59

Neuroscience

J Physiol 594.1 (2016) pp 59–81

Ischaemic concentrations of lactate increase TREK1 channel activity by interacting with a single histidine residue in the carboxy terminal domain Swagata Ghatak, Aditi Banerjee and Sujit Kumar Sikdar Molecular Biophysics Unit, Indian Institute of Science, Bangalore, Karnataka 560012, India

Key points

The Journal of Physiology

r The physiological metabolite, lactate and the two-pore domain leak potassium channel, TREK1 r r r r

are known neuroprotectants against cerebral ischaemia. However, it is not known whether lactate interacts with TREK1 channel to provide neuroprotection. In this study we show that lactate increases TREK1 channel activity and hyperpolarizes CA1 stratum radiatum astrocytes in hippocampal slices. Lactate increases open probability and decreases longer close time of the human (h)TREK1 channel in a concentration dependent manner. Lactate interacts with histidine 328 (H328) in the carboxy terminal domain of hTREK1 channel to decrease its dwell time in the longer closed state. This interaction was dependent on the charge on H328. Lactate-insensitive mutant H328A hTREK1 showed pH sensitivity similar to wild-type hTREK1, indicating that the effect of lactate on hTREK1 is independent of pH change.

Abstract A rise in lactate concentration and the leak potassium channel TREK1 have been independently associated with cerebral ischaemia. Recent literature suggests lactate to be neuroprotective and TREK1 knockout mice show an increased sensitivity to brain and spinal cord ischaemia; however, the connecting link between the two is missing. Therefore we hypothesized that lactate might interact with TREK1 channels. In the present study, we show that lactate at ischaemic concentrations (15–30 mM) at pH 7.4 increases TREK1 current in CA1 stratum radiatum astrocytes and causes membrane hyperpolarization. We confirm the intracellular action of lactate on TREK1 in hippocampal slices using monocarboxylate transporter blockers and at single channel level in cell-free inside-out membrane patches. The intracellular effect of lactate on TREK1 is specific since other monocarboxylates such as pyruvate and acetate at pH 7.4 failed to increase TREK1 current. Deletion and point mutation experiments suggest that lactate decreases the longer close dwell time incrementally with increase in lactate concentration by interacting with the histidine residue at position 328 (H328) in the carboxy terminal domain of the TREK1 channel. The interaction of lactate with H328 is dependent on the charge on the histidine residue since isosteric mutation of H328 to glutamine did not show an increase in TREK1 channel activity with lactate. This is the first demonstration of a direct effect of lactate on ion channel activity. The action of lactate on the TREK1 channel signifies a separate neuroprotective mechanism in ischaemia since it was found to be independent of the effect of acidic pH on channel activity.

S. Ghatak and A. Banerjee contributed equally to this work.  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

DOI: 10.1113/JP270706

60

S. Ghatak and others

J Physiol 594.1

(Received 6 April 2015; accepted after revision 21 September 2015; first published online 7 October 2015) Corresponding author S. K. Sikdar: Molecular Biophysics Unit, Indian Institute of Science, Bangalore, Karnataka 560012, India. Email: [email protected] Abbreviations ACSF, artificial cerebrospinal fluid; ASIC, acid-sensing ion channel; CA1sr, CA1 stratum radiatum; 4CIN, α-cyano-4-hydroxycinnamate; CTD, carboxy terminal domain; DMEM, Dulbecco’s modified Eagle’s medium; EGFP, enhanced green fluorescent protein; HCA1R, hydroxycarboxylic acid 1 receptor; HEK293, human embryonic kidney 293 cells; hTREK1, human TREK1 channel; I–V, current–voltage; KATP , ATP-sensitive potassium channel; Kir , inward rectifying potassium channel; MCT, monocarboxylate transporter; RI, rectification index; RMP, resting membrane potential; TREK1, TWIK related potassium channel; TWIK1, tandem pore domain weak inward rectifying potassium channel.

