Fish & Shellfish Immunology 40 (2014) 644e647
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short sequence report
Isolation and activity of the promoters for STAT1 and 2 in Atlantic salmon Salmo salar raldine Ganne, Bertrand Collet Catherine Collins*, Ge Marine Scotland, 375 Victoria Road, Aberdeen, AB11 9DB, UK
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 April 2014 Received in revised form 18 July 2014 Accepted 23 July 2014 Available online 13 August 2014
Signal Transducer and Activator of Transcription (STAT) 1 and 2 molecules are part of the interferon (IFN) type I and type II (gIFN) signalling pathways, key pathways in the innate immune response. Genomic sequence regions upstream from the 5-prime Salmo salar ORFs were obtained and shown to have functional activity through their incorporation into luciferase reporter constructs and subsequent activation by salmonid alpha virus (SAV). The STAT1 and STAT2 putative promoter regions were also induced by co-transfected plasmids expressing gIFN and IFN type I respectively. Two IFN-induced gene regulatory motifs (GAAANN) associated in a complete Interferon Stimulating Response Element (ISRE) were identified in the STAT1 putative promoter sequence and several GAS elements conforming to Boehm's consensus TTNCNNNAA. Sixteen IFN-induced gene regulatory motifs (GAAANN) could be identified in the STAT2 putative promoter region but no Boehm's GAS element nor ISRE. A palindromic sequence that conforms to Decker's consensus GAS element TTCNNN(N)GAA was identified. The reporter constructs generated here may prove an additional tool for refining knowledge on interferon signalling in fish and the inhibition of such by some fish viral pathogens. Crown Copyright © 2014 Published by Elsevier Ltd. All rights reserved.
Keywords: STAT2 STAT1 Promoter Viral infection Reporter system
Signal Transducer and Activator of Transcription (STAT) is a family of cytosolic molecules consisting of 6 members involved in cytokine signalling. STAT1/STAT1 and STAT1/STAT2 homo- and heterodimers are involved in the signalling pathways of type I and type II (IFNg) interferons (IFN) respectively [1]. The activation of STAT1 and STAT2 leads to their nuclear translocation, subsequent binding to elements in promoters of antiviral genes and induction of these genes [2]. In general an Interferon Stimulating Response Element (ISRE) and Gamma Activated Sequence (GAS) element are associated with type I IFN and IFNg induced-gene activation respectively. Homologous genes have been isolated in Atlantic salmon (ssSTAT1 [3], ssSTAT2 [4]). The present note reports the isolation of the 50 regulatory sequences of these two salmon genes and their preliminary characterisation in fish cells using a reporter gene system. 1. Sequence isolation and identification of putative motifs Genomic DNA was purified from Atlantic salmon (Salmo salar) kidney tissue using the DNeasy purification kit (Qiagen, Crawley, UK) and used to construct a genomic library using the Universal
* Corresponding author. Tel.: þ44 (0) 1224 425521; fax: þ44 (0) 1224 295511. E-mail address: [email protected] (C. Collins). http://dx.doi.org/10.1016/j.fsi.2014.07.025 1050-4648/Crown Copyright © 2014 Published by Elsevier Ltd. All rights reserved.
Genome Walking Kit (Takara Bio Europe/Clontech, SaintGermain-en-Lay) according to the manufacturer's instructions. Reverse primers were designed from the 50 UTR of the Atlantic salmon STAT1 (ssSTAT1) and STAT2 (ssSTAT2) cDNA sequences ([3,4] Genbank accession numbers NM_001123654; FJ173070; Table 1). The sequences upstream of the ssSTAT1 and ssSTAT2 gene transcription start codons, termed pSTAT1 (1086 nucleotide (nt)) and pSTAT2 (614 nt) are given in Fig. 1A and B, respectively (Genbank accession numbers JQ413375 and JQ413376). Twenty elements characteristic of IFN-induced gene regulatory motifs (GAAANN) were identified in pSTAT1 (Fig. 1A) with two of them being associated in a complete Interferon Stimulating Response Element (ISRE) as described previously [5] in the promoter of the rainbow trout type I IFN inducible Mx gene. Several GAS elements could also be found in pSTAT1 conforming to Boehm's consensus TTNCNNNAA [6]. The architecture of pSTAT1 is similar to the human STAT1 promoter [7], and also to that of Channa argus STAT1 promoter [8] where both a GAS and an ISRE element were identified. GAS and ISRE elements have been found in the promoter regions of IFNg responsive fish genes, and it was demonstrated that the GAS element alone was not able to permit inducibility [9]. Sixteen IFN-induced gene regulatory motifs (GAAANN) could be identified in pSTAT2 but no Boehm's GAS element nor ISRE. There is little information available on transcription factor binding elements
C. Collins et al. / Fish & Shellfish Immunology 40 (2014) 644e647
645
Table 1 Sequence, name and use of the primers in this study. Name STAT1pro STAT1pro STAT1pro STAT2pro STAT2pro STAT2pro STAT1pro STAT1pro STAT2pro STAT2pro GIFN-F GIFN-R IFNA2-F IFNA2-R
Sequence (5'e3') 1R 2R 3R 1R 2R 3R F R F R
CACGAACGAAAGACTTGGAGAAATGATGGT GACTATGGACAACAAATCACGAACGAAAGACT TCCACTTGCTGAGGTACTGTCTGATGTCCA TCATAAAACCATAAACAGAGACAAACTTCGCTTCC GAAGGCATCCCCATCATACAGCTCATCCAC AGCGTTCTGCAGGATCTCTTTCTCTTTTTC GGGGGGGGTACCCTACTTACAGTATCTTCATCA GGGGGGCTCGAGTTATAGTTCTATCTGTAGAGT GGGGGGGGTACCATGTCTGTTGTGTCCTTTGTC GGGGGGCTCGAGTGTGTGCACCTCCCCCCG CCCCCCCCCCTCGAGATGGATGTGTTATCAAGGGCT CCCCCCCCCAAGCTTCTACATGATGCTTGATTTGAG CCCCCCCCCCTCGAGATGTATACAATGCAGAGTTGG CCCCCCCCCAAGCTTTCAGTACATCTGTGCTGCAAG
in the STAT2 promoter region of other organisms for comparison purposes. Given the role STAT2 plays in activation of type I IFN induced genes an ISRE might have been expected for positive up-regulation, and indeed an interferon stimulating factor 3 (ISGF-3) binding motif has been identified in the human STAT2 promoter region (SABiosciences DECODE database). The sequence obtained here for pSTAT2, upstream of the salmon STAT2 gene, is only 614 nt and may not represent the full promoter region. However a palindromic sequence that conforms to Decker's consensus GAS element TTCNNN(N)GAA ([10]; Fig. 1B) was identified. A palindromic sequence similar to Decker's consensus GAS element was found in a subset of ISG promoters to which a STAT1/2 heterodimer, without IRF9, bound, the former complex being induced by type I IFN [11].
