowie. 1974. Polyoma DNA-a physical map. Proc. Natl. Acad. Sci. U.S.A. 71:2077-2081. 11. Hfrt, B. 1967. Selective eztraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-369. 12. Hunter, T., M. A. Hutchinson, and W. Eckhart. 1978. Translation of polyoma virus T antigens in vitro. Proc. Natl. Acad. Sci. U.S.A. 75:5917-5921. 13. Hutchinson, M. A., T. Hunter, and W. Eckhart. 1978. Characterization of T-antigens in polyoma-infected and transformed cells. Cell 15:65-77. 14. Ito, Y., J. Brocklehurst, and R. Dulbecco. 1977. Virus-
522
15.
16. 17.
18. 19.
20.
WELLS, HUTCHINSON, AND ECKHART
specific proteins in the plasma membrane of cells lytically infected or transformed by polyoma virus. Proc. Natl. Acad. Sci. U.S.A. 74:4666-4670. Ito, Y., J. Brocklehurst, N. Spurr, M. Griffiths, J. Hurst, and M. Fried. 1977. Polyoma virus wild type and mutant T-antigens, p. 145-151. In Early proteins of oncogenic viruses. Colloques INSERM-EMBO. Ito, Y., N. Spurr, and R. Dulbecco. 1977. Characterization of polyoma virus T antigen. Proc. Natl. Acad. Sci. U.S.A. 74:1259-1263. Kamen, R., and H. Shure. 1976. Topography of polyoma virus messenger RNA molecules. Cell 7:361-371. Lai, C.-J., and D. Nathans. 1974. Mapping temperaturesensitive mutants of simian virus 40: rescue of mutants by fragments of viral DNA. Virology 60:466-475. Lund, E., M. Fried, and B. E. Griffin. 1977. Polyoma virus defective DNA's. I. Physical maps of a related set of defective molecules (D76, D91, D92). J. Mol. Biol. 117:473-495. Miller, L., and M. Fried. 1976. Construction of the genetic map of the polyoma genome. J. Virol. 18:824-
J. VIROL. 832. 21. Reed, S. K., G. R. Stark, and J. C. Alwine. 1976. Autoregulation of simian virus 40 gene A by T antigen. Proc. Natl. Acad. Sci. U.S.A. 73:3083-3087. 22. Schaffhausen, B., J. Silver, and T. Benjamin. 1978. Tumor antigen(s) in cells productively infected by wildtype polyoma virus and mutant NG-18. Proc. Natl. Acad. Sci. U.S.A. 75:79-83. 23. Smart, J. E., and Y. Ito. 1978. Three species of polyoma virus tumor antigens share common peptide probably near the amino termini of the proteins. Cell 15:14271437. 24. Summers, J. 1975. Physical map of polyoma viral DNA fragments produced by cleavage with a restriction enzyme from Haemophilus aegyptius, endonuclease R. HaeIII. J. Virol. 15:946-958. 25. Tegtmeyer, P. 1972. Simian virus 40 deoxyribonucleic acid synthesis: the viral replicon. J. Virol. 10:591-598. 26. Turler, H., and C. Salomon. 1977. Characterization of polyoma T-antigen, p. 131-144. In Early proteins of oncogenic viruses. Colloques INSERM-EMBO.