Introduction Ischaemia is triggered by sudden disruption of blood flow delaying the availability of oxygen, glucose and other nutrients to the tissue (Rossi et al. 2007). During cerebral ischaemia, lactate concentration in the brain rises by 15- to 25-fold from resting levels of 1–3 mM to 12–35 mM in the extracellular space (Hillered et al. 1989; Walz & Harold, 1990; Dimlich & Nielsen, 1992; Allen & Attwell, 2002). However, contrary to earlier reports of lactic acidosis-induced brain damage, high concentrations of lactate have several beneficial effects on neurons. Intravenous and intracerebroventricular lactate injections in mice subjected to transient focal cerebral ischaemia leads to brain lactate levels of 25 mM which decreases infarct size, hemisphere atrophy and neurological deficit scores (Berthet et al. 2012). Lactate (30 mM) suppresses excitatory postsynaptic potentials and reduces excitability of CA1 pyramidal neurons (Walz & Mukerji, 1990). Calcium excitotoxicity was prevented by 32 mM lactate in synaptosomes subjected to ischaemia by reducing intracellular calcium levels and decreasing acetylcholine release in synaptosomes subjected to ischaemia (Boakye et al. 1991). In vivo release of glutamate in rat cerebral cortex was reduced by 20-40 mM lactate thus preventing glutamate excitotoxicity and improving electrocorticogram recovery during ischaemia/reperfusion injury (Phillis et al. 1999; Glenn et al. 2015). A neuroprotective role of lactate has also been observed during other brain disorders such as traumatic brain injury, hypoglycaemia and hyperglycolysis (Maran et al. 1994; Holloway et al. 2007; Oddo et al. 2012; Glenn et al. 2015). Depletion of cellular ATP during cerebral ischaemia is partially delayed by the production of lactate by astrocytes (Rossi et al. 2007). Astrocytes take up glucose from blood vessels, metabolize it to lactate and then release it to the interstitial space via monocarboxylate transporters (MCT1, MCT4) (Pellerin & Magistretti, 1994; Erlichman et al. 2008). Neurons utilize lactate by internalizing it via MCT2 and lactate production by astrocytes is closely linked to neuronal activity (Pellerin & Magistretti, 1994; Erlichman et al. 2008). Astrocytes in the CA1 stratum radiatum region of hippocampus express the two-pore domain leak potassium channel TREK1, which contributes to their negative resting membrane potential

and passive conductance (Zhou et al. 2009; Hwang et al. 2014). Both focal and global cerebral ischaemia increases the expression of TREK1 channels in CA1 stratum radiatum (CA1sr) astrocytes (Pivonkova et al. 2010; Wang et al. 2012). Trek1−/− mice exhibit increased neuronal mortality after global ischaemia (Heurteaux et al. 2004); however, hypoxia alone does not affect the basal activity of TREK1 (Buckler & Honor´e, 2005). Arachidonic acid and polyunsaturated fatty acids (PUFAs) strongly activate TREK1 current and have been shown to impart tolerance against ischaemic and epileptic damage (Heurteaux et al. 2004; Buckler & Honor´e, 2005). Further, in TREK1−/− mice, PUFAs fail to induce cerebral vasodilatation, thus causing increased vulnerability to ischaemia (Blondeau et al. 2007). Neuroprotective agents such as volatile anaesthetics and riluzole are also known to activate TREK1 (Buckler & Honor´e, 2005). Thus, TREK1 activity is closely linked to the extent of ischaemic damage. As indicated above, there is extensive scientific literature to support the independent neuroprotective roles of both lactate and TREK1, but the connecting link between the two has not been alluded to in the literature. We hypothesized that one of the mechanisms by which lactate expresses its neuroprotective effect is by activating TREK1 channels. Using patch clamp electrophysiology on acute brain slices and heterologously expressed human (h)TREK1 in cells of the human embryonic kidney 293 cell line (HEK293) we observed that lactate increases TREK1 current. The cytoplasmic carboxy terminal domain (CTD) of TREK1 plays a key role in the function and regulation of TREK1 via regulatory mechanisms such as phosphorylation, protonation and interaction with neuroprotective agents (Noel et al. 2011). Using site directed mutagenesis we elucidated a novel site of interaction of lactate with a histidine residue at the 328th position in CTD of hTREK1 which could functionally alter its biophysical properties, leading to an increase in the channel opening probability. Methods Acute slicing