Remark
Use Amplification of fragments upstream the transcription start from genome walking libraries
KpnI linker XhoI linker KpnI linker XhoI linker XhoI linker HindIII linker XhoI linker HindIII linker
Construction of luciferase reporter plasmids.
Construction of gIFN and IFNa2 expression plasmids
and IFNA2-F/IFNA2-R (Table 1) designed from Genbank AY795563 and AY216595 respectively and containing XhoI and HindIII restriction sites. The template cDNA used to amplify the products was generated from purified RNA from Atlantic salmon kidney sampled 7 days post infection with Infectious Pancreatic Necrosis virus (IPNV). PCR amplification generated a 543 and 528 nt fragment for IFNg and IFNa2, respectively. The fragments were cloned into pcDNA3.1()/Zeo vector (Life Technologies, Paisley, UK) between the sites XhoI and HindIII as described above and the expression plasmids are designated here as pcIFNg and pcIFNa2 respectively. The empty vector pcDNA3.1()/Zeo was used as a negative control and is designated as pC.
2. Functional characterisation Fragments containing the promoter sequence for STAT1 and STAT2 genes were amplified by PCR from Atlantic salmon genomic DNA using the primer pairs STAT1pro F/STAT1pro R and STAT2pro F/STAT2pro R for pSTAT1 and pSTAT2 respectively (Table 1). Sites for KpnI and XhoI restriction endonucleases were included in the primers (Table 1). PCR amplification was carried out using the high fidelity antibody-based hot start KOD DNA PCR kit according to the manufacturer's instructions (Takara Bio Europe/Clontech, Saint-Germain-en-Laye, France). The reaction mix was as follows in a 25 ml volume: 1 Buffer for KOD Hot Start DNA polymerase, 1.5 mM MgSO4, 0.2 mM each dNTPs, 0.3 mM each primer, 1 ml template (genomic DNA purified from kidney tissue of Atlantic salmon), 0.5 Units KOD Hot Start DNA Polymerase. The cycling conditions were 95 C for 2 min, then 35 cycles of 95 C for 20 s, 60 C for 10 s, 70 C for 45 s, and a final extension step at 70 C for 10 min and hold at 4 C. PCR products were separated on a 1% TBEEtBr-Agarose gel, excised, purified (MiniElute Kit, Qiagen, Crawley, UK) and digested with KpnI and XhoI. Digested fragments were purified and ligated at 16 C for 16 h (T4 DNA ligase kit, Promega UK, Southampton) into the Photinus pyralis firefly luciferase (FF)expressing pGL3Basic-NeoR plasmid, upstream of the luciferase gene [12], previously digested with KpnI and XhoI and purified as described above. Endofree plasmid DNA was prepared (Endofree Maxiprep kit, Qiagen, Crawley, UK) according to the manufacturer's instruction. The plasmid concentration was adjusted to 1.5 mg/ml and stored at 20 C until use for transfection. The reporter plasmids are designated here as pGL3STAT1 and pGL3STAT2. The full coding regions from the Atlantic salmon S. salar IFNg and IFNa2 were amplified using the primers pairs GIFN-F/GIFN-R
Fig. 1. Sequence pSTAT1 (A) and pSTAT2 (B), excluding primer sequence. IRF-E element are shaded, Boehm's GAS element [6] are boxed whereas Decker's GAS elements are boxed and in italic [10]. Complete Interferon Stimulating Response Element (ISRE) consisting of two elements characteristic of IFN-induced gene regulatory motifs (GAAANN) is highlighted in bold.
646
C. Collins et al. / Fish & Shellfish Immunology 40 (2014) 644e647
2.1. Transfection experiment 1 Cells from a confluent culture of Chinook Salmon Embryo 214 (CHSE-214) (ATCC CRL-1681) grown in 75 cm2 flasks were detached using 0.5% Trypsin-EDTA (Life Technologies, Paisley, UK), centrifuged at 12,000 g for 30 s at room temperature and washed once with CHSE-214 culture medium (ATCC CRL-1681) and twice with 1 ml D-PBS (Life Technologies, Paisley, UK). The transfection procedure was carried out using a Neon device and the Neon 100 ml kit according to the manufacturer's instructions (Life Technologies, Paisley, UK). The cell pellet was resuspended in solution R at an approximate density of 107 cells/ml and mixed with plasmid DNA solution at a total concentration of 50 ng/ml of pGL3STAT1, pGL3STAT2, pMX1 (promoter of rainbow trout type I IFN inducible MX gene; [12e14]) as positive control or promoter-less pGL3-basicNeoR as negative control. A constant amount of 8 ng/ml of pmaxGFP (plasmid containing CMV promoter constitutively expressing GFP: Amaxa, Lonza, Basel) was added to each of the four groups as control for variation in transfection efficiencies. A voltage of 1300 v was applied twice for 20 ms according to prior optimisation tests for CHSE. The cells were plated into a 24 well plate and left overnight at 22 C. Salmon alphavirus (SAV) cell culture adapted isolate F93-125 [15] was added to half of the wells (3 wells per plasmid type/insert) at a multiplicity of infection of approx. 0.1 and left for 2 days at 15 C. The culture medium was replaced with PBS (Life Technologies, Paisley, UK) and the GFP fluorescence was directly measured in the cells using a Victor3 fluorometer/luminometer (PerkineElmer) to estimate transfection efficiency. The plate was drained, and 75 ml of Steady Glo substrate was added (Promega UK, Southampton) to measure firefly (FF) luciferase activity. The light emission was measured over 10 s. The Relative FF Activity (ratio FF/ GFP) was computed and analysed by two-way ANOVA (Minitab, VSN International Ltd). Two days after infection with SAV F93-125, CHSE transfected with reporter constructs pGL3STAT1, pGL3STAT2 or pMx1 showed significant induction of luciferase (p < 0.05) giving inducibility of 3.1, 2.6 and 2.6 fold, respectively compared to uninfected transfected control cells (Fig. 2A). This level of induction for pMX1 is similar to that seen in other studies [12]. The control promoter-less construct (pGL3-basic-NeoR) did not show significant induction (Fig. 2A). The cells did not show signs of cytopathic effect at the time of measurement (data not shown). These results demonstrated that pGL3STAT1 and pGL3STAT2 sequences conferred viral inducibility to the reporter luciferase gene. Further characterisation would inform on the exact contributions of the individual GAS and ISRE elements following viral exposure. There was a significant increase in the basal (un-infected) level of activity of the reporter gene of pGL3STAT1 and pGL3STAT2 (p < 0.05) compared to the pGL3basic control (Fig. 2A). This reveals a difference in induction kinetics/mechanism between the STAT1/2 and Mx genes whereby STAT1/2 genes are constitutively induced at low levels in absence of stimulation unlike Mx which was virtually undetectable based on its promoter activity. 2.2. Transfection experiment 2 TO cells (which have low levels of constitutive IFN expression; [16]) were cultivated as described previously [16] and transfected as described above but using parameters optimised for TO cells (two pulses of 1400 v for 20 ms). Cells were transfected with combination of plasmids as follows: 1.pGL3STAT1 (50 ng/ml) combined with pC, pcIFNg or pcIFNa2 (50 ng/ml). 2. pGL3STAT2 (50 ng/ ml) combined with pC, pcIFNg or pcIFNa2 (50 ng/ml). A constant amount (8 ng/ml) of a control plasmid containing CMV promoter and expressing the Renilla reniformis luciferase (RL) was added to
Fig. 2. (A). Activity of pGL3STAT1, pGL3STAT2, pMX1 and pGL3-basic in CHSE cells after infection with Salmon Alphavirus SAV (SAV ¼ infected; CONT ¼ un-infected control). #: p < 0.05 comparison of constitutive induction between promoter-less pGL3-basic plasmid and promoter plasmids in un-infected CHSE cells. *: p < 0.05 comparison between infected and un-infected controls in CHSE. NS ¼ Not Significant (p > 0.05). (B). Activity of pGL3STAT1, pGL3STAT2 after co-transfection with empty vector pcDNA3.1()/Zeo, (pC), pcIFNg (GIFN) e or pcIFNa2 (IFNA2) e expressing plasmids in TO cells. *: p < 0.05 comparison to group pC. Data represent average Relative Light Units (RLU) þ SE corrected to GFP (A, N ¼ 3) or RL (B, N ¼ 6).
correct for transfection/expression efficiency (pRL vector, Promega UK, Southampton). Transfected cells were added on a 48-well plate (6 groups, 6 replicates per group) and incubated for 72 h at 22 C. The dual Glo assay (Promega UK, Southampton) was used to measure the RL and FF luciferase independently for each well. The Relative FF Activity (ratio FF/RL) was computed and analysed by two-way ANOVA (Minitab, VSN International Ltd). Gene expression of candidate immune genes was analysed using TaqMan QPCR assays as described in [16]. Expression of IFNg from pcIFNg significantly induced pGL3STAT1 (p < 0.05), as observed previously with respect to STAT1 expression [17,18], but not pGL3STAT2 when compared to the empty expression vector þ pGL3STAT1/pGL3STAT2 and after correction for transfection efficiency (Fig. 2B). In contrast, expression of pcIFNa2 induced significantly pGL3STAT2 (p < 0.05) but not pGL3STAT1. In parallel, TO cells were transfected only with no DNA (mock), pcDNA3.1() Zeo (empty vector, pC), pcIFNg or pcIFNa2 as described above. Cells were seeded onto 4 6-well plates (4 groups, N ¼ 6) and incubated for 72 h. Mx, gIP, IFNg and IFNa2 gene expression was measured in each transfection group as described previously [16]. pcIFNg did not induce IFNa2 but pcIFNa2 induced IFNg (Table 2). Expression results for pGL3STAT1/2 and IFNg/IFNa2 taken together might suggest the following scenario: IFNg induces STAT1, homo-dimers of which are required to activate IFNg induced genes, IFNa induces STAT2, but also requires STAT1 for activation of its ISGs and this it induces indirectly through induction of IFNg.
C. Collins et al. / Fish & Shellfish Immunology 40 (2014) 644e647 Table 2 Gene expression in TO cells transfected with pIFNg or pIFNa2 plasmids. Fold increases are expression relative to cells mock transfected. Transfection group
NO DNA pC pcIFNg pcIFNa2
Fold increase related to No DNA control (N ¼ 6) MX
gIP
IFNg
IFNa2
1.0 3.7 236.7 34.1
1.0 0.5 8620.8 5.5
1.0 5.0 1767638.1a 601.6
1.0 8.7 0.0 2616.0a
a Combined expression of plasmid, carry-over of plasmid DNA and endogeneous gene expression.
Type I IFN has been reported to induce IFNg in a number of different cell types in humans [19e21], but IFNg induction by type I IFN is inhibited when STAT1 levels increase [22]. This may act in down regulating IFNg expression during viral infections. gIP is induced by both type I IFN and IFNg, similar to results found in other studies on fish [23] but induction by IFNg is approximately 1517 fold higher (Table 2). Interestingly, Mx was induced approximately 70 fold higher by pcIFNg than by pcIFNa2 which is in contrast to results found in other studies [23,24]. However, the amount of Mx protein produced in cells transfected by pcIFNg or pcIFNa2 is unknown and may be different. The role of salmonid IFNg in response to viral infection has been investigated in vitro in relation to the salmonid alpha virus, subtype 3 [24,25]. Conflicting results were found by the authors with Sun et al. [24] finding a significant role for IFNg in protection and Xu et al. [25] little or no ability to mitigate infection. The high level of expression of Mx found in this study following induction with pcIFNg could support an important role for IFNg in the antiviral response, but it is in contradiction to previous reports which showed induction of Mx by IFNg, but at lower levels compared to IFNa [17,24,9]. Sun et al. (2010) [24] suggested that IFNg may induce an antiviral response through induction of IFNa, as antiIFNa antibody reduced the antiviral effect of IFNg, and expression analyses showed induction of IFNa by recombinant IFNg. Martin et al. (2007) [23,18] also found increased mRNA levels of IFNa after stimulation of SHK cells with rIFNg. However, we did not observe this here following gene expression analyses of pcIFNg transfected cells. The antiviral effect due to IFNg previously observed [24] may have resulted from induction of STAT1 and a ready supply of the STAT1 protein for IFNa pathway when the cells were subsequently infected by SAV3. Why a similar result was not observed by Xu et al. [25] is not clear but both studies used very different viral loads, and amounts of recombinant IFN also differed though the latter overlapped between the studies. The current work contributes to understanding the promoter elements involved in STAT1 and STAT2 induction by type I IFN and IFNg. However a much more refined study is required to identify the exact regions involved. The study does demonstrate that the reporter constructs for STAT1 and STAT2 are functional and as such represent additional tools for the study of fish antiviral responses and viral modulation of these responses as well as applied cellbased functional assays for monitoring of fish disease status. Acknowledgements This work was partly funded by EU FP6 project IMAQUANIM, project number 007103 and by EU FP7 project TARGETFISH, project number 311993.