All experiments were performed in accordance with the rules and regulations of the Ethical Committee of  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

J Physiol 594.1

Interaction of lactate and TREK1

the Indian Institute of Science, Bangalore, India. Male Wistar rats aged 14–42 days postpartum were randomly selected for experiments. They were anaesthetized using halothane and decapitated. Their brains were quickly and carefully dissected at 4°C in sucrose based artificial cerebrospinal fluid (ACSF) whose composition was (mM): sucrose 216, KCl 2.5, MgCl2 .6H2 O 7, CaCl2 .2H2 O 0.5, NaH2 PO4 1.25, NaHCO3 26, glucose 25, ascorbate 1, sodium pyruvate 2 (pH 7.4, 310–320 mosmol l−1 ) bubbled with 95% O2 and 5% CO2 . Transverse hippocampal slices of 300 μm were obtained at 4°C in oxygenated sucrose ACSF using a Leica VT 1000S vibratome. After slicing, the sections were transferred carefully to a 50 ml incubation chamber and incubated for 10 min at 35°C in oxygenated ACSF whose composition was (mM): NaCl 125, KCl 3, MgCl2 .6H2 O 1, CaCl2 .2H2 O 2, NaH2 PO4 1.25, NaHCO3 26, glucose 25 (pH 7.4, 300–310 mosmol l−1 ). Next, the incubation chamber containing the hippocampal slices was maintained at room temperature (20°C) with 95% O2 and 5% CO2 and allowed to stabilize for 1 h.

Slice electrophysiology

A single slice was carefully transferred to an open bath chamber (RC-21BRW; Warner Instruments, Hamden, CT, USA) fitted onto a stage adapter (SA-OLY/2, Series 20 Magnetic Platform, Warner Instruments). The slice was bathed in oxygenated artificial cerebrospinal fluid (ACSF) circulating through the chamber at 2–3 ml min−1 via a Masterflex C/L peristaltic pump (Harvard Apparatus, Holliston, MA, USA). The temperature of the ACSF within the open chamber was maintained at 23–25°C by a single channel heater (TC-324B, Warner Instruments) connected to the stage adapter and all electrophysiological recordings were done in the above conditions. TREK1 currents were recorded at 23–25°C from CA1 stratum radiatum (CA1sr) astrocytes. Since inside-out recordings from HEK293 cells overexpressing human TREK1 channels were done at 23°C (see ‘Single channel electrophysiology’ below), we wanted to maintain the same recording temperatures for the slice experiments as well. CA1sr astrocytes were visualized using an upright microscope (Olympus BX-61WI) with differential interference contrast optics (×40, NA 0.8) using an infrared camera (IR-1000, Dage-MTI, Michigan City, IN, USA) and a LCD monitor (VU Series, Dage-MTI). Patch electrodes (3–4 M) were pulled from thick-walled borosilicate glass capillaries (Harvard Apparatus) with outer diameter of 1.5 mm and inner diameter of 0.86 mm and were filled with internal solution whose composition was (mM): KCl 140, CaCl2 .2H2 O 0.5, MgCl2 .6H2 O 1, EGTA 5, Hepes 10, MgATP 3, NaGTP 0.3 (pH 7.4 adjusted with KOH, 300–310 mosmol l−1 ). The cells were approached