647
References [1] Dunn GP, Koebel CM, Schreiber RD. Interferons, immunity and cancer immunoediting. Nat Rev Immunol 2006;6:836e48. [2] Platanias LC. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat Rev Immunol 2005;5:375e86. [3] Collet B, Bain N, Prevost S, Besinque G, McBeath A, Snow M, et al. Atlantic salmon Salmo salar Signal Transducer and Activator of Transcription STAT-1: a contrasting kinetics of expression upon ISAV or IPNV infection. Fish Shellfish Immunol 2008;25:861e7. [4] Collet B, Ganne G, Bird S, Collins C. Isolation and expression profile of a gene encoding for the Signal Transducer and Activator of Transcription STAT-2 in Atlantic salmon (Salmo salar). Dev Comp Immunol 2009;33:821e9. [5] Collet B, Secombes CJ. Type I interferon signaling in fish. Fish Shellfish Immunol 2002;12:389e97. [6] Boehm U, Klamp T, Groot M, Howard JC. Cellular responses to interferon. Annu Rev Immunol 1997;15:749e95. [7] Wong LH, Sim H, Chatterjee-Kishore M, Hatzinisiriou I, Devenish RJ, Stark G, et al. Isolation and characterization of a human STAT1 gene regulatory element. J Biol Chem 2002;277:19408e17. [8] Jia W, Zhou X. Molecular structural and functional characterization of STAT1 gene regulatory region in teleost Channa argus. Vet Immunol Immunopathol 2010;135:146e51. [9] Castro R, Martin SAM, Bird S, Lamas J, Secombes CJ. Characterisation of ginterferon responsive promoters in fish. Mol Immunol 2008;45:3454e62. [10] Decker T, Kovarik P, Meinke A. GAS elements: a few nucleotides with a major impact on cytokine-induced gene expression. J Interferon Cytokine Res 1997;17:121e34. [11] Ghislain JJ, Wong T, Nquyen M, Fish EN. The interferon-inducible Stat2:Stat1 heterodimer preferentially binds in vitro to a consensus element found in the promoters of a subset of interferon-stimulated genes. J Interferon Cytokine Res 2001;21:379e88. [12] Collet B, Boudinot P, Benmansour A, Secombes CJ. An Mx1 promoter-reporter system to study interferon pathways in rainbow trout. Dev Comp Immunol 2004;28:793e801. [13] Collet B, Secombes CJ. The rainbow trout Mx1 promoter: structural and functional characterisation. Eur J Biochem 2001;286:1577e84. [14] Jørgensen JB, Johansen A, Hegseth MN, Zou J, Robertsen B, Collet B, et al. A recombinant CHSE-214 cell line expressing an Mx1 promoter-reporter system responds to both interferon type I and type II from salmonids and represents a versatile tool to study the IFN-system in teleost fish. Fish Shellfish Immunol 2007;23:1294e303. [15] Weston J, Villoing S, Bremont M, Castric J, Pfeffer M, Jewhurst V, et al. Comparison of two aquatic alphaviruses, salmon pancreas disease virus and sleeping disease virus, by using genome sequence analysis, monoclonal reactivity, and cross-infection. J Virol 2002;76:6155e63. [16] Collet B, Collins C. Comparative gene expression profile in two Atlantic salmon cell lines TO and SHK-1. Vet Immunol Immunopathol 2009;130:92e5. [17] Zou J, Carrington A, Collet B, Dijkstra JM, Yoshiura Y, Bols N, et al. Identification and bioactivities of IFN-gamma in rainbow trout Oncorhynchus mykiss: the first Th1-type cytokine characterized functionally in fish. J Immunol 2005;175:2484e94. [18] Skjesol A, Hansen T, Shi C-Y, Thim HL, Jørgensen JB. Structural and functional studies of STAT1 from Atlantic salmon (Salmo salar). BMC Immunol 2010;11. [19] Matikainen S, Paananen A, Miettinen M, Kurimoto M, Timonen T, Julkunen I, et al. IFN-alpha and IL-18 synergistically enhance IFN-gamma production in human NK cells: differential regulation of Stat4 activation and IFN-gamma gene expression by IFN-alpha and IL-12. Eur J Immunol 2001;31:2236e45. €rfer B, Blackwell S, Ballas ZK, et al. [20] Krug A, Rothenfusser S, Hornung V, Jahrsdo Identification of CpG oligonucleotide sequences with high induction of IFNalpha/beta in plasmacytoid dendritic cells. Eur J Immunol 2001;31:2154e63. [21] Mack EA, Kallal LE, Demers DA, Biron CA. Type 1 interferon induction of natural killer cell gamma interferon production for defence during lymphocytic choriomeningitis virus Infection. mBio 2011;2. e00169e11. [22] Nguyen KB, Cousens LP, Doughty LA, Pien GC, Durbin JE, Biron CA. Interferon alpha/beta-mediated inhibition and promotion of interferon gamma: STAT1 resolves a paradox. Nat Immunol 2000;1:70e6. [23] Martin SAM, Taggart JB, Seear P, Bron JE, Talbot R, Teale AJ, et al. Interferon type I and type II responses in an Atlantic salmon (Salmo salar) SHK-1 cell line by the salmon TRAITS/SGP microarray. Physiol Genomics 2007;32:33e44. [24] Sun B, Skjæveland I, Svingerud T, Zou J, Jørgensen J, Robertsen B. Antiviral activity of salmonid interferon gamma against infectious pancreatic necrosis virus and salmonid alphavirus and its dependency on type I interferon. J Virol 2011;85:9188e98. [25] Xu C, Guo T-C, Mutoloki S, Haugland Ø, Marjara IS, Evensen Ø. Alpha interferon and not gamma interferon inhibits salmonid alphavirus subtype 3 replication in vitro. J Virol 2010;84:8903e12.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Short sequence report
Isolation and activity of the promoters for STAT1 and 2 in Atlantic salmon Salmo salar raldine Ganne, Bertrand Collet Catherine Collins*, Ge Marine Scotland, 375 Victoria Road, Aberdeen, AB11 9DB, UK
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 April 2014 Received in revised form 18 July 2014 Accepted 23 July 2014 Available online 13 August 2014
Signal Transducer and Activator of Transcription (STAT) 1 and 2 molecules are part of the interferon (IFN) type I and type II (gIFN) signalling pathways, key pathways in the innate immune response. Genomic sequence regions upstream from the 5-prime Salmo salar ORFs were obtained and shown to have functional activity through their incorporation into luciferase reporter constructs and subsequent activation by salmonid alpha virus (SAV). The STAT1 and STAT2 putative promoter regions were also induced by co-transfected plasmids expressing gIFN and IFN type I respectively. Two IFN-induced gene regulatory motifs (GAAANN) associated in a complete Interferon Stimulating Response Element (ISRE) were identified in the STAT1 putative promoter sequence and several GAS elements conforming to Boehm's consensus TTNCNNNAA. Sixteen IFN-induced gene regulatory motifs (GAAANN) could be identified in the STAT2 putative promoter region but no Boehm's GAS element nor ISRE. A palindromic sequence that conforms to Decker's consensus GAS element TTCNNN(N)GAA was identified. The reporter constructs generated here may prove an additional tool for refining knowledge on interferon signalling in fish and the inhibition of such by some fish viral pathogens. Crown Copyright © 2014 Published by Elsevier Ltd. All rights reserved.
Keywords: STAT2 STAT1 Promoter Viral infection Reporter system
Signal Transducer and Activator of Transcription (STAT) is a family of cytosolic molecules consisting of 6 members involved in cytokine signalling. STAT1/STAT1 and STAT1/STAT2 homo- and heterodimers are involved in the signalling pathways of type I and type II (IFNg) interferons (IFN) respectively [1]. The activation of STAT1 and STAT2 leads to their nuclear translocation, subsequent binding to elements in promoters of antiviral genes and induction of these genes [2]. In general an Interferon Stimulating Response Element (ISRE) and Gamma Activated Sequence (GAS) element are associated with type I IFN and IFNg induced-gene activation respectively. Homologous genes have been isolated in Atlantic salmon (ssSTAT1 [3], ssSTAT2 [4]). The present note reports the isolation of the 50 regulatory sequences of these two salmon genes and their preliminary characterisation in fish cells using a reporter gene system. 1. Sequence isolation and identification of putative motifs Genomic DNA was purified from Atlantic salmon (Salmo salar) kidney tissue using the DNeasy purification kit (Qiagen, Crawley, UK) and used to construct a genomic library using the Universal
* Corresponding author. Tel.: þ44 (0) 1224 425521; fax: þ44 (0) 1224 295511. E-mail address: [email protected] (C. Collins). http://dx.doi.org/10.1016/j.fsi.2014.07.025 1050-4648/Crown Copyright © 2014 Published by Elsevier Ltd. All rights reserved.
Genome Walking Kit (Takara Bio Europe/Clontech, SaintGermain-en-Lay) according to the manufacturer's instructions. Reverse primers were designed from the 50 UTR of the Atlantic salmon STAT1 (ssSTAT1) and STAT2 (ssSTAT2) cDNA sequences ([3,4] Genbank accession numbers NM_001123654; FJ173070; Table 1). The sequences upstream of the ssSTAT1 and ssSTAT2 gene transcription start codons, termed pSTAT1 (1086 nucleotide (nt)) and pSTAT2 (614 nt) are given in Fig. 1A and B, respectively (Genbank accession numbers JQ413375 and JQ413376). Twenty elements characteristic of IFN-induced gene regulatory motifs (GAAANN) were identified in pSTAT1 (Fig. 1A) with two of them being associated in a complete Interferon Stimulating Response Element (ISRE) as described previously [5] in the promoter of the rainbow trout type I IFN inducible Mx gene. Several GAS elements could also be found in pSTAT1 conforming to Boehm's consensus TTNCNNNAA [6]. The architecture of pSTAT1 is similar to the human STAT1 promoter [7], and also to that of Channa argus STAT1 promoter [8] where both a GAS and an ISRE element were identified. GAS and ISRE elements have been found in the promoter regions of IFNg responsive fish genes, and it was demonstrated that the GAS element alone was not able to permit inducibility [9]. Sixteen IFN-induced gene regulatory motifs (GAAANN) could be identified in pSTAT2 but no Boehm's GAS element nor ISRE. There is little information available on transcription factor binding elements
C. Collins et al. / Fish & Shellfish Immunology 40 (2014) 644e647
645
Table 1 Sequence, name and use of the primers in this study. Name STAT1pro STAT1pro STAT1pro STAT2pro STAT2pro STAT2pro STAT1pro STAT1pro STAT2pro STAT2pro GIFN-F GIFN-R IFNA2-F IFNA2-R
Sequence (5'e3') 1R 2R 3R 1R 2R 3R F R F R
CACGAACGAAAGACTTGGAGAAATGATGGT GACTATGGACAACAAATCACGAACGAAAGACT TCCACTTGCTGAGGTACTGTCTGATGTCCA TCATAAAACCATAAACAGAGACAAACTTCGCTTCC GAAGGCATCCCCATCATACAGCTCATCCAC AGCGTTCTGCAGGATCTCTTTCTCTTTTTC GGGGGGGGTACCCTACTTACAGTATCTTCATCA GGGGGGCTCGAGTTATAGTTCTATCTGTAGAGT GGGGGGGGTACCATGTCTGTTGTGTCCTTTGTC GGGGGGCTCGAGTGTGTGCACCTCCCCCCG CCCCCCCCCCTCGAGATGGATGTGTTATCAAGGGCT CCCCCCCCCAAGCTTCTACATGATGCTTGATTTGAG CCCCCCCCCCTCGAGATGTATACAATGCAGAGTTGG CCCCCCCCCAAGCTTTCAGTACATCTGTGCTGCAAG
in the STAT2 promoter region of other organisms for comparison purposes. Given the role STAT2 plays in activation of type I IFN induced genes an ISRE might have been expected for positive up-regulation, and indeed an interferon stimulating factor 3 (ISGF-3) binding motif has been identified in the human STAT2 promoter region (SABiosciences DECODE database). The sequence obtained here for pSTAT2, upstream of the salmon STAT2 gene, is only 614 nt and may not represent the full promoter region. However a palindromic sequence that conforms to Decker's consensus GAS element TTCNNN(N)GAA ([10]; Fig. 1B) was identified. A palindromic sequence similar to Decker's consensus GAS element was found in a subset of ISG promoters to which a STAT1/2 heterodimer, without IRF9, bound, the former complex being induced by type I IFN [11].