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

61

using a micromanipulator (Patchstar, Scientifica, Uckfield, East Sussex, UK) mounted onto an upright slice platform (Scientifica). Somatic whole-cell recordings were performed on CA1sr astrocytes in voltage clamp and current clamp mode. The signals were amplified using Multiclamp700B (Axon Instruments, Molecular Devices Corporation, Sunnyvale, CA, USA) and digitized using Digidata 1440A (Molecular Devices). Dentate gyrus–CA3 connections to CA1 were cut at room temperature just before recording in oxygenated ACSF to prevent the slices from becoming epileptic. CA1sr astrocytes were held at –70 mV with 100 pA holding current for voltage clamp recordings. Only cells which showed no action potential firing with current injection of 4 nA were included for recordings. Data were acquired using pCLAMP 10 at a sampling frequency of 20 kHz and low-pass filtered at 3 kHz. Series resistance (10–13 M) was compensated. Experimental junction potentials 6 mV corroborated with theoretical junction potentials and were corrected for all recordings. Solutions and drugs

CA1sr astrocytes express various potassium channels (voltage-gated, inwardly rectifying, calcium-activated, two-pore domain). In order to isolate the effect of lactate on TREK1 currents, other potassium channels were blocked. Control solutions contained 10 mM tetraethylammonium chloride (A-type potassium channel (KA ), delayed potassium channel (KD ) and big conductance calcium activated potassium channel (BK) blocker), 100 μM 4-aminopyridine (KA and KD blocker), 1 mM barium chloride (inward rectifying potassium channel (Kir ) blocker), 500 μM tolbutamide (ATP-sensitive potassium channel (KATP ) blocker), 50 nM apamin (small conductance calcium activated potassium channel (SK) blocker), 50 μM mefloquine (gap junction blocker), and 100 μM 5-nitro-2-3-phenylpropylaminobenzoic acid (chloride channel blocker) dissolved in oxygenated ACSF at pH 7.4 (Kucheryavykh et al. 2009). Lactate solutions of 15 and 30 mM were made by replacing NaCl with sodium lactate in control solutions at pH 7.4. Sodium pyruvate solution was made by replacing NaCl with 30 mM sodium pyruvate at pH 7.4. Quinine (200 μM) and fluoxetine (100 μM) were used to inhibit TREK1 channels (Zhou et al. 2009; Cadaveira-Mosquera et al. 2011). Arachidonic acid (10 μM) was used to activate TREK1 channels (Mazella et al. 2010). A non-specific blocker of monocarboxylate transporter, α-cyano-4-hydroxycinnamate (2 mM), was used to inhibit lactate uptake (Phillis & O’Regan, 2002). All chemicals were obtained from Sigma-Aldrich and all solutions were maintained at pH 7.4.

62

S. Ghatak and others

J Physiol 594.1

Table 1. Forward and reverse primer sequences used for constructing the hTREK1 mutants used in the study Name of mutation H328A H328Q R326A

Primer

Primer sequence

Forward Reverse Forward Reverse Forward Reverse

AGAGTTCAGAGCAGCCGCTGCTGAGTGG ATGTTCTCAATCACAGCAATCTCTTCACCAGC AGAGTTCAGAGCACAAGCTGCTGAGTGG ATGTTCTCAATCACAGCAATCTCTTCACCAGC GTGGGAGAGTTCGCAGCACACGCTGCTG ATGTTCTCAATCACAGCAATCTCTTCACCAGC

The amino acid codons which have been mutated are underlined.