Remark
Use Amplification of fragments upstream the transcription start from genome walking libraries
KpnI linker XhoI linker KpnI linker XhoI linker XhoI linker HindIII linker XhoI linker HindIII linker
Construction of luciferase reporter plasmids.
Construction of gIFN and IFNa2 expression plasmids
and IFNA2-F/IFNA2-R (Table 1) designed from Genbank AY795563 and AY216595 respectively and containing XhoI and HindIII restriction sites. The template cDNA used to amplify the products was generated from purified RNA from Atlantic salmon kidney sampled 7 days post infection with Infectious Pancreatic Necrosis virus (IPNV). PCR amplification generated a 543 and 528 nt fragment for IFNg and IFNa2, respectively. The fragments were cloned into pcDNA3.1()/Zeo vector (Life Technologies, Paisley, UK) between the sites XhoI and HindIII as described above and the expression plasmids are designated here as pcIFNg and pcIFNa2 respectively. The empty vector pcDNA3.1()/Zeo was used as a negative control and is designated as pC.
2. Functional characterisation Fragments containing the promoter sequence for STAT1 and STAT2 genes were amplified by PCR from Atlantic salmon genomic DNA using the primer pairs STAT1pro F/STAT1pro R and STAT2pro F/STAT2pro R for pSTAT1 and pSTAT2 respectively (Table 1). Sites for KpnI and XhoI restriction endonucleases were included in the primers (Table 1). PCR amplification was carried out using the high fidelity antibody-based hot start KOD DNA PCR kit according to the manufacturer's instructions (Takara Bio Europe/Clontech, Saint-Germain-en-Laye, France). The reaction mix was as follows in a 25 ml volume: 1 Buffer for KOD Hot Start DNA polymerase, 1.5 mM MgSO4, 0.2 mM each dNTPs, 0.3 mM each primer, 1 ml template (genomic DNA purified from kidney tissue of Atlantic salmon), 0.5 Units KOD Hot Start DNA Polymerase. The cycling conditions were 95 C for 2 min, then 35 cycles of 95 C for 20 s, 60 C for 10 s, 70 C for 45 s, and a final extension step at 70 C for 10 min and hold at 4 C. PCR products were separated on a 1% TBEEtBr-Agarose gel, excised, purified (MiniElute Kit, Qiagen, Crawley, UK) and digested with KpnI and XhoI. Digested fragments were purified and ligated at 16 C for 16 h (T4 DNA ligase kit, Promega UK, Southampton) into the Photinus pyralis firefly luciferase (FF)expressing pGL3Basic-NeoR plasmid, upstream of the luciferase gene [12], previously digested with KpnI and XhoI and purified as described above. Endofree plasmid DNA was prepared (Endofree Maxiprep kit, Qiagen, Crawley, UK) according to the manufacturer's instruction. The plasmid concentration was adjusted to 1.5 mg/ml and stored at 20 C until use for transfection. The reporter plasmids are designated here as pGL3STAT1 and pGL3STAT2. The full coding regions from the Atlantic salmon S. salar IFNg and IFNa2 were amplified using the primers pairs GIFN-F/GIFN-R
Fig. 1. Sequence pSTAT1 (A) and pSTAT2 (B), excluding primer sequence. IRF-E element are shaded, Boehm's GAS element [6] are boxed whereas Decker's GAS elements are boxed and in italic [10]. Complete Interferon Stimulating Response Element (ISRE) consisting of two elements characteristic of IFN-induced gene regulatory motifs (GAAANN) is highlighted in bold.
646
C. Collins et al. / Fish & Shellfish Immunology 40 (2014) 644e647
2.1. Transfection experiment 1 Cells from a confluent culture of Chinook Salmon Embryo 214 (CHSE-214) (ATCC CRL-1681) grown in 75 cm2 flasks were detached using 0.5% Trypsin-EDTA (Life Technologies, Paisley, UK), centrifuged at 12,000 g for 30 s at room temperature and washed once with CHSE-214 culture medium (ATCC CRL-1681) and twice with 1 ml D-PBS (Life Technologies, Paisley, UK). The transfection procedure was carried out using a Neon device and the Neon 100 ml kit according to the manufacturer's instructions (Life Technologies, Paisley, UK). The cell pellet was resuspended in solution R at an approximate density of 107 cells/ml and mixed with plasmid DNA solution at a total concentration of 50 ng/ml of pGL3STAT1, pGL3STAT2, pMX1 (promoter of rainbow trout type I IFN inducible MX gene; [12e14]) as positive control or promoter-less pGL3-basicNeoR as negative control. A constant amount of 8 ng/ml of pmaxGFP (plasmid containing CMV promoter constitutively expressing GFP: Amaxa, Lonza, Basel) was added to each of the four groups as control for variation in transfection efficiencies. A voltage of 1300 v was applied twice for 20 ms according to prior optimisation tests for CHSE. The cells were plated into a 24 well plate and left overnight at 22 C. Salmon alphavirus (SAV) cell culture adapted isolate F93-125 [15] was added to half of the wells (3 wells per plasmid type/insert) at a multiplicity of infection of approx. 0.1 and left for 2 days at 15 C. The culture medium was replaced with PBS (Life Technologies, Paisley, UK) and the GFP fluorescence was directly measured in the cells using a Victor3 fluorometer/luminometer (PerkineElmer) to estimate transfection efficiency. The plate was drained, and 75 ml of Steady Glo substrate was added (Promega UK, Southampton) to measure firefly (FF) luciferase activity. The light emission was measured over 10 s. The Relative FF Activity (ratio FF/ GFP) was computed and analysed by two-way ANOVA (Minitab, VSN International Ltd). Two days after infection with SAV F93-125, CHSE transfected with reporter constructs pGL3STAT1, pGL3STAT2 or pMx1 showed significant induction of luciferase (p < 0.05) giving inducibility of 3.1, 2.6 and 2.6 fold, respectively compared to uninfected transfected control cells (Fig. 2A). This level of induction for pMX1 is similar to that seen in other studies [12]. The control promoter-less construct (pGL3-basic-NeoR) did not show significant induction (Fig. 2A). The cells did not show signs of cytopathic effect at the time of measurement (data not shown). These results demonstrated that pGL3STAT1 and pGL3STAT2 sequences conferred viral inducibility to the reporter luciferase gene. Further characterisation would inform on the exact contributions of the individual GAS and ISRE elements following viral exposure. There was a significant increase in the basal (un-infected) level of activity of the reporter gene of pGL3STAT1 and pGL3STAT2 (p < 0.05) compared to the pGL3basic control (Fig. 2A). This reveals a difference in induction kinetics/mechanism between the STAT1/2 and Mx genes whereby STAT1/2 genes are constitutively induced at low levels in absence of stimulation unlike Mx which was virtually undetectable based on its promoter activity. 2.2. Transfection experiment 2 TO cells (which have low levels of constitutive IFN expression; [16]) were cultivated as described previously [16] and transfected as described above but using parameters optimised for TO cells (two pulses of 1400 v for 20 ms). Cells were transfected with combination of plasmids as follows: 1.pGL3STAT1 (50 ng/ml) combined with pC, pcIFNg or pcIFNa2 (50 ng/ml). 2. pGL3STAT2 (50 ng/ ml) combined with pC, pcIFNg or pcIFNa2 (50 ng/ml). A constant amount (8 ng/ml) of a control plasmid containing CMV promoter and expressing the Renilla reniformis luciferase (RL) was added to