Cell culture

Human embryonic kidney (HEK293) cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM high glucose) (Sigma, St. Louis, MO, USA) supplemented with 10% fetal bovine serum (v/v) (GIBCO, Waltham, MA, USA), 1% antibiotic–antimycotic (Sigma) in a humidified incubator with an atmosphere of 5% CO2 . Molecular biology

cDNA encoding the hTREK1 channel (GenBank accession no: AF004711) cloned into the mammalian expression vector pRAT was transiently transfected with the enhanced green fluorescent protein (EGFP) cDNA using the Lipofectamine 2000 reagent. Briefly, 1 ng each of cDNA and 2 μl of Lipofectamine 2000 reagent (Life Technologies, Carlsbad, CA, USA) was mixed and added to HEK293 cells grown in 35 mm culture dishes. The media of the HEK293 cells was replaced with OptiMem media (Life Technologies) and after 4 h the media was changed to DMEM high glucose media for HEK293 cells. The transfected HEK293 cells were used for electrophysiology. EGFP was co-transfected to visualize the cells expressing hTREK1. The C-terminal deletion mutants of hTREK1 (89, 100, 119 hTREK1) were constructed by PCR mutagenesis as described previously (Harinath & Sikdar, 2004). R326A, H328A and H328Q mutants of hTREK1 were constructed by the megaprimer method of site directed mutagenesis and mutations were verified by DNA sequencing. The primers for the site directed mutagenesis are listed (Table 1). The mutants were also expressed transiently along with EGFP in HEK293 cells using Lipofectamine 2000 reagent as described for patch clamp experiments. Single channel electrophysiology

Electrophysiological recordings were performed using an EPC8 patch-clamp amplifier (HEKA Elektronik Instruments, Holliston, MA, USA). All the experiments were performed at room temperature (23°C). Single channel current recording was acquired in the excised inside-out configuration of patch clamp using fire polished micropipettes of 5–10 M resistance. The recordings were

filtered at 3 kHz using a 7-pole Bessel filter (3 dB), digitized using a LIH 1600 A/D converter interface (HEKA Elektronik) at a sampling rate of 10 kHz and analysed offline by the Pulse (HEKA Elektronik) and TAC software (Bruxton Corp., Seattle, WA, USA). Whole cell patch experiments were done in HEK293 cells overexpressing hTREK1 channels. The composition of pipette solution used was (mM): KCl 150, EGTA 5, MgCl2 .6H2 O 3, CaCl2 .2H2 O 0.3, Hepes 10 (pH adjusted to 7.4 with KOH, 280–300 mosmol l−1 ). The composition of bath solution used was (mM): NaCl 145, KCl 2.5, MgCl2 3, CaCl2 1, Hepes 10, glucose 5 (pH adjusted to 7.4 with NaOH, 280—300 mosmol l−1 ). Sodium lactate solution was made by replacing NaCl with 30 mM sodium lactate. Whole cell hTREK1 current was elicited by a voltage ramp (300 ms) from –80 mV to +80 mV. Recordings were done at 23°C and by holding the cells at –80 mV. In experiments using the excised patches, the composition of pipette solution used was (mM): KCl 150, EGTA 5, MgCl2 .6H2 O 3, CaCl2 .2H2 O 0.3, Hepes 10 (pH adjusted to 7.4 with KOH, 280–300 mosmol l−1 ). The composition of bath solution used was (mM): KCl 150, EGTA 5, MgCl2 .6H2 O 3, CaCl2 .2H2 O 0.3, Hepes 10 (pH adjusted to 7.4 with KOH, 280–300 mosmol l−1 ). In experiments where different concentrations of lactate (10–50 mM) were applied, KCl was replaced by equimolar concentrations of potassium lactate in the bath solution. Acetate solution was made by replacing KCl with 30 mM potassium acetate. In 0 Mg2+ and 0 Ca2+ experiments, the composition of the bath solution used was (mM): KCl 150, EGTA 5, Hepes 10 (pH adjusted to 7.4 with KOH, 280–330 mosmol l−1 ). In pH 5.5 experiments, the composition of the bath solution used was (mM): KCl 150, EGTA 5, Mes 10 (pH adjusted to 5.5 with KOH, 280–330 mosmol l−1 ). In pH 6.5 experiments, the composition of the bath solution used was the same as used in pH 5.5 experiments with pH adjusted to 6.5 using KOH. The pipette solution used was the same as mentioned previously. The various concentrations of lactate were applied in the bath at a rate of 1 ml min−1 . The bath perfusion was done by a peristaltic pump (Gilson, Middleton, WI, USA). Single channel current recording was acquired in gap-free mode at –60 mV. Inside-out hTREK1 current was elicited by a voltage ramp (2 s) from –100 to +100 mV (interpulse interval, 5 s) in order  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

Interaction of lactate and TREK1

J Physiol 594.1

to characterize hTREK1 current. Negative pressure was applied through the patch pipette to confirm the mechanosensitivity of the hTREK1 channel. Data analysis

Recordings from CA1sr astrocytes were analysed using Clampfit 10.0 (Molecular Devices, USA). Current traces obtained after bath application of lactate were subtracted from current traces in control solutions and were plotted against voltage to reveal the characteristic outward rectifying lactate induced current–voltage (I–V) profile of whole cell TREK1 currents (Lee et al. 2010). Percentage change in TREK1 current under voltage clamp at two potentials (current at 20 mV = I1 and current at –160 mV = I2 ), i.e. ±90 mV from the reversal potential (Vrev = –70 mV) was calculated: [(I1 or I2 with 30 mM lactate) – (I1 or I2 in control)/(I1 or I2 in control)] × 100. The rectification index (RI) of TREK current in control and 30 mM lactate conditions was estimated using the formula: RI = (I1 /90)/(I2 /–90). Statistical analysis was done using GraphPad Prism. P values 0.05 were considered insignificant. Single channel events were detected by setting a threshold at half the maximum open channel current amplitude of the major conductance state. Single channel current amplitude was determined by constructing amplitude histograms and fitting with Gaussian distributions. hTREK1 channel activity in a patch was expressed quantitatively as NPo , i.e. the product of the number of channels (N) in a patch and the probability that the channel is in the open state, Po . The NPo was calculated by the relative area under the all-points amplitude histogram and expressed as follows: NP o =

N  i=1

iA i /

N 

Ai

i=0

where A is the area under the Gaussian curve and i is the number of active channels in a given recording fragment. For the NPo analysis it was assumed that the channels in a patch are identical and independent. Normalized NPo was calculated as follows: NP o(lactate) Normalized NP o = NP o(control) To get a better insight into the changes in biophysical properties of TREK1 channels, detailed analysis of channel kinetics was done. Dwell time histograms were constructed by binning the dwell times of the channel at a particular conductance level and plotting the frequency versus duration on a linear scale. However, it became difficult to separate the multi-exponential components from the linear plots. The histograms are therefore represented with a logarithmic time base and in addition to this the frequency axis is presented as the square root of the counts per bin to enhance the resolution of the kinetically  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

63

distinct components. The dwell time distribution histograms were fitted to mixed exponential probability density functions (p.d.f.s), each characterized by a time constant τ, and a relative amplitude, a, as given below;    n n  −t ai p.d.f. (t) = exp ai = 1 , τ τi i=1 i i=1 The time constants of the exponential distributions obtained from the p.d.f.s, represented the mean dwell times of the channel at a particular conductance level, whereas the number of exponential components provided the lowest estimate of the number of kinetically distinct sub-states in a particular dwell state, with the weight of the exponentials representing the relative life time or ‘occupancy’ in that particular sub-state. The TAC software was used for this purpose. The percentage change in the mean dwell time in each state was given by τlactate − τcontrol × 100 % change in τ = τcontrol Statistical analysis for the single channel data was done using GraphPad Prism. P values  0.05 were considered insignificant. Results Lactate increases TREK1 channel activity in a concentration dependent manner