Fig. 2. (A). Activity of pGL3STAT1, pGL3STAT2, pMX1 and pGL3-basic in CHSE cells after infection with Salmon Alphavirus SAV (SAV ¼ infected; CONT ¼ un-infected control). #: p < 0.05 comparison of constitutive induction between promoter-less pGL3-basic plasmid and promoter plasmids in un-infected CHSE cells. *: p < 0.05 comparison between infected and un-infected controls in CHSE. NS ¼ Not Significant (p > 0.05). (B). Activity of pGL3STAT1, pGL3STAT2 after co-transfection with empty vector pcDNA3.1()/Zeo, (pC), pcIFNg (GIFN) e or pcIFNa2 (IFNA2) e expressing plasmids in TO cells. *: p < 0.05 comparison to group pC. Data represent average Relative Light Units (RLU) þ SE corrected to GFP (A, N ¼ 3) or RL (B, N ¼ 6).
correct for transfection/expression efficiency (pRL vector, Promega UK, Southampton). Transfected cells were added on a 48-well plate (6 groups, 6 replicates per group) and incubated for 72 h at 22 C. The dual Glo assay (Promega UK, Southampton) was used to measure the RL and FF luciferase independently for each well. The Relative FF Activity (ratio FF/RL) was computed and analysed by two-way ANOVA (Minitab, VSN International Ltd). Gene expression of candidate immune genes was analysed using TaqMan QPCR assays as described in [16]. Expression of IFNg from pcIFNg significantly induced pGL3STAT1 (p < 0.05), as observed previously with respect to STAT1 expression [17,18], but not pGL3STAT2 when compared to the empty expression vector þ pGL3STAT1/pGL3STAT2 and after correction for transfection efficiency (Fig. 2B). In contrast, expression of pcIFNa2 induced significantly pGL3STAT2 (p < 0.05) but not pGL3STAT1. In parallel, TO cells were transfected only with no DNA (mock), pcDNA3.1() Zeo (empty vector, pC), pcIFNg or pcIFNa2 as described above. Cells were seeded onto 4 6-well plates (4 groups, N ¼ 6) and incubated for 72 h. Mx, gIP, IFNg and IFNa2 gene expression was measured in each transfection group as described previously [16]. pcIFNg did not induce IFNa2 but pcIFNa2 induced IFNg (Table 2). Expression results for pGL3STAT1/2 and IFNg/IFNa2 taken together might suggest the following scenario: IFNg induces STAT1, homo-dimers of which are required to activate IFNg induced genes, IFNa induces STAT2, but also requires STAT1 for activation of its ISGs and this it induces indirectly through induction of IFNg.
C. Collins et al. / Fish & Shellfish Immunology 40 (2014) 644e647 Table 2 Gene expression in TO cells transfected with pIFNg or pIFNa2 plasmids. Fold increases are expression relative to cells mock transfected. Transfection group
NO DNA pC pcIFNg pcIFNa2
Fold increase related to No DNA control (N ¼ 6) MX
gIP
IFNg
IFNa2
1.0 3.7 236.7 34.1
1.0 0.5 8620.8 5.5
1.0 5.0 1767638.1a 601.6
1.0 8.7 0.0 2616.0a
a Combined expression of plasmid, carry-over of plasmid DNA and endogeneous gene expression.
Type I IFN has been reported to induce IFNg in a number of different cell types in humans [19e21], but IFNg induction by type I IFN is inhibited when STAT1 levels increase [22]. This may act in down regulating IFNg expression during viral infections. gIP is induced by both type I IFN and IFNg, similar to results found in other studies on fish [23] but induction by IFNg is approximately 1517 fold higher (Table 2). Interestingly, Mx was induced approximately 70 fold higher by pcIFNg than by pcIFNa2 which is in contrast to results found in other studies [23,24]. However, the amount of Mx protein produced in cells transfected by pcIFNg or pcIFNa2 is unknown and may be different. The role of salmonid IFNg in response to viral infection has been investigated in vitro in relation to the salmonid alpha virus, subtype 3 [24,25]. Conflicting results were found by the authors with Sun et al. [24] finding a significant role for IFNg in protection and Xu et al. [25] little or no ability to mitigate infection. The high level of expression of Mx found in this study following induction with pcIFNg could support an important role for IFNg in the antiviral response, but it is in contradiction to previous reports which showed induction of Mx by IFNg, but at lower levels compared to IFNa [17,24,9]. Sun et al. (2010) [24] suggested that IFNg may induce an antiviral response through induction of IFNa, as antiIFNa antibody reduced the antiviral effect of IFNg, and expression analyses showed induction of IFNa by recombinant IFNg. Martin et al. (2007) [23,18] also found increased mRNA levels of IFNa after stimulation of SHK cells with rIFNg. However, we did not observe this here following gene expression analyses of pcIFNg transfected cells. The antiviral effect due to IFNg previously observed [24] may have resulted from induction of STAT1 and a ready supply of the STAT1 protein for IFNa pathway when the cells were subsequently infected by SAV3. Why a similar result was not observed by Xu et al. [25] is not clear but both studies used very different viral loads, and amounts of recombinant IFN also differed though the latter overlapped between the studies. The current work contributes to understanding the promoter elements involved in STAT1 and STAT2 induction by type I IFN and IFNg. However a much more refined study is required to identify the exact regions involved. The study does demonstrate that the reporter constructs for STAT1 and STAT2 are functional and as such represent additional tools for the study of fish antiviral responses and viral modulation of these responses as well as applied cellbased functional assays for monitoring of fish disease status. Acknowledgements This work was partly funded by EU FP6 project IMAQUANIM, project number 007103 and by EU FP7 project TARGETFISH, project number 311993.
647
References [1] Dunn GP, Koebel CM, Schreiber RD. Interferons, immunity and cancer immunoediting. Nat Rev Immunol 2006;6:836e48. [2] Platanias LC. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat Rev Immunol 2005;5:375e86. [3] Collet B, Bain N, Prevost S, Besinque G, McBeath A, Snow M, et al. Atlantic salmon Salmo salar Signal Transducer and Activator of Transcription STAT-1: a contrasting kinetics of expression upon ISAV or IPNV infection. Fish Shellfish Immunol 2008;25:861e7. [4] Collet B, Ganne G, Bird S, Collins C. Isolation and expression profile of a gene encoding for the Signal Transducer and Activator of Transcription STAT-2 in Atlantic salmon (Salmo salar). Dev Comp Immunol 2009;33:821e9. [5] Collet B, Secombes CJ. Type I interferon signaling in fish. Fish Shellfish Immunol 2002;12:389e97. [6] Boehm U, Klamp T, Groot M, Howard JC. Cellular responses to interferon. Annu Rev Immunol 1997;15:749e95. [7] Wong LH, Sim H, Chatterjee-Kishore M, Hatzinisiriou I, Devenish RJ, Stark G, et al. Isolation and characterization of a human STAT1 gene regulatory element. J Biol Chem 2002;277:19408e17. [8] Jia W, Zhou X. Molecular structural and functional characterization of STAT1 gene regulatory region in teleost Channa argus. Vet Immunol Immunopathol 2010;135:146e51. [9] Castro R, Martin SAM, Bird S, Lamas J, Secombes CJ. Characterisation of ginterferon responsive promoters in fish. Mol Immunol 2008;45:3454e62. [10] Decker T, Kovarik P, Meinke A. GAS elements: a few nucleotides with a major impact on cytokine-induced gene expression. J Interferon Cytokine Res 1997;17:121e34. [11] Ghislain JJ, Wong T, Nquyen M, Fish EN. The interferon-inducible Stat2:Stat1 heterodimer preferentially binds in vitro to a consensus element found in the promoters of a subset of interferon-stimulated genes. J Interferon Cytokine Res 2001;21:379e88. [12] Collet B, Boudinot P, Benmansour A, Secombes CJ. An Mx1 promoter-reporter system to study interferon pathways in rainbow trout. Dev Comp Immunol 2004;28:793e801. [13] Collet B, Secombes CJ. The rainbow trout Mx1 promoter: structural and functional characterisation. Eur J Biochem 2001;286:1577e84. [14] Jørgensen JB, Johansen A, Hegseth MN, Zou J, Robertsen B, Collet B, et al. A recombinant CHSE-214 cell line expressing an Mx1 promoter-reporter system responds to both interferon type I and type II from salmonids and represents a versatile tool to study the IFN-system in teleost fish. Fish Shellfish Immunol 2007;23:1294e303. [15] Weston J, Villoing S, Bremont M, Castric J, Pfeffer M, Jewhurst V, et al. Comparison of two aquatic alphaviruses, salmon pancreas disease virus and sleeping disease virus, by using genome sequence analysis, monoclonal reactivity, and cross-infection. J Virol 2002;76:6155e63. [16] Collet B, Collins C. Comparative gene expression profile in two Atlantic salmon cell lines TO and SHK-1. Vet Immunol Immunopathol 2009;130:92e5. [17] Zou J, Carrington A, Collet B, Dijkstra JM, Yoshiura Y, Bols N, et al. Identification and bioactivities of IFN-gamma in rainbow trout Oncorhynchus mykiss: the first Th1-type cytokine characterized functionally in fish. J Immunol 2005;175:2484e94. [18] Skjesol A, Hansen T, Shi C-Y, Thim HL, Jørgensen JB. Structural and functional studies of STAT1 from Atlantic salmon (Salmo salar). BMC Immunol 2010;11. [19] Matikainen S, Paananen A, Miettinen M, Kurimoto M, Timonen T, Julkunen I, et al. IFN-alpha and IL-18 synergistically enhance IFN-gamma production in human NK cells: differential regulation of Stat4 activation and IFN-gamma gene expression by IFN-alpha and IL-12. Eur J Immunol 2001;31:2236e45. €rfer B, Blackwell S, Ballas ZK, et al. [20] Krug A, Rothenfusser S, Hornung V, Jahrsdo Identification of CpG oligonucleotide sequences with high induction of IFNalpha/beta in plasmacytoid dendritic cells. Eur J Immunol 2001;31:2154e63. [21] Mack EA, Kallal LE, Demers DA, Biron CA. Type 1 interferon induction of natural killer cell gamma interferon production for defence during lymphocytic choriomeningitis virus Infection. mBio 2011;2. e00169e11. [22] Nguyen KB, Cousens LP, Doughty LA, Pien GC, Durbin JE, Biron CA. Interferon alpha/beta-mediated inhibition and promotion of interferon gamma: STAT1 resolves a paradox. Nat Immunol 2000;1:70e6. [23] Martin SAM, Taggart JB, Seear P, Bron JE, Talbot R, Teale AJ, et al. Interferon type I and type II responses in an Atlantic salmon (Salmo salar) SHK-1 cell line by the salmon TRAITS/SGP microarray. Physiol Genomics 2007;32:33e44. [24] Sun B, Skjæveland I, Svingerud T, Zou J, Jørgensen J, Robertsen B. Antiviral activity of salmonid interferon gamma against infectious pancreatic necrosis virus and salmonid alphavirus and its dependency on type I interferon. J Virol 2011;85:9188e98. [25] Xu C, Guo T-C, Mutoloki S, Haugland Ø, Marjara IS, Evensen Ø. Alpha interferon and not gamma interferon inhibits salmonid alphavirus subtype 3 replication in vitro. J Virol 2010;84:8903e12.