Passive conductance in the CA1sr astrocytes is primarily due to the activity of two-pore domain leak potassium channels, TREK1 and TWIK1 channels (Zhou et al. 2009; Hwang et al. 2014). Since these cells do not express TREK2 channels (Minieri et al. 2013), we isolated TREK1 currents in CA1sr astrocytes by using pharmacological agents to block other native potassium channels, chloride channels and gap junctions (Kucheryavykh et al. 2009; Zhou et al. 2009). We observed increased TREK1 currents with ischaemic concentrations of lactate (15–30 mM) at pH 7.4 in CA1sr astrocytes whereas physiological concentrations (1–3 mM) were without effect (Figs 1A, B, C and E, and 2A and B). TREK1 current showed a 12.3 ± 2.7% and 24.7 ± 4.7% increase with 15 mM and 30 mM lactate, respectively, when compared to their respective controls (Fig. 1B, C and E). The lactate-induced increase in TREK1 current could be blocked by application of lactate with 200 μM quinine, a blocker of TREK1 channels (Figs 1E and 2C). When slices were reperfused with 30 mM lactate alone, after application of lactate + quinine, a significant increase in TREK1 current was observed, indicating reversible inhibition by quinine (Fig. 2C). Similarly, when 30 mM lactate was applied with 100 μM fluoxetine, another TREK1 channel blocker, lactate was unable to increase whole cell TREK1 currents in CA1sr astrocytes (Fig. 2D). The fluoxetine-sensitive astrocyte current was enhanced

64

S. Ghatak and others

J Physiol 594.1

*

*

*

*

Figure 1. Lactate increases whole cell TREK1 current in CA1sr astrocytes of hippocampal slices A, schematic diagram shows the magnified representation of CA1sr astrocyte (black dot) in a hippocampal slice. The pipette solution inside the grey patch pipette is maintained at pH 7.4. All bath solutions used for whole cell experiments were maintained at pH 7.4. CA1sr astrocytes in hippocampal slices were whole cell patch clamped using the voltage clamp protocol indicated above. Representative TREK1 currents, TREK1 current trace at +40 mV and current density vs. voltage plot are shown in A, B, C and D for 2 mM lactate, 15 mM lactate, 30 mM lactate and 30 mM pyruvate, respectively. Note the outward rectification of the whole cell lactate induced TREK1 currents in the subtracted traces in B and C. Note the profiles of subtracted traces in A and D which indicate no change of whole cell TREK1 current with basal concentrations of lactate and 30 mM pyruvate. The last three points of each of the current density vs. voltage plots in A, B, C and D have been magnified as insets for better visualization of representative symbols. E, summary plot of percentage change in TREK1 current density of astrocytes. Measurements were significantly different from their respective control values (∗ P < 0.05; Wilcoxon matched pairs signed rank test). The corresponding sample sizes for each experiment are indicated above their respective bars. Data are represented as means ± SEM.  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

J Physiol 594.1

Interaction of lactate and TREK1

Figure 2. Basal concentrations of lactate do not increase TREK1 channel activity in CA1sr astrocytes in hippocampal slices

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

65

66

S. Ghatak and others

by 10 μM arachidonic acid, a known TREK1 channel activator (Fig. 2D). Astrocytes internalize lactate via monocarboxylate transporters (MCTs), namely MCT1 (low capacity, Km for lactate 5–7 mM) and MCT4 (high capacity, Km for lactate 28–35 mM) (Erlichman et al. 2008). Application of 30 mM lactate along with non-specific MCT blocker 2 mM α-cyano-4-hydroxycinnamate (4CIN) did not increase TREK1 current beyond control levels (Figs 1E and 3A). The concentration of 4CIN used was such that it could block both MCT1 (IC50 = 425 μM) and MCT4 (IC50 = 900 μM) (Erlichman et al. 2008). Reperfusion of the slices with 30 mM lactate after application of lactate with 4CIN significantly increased TREK1 current, indicating the reversibility of the 4CIN effect (Fig. 3A). However, MCTs also transport other monocarboxylates such as pyruvate and acetate. In order to confirm whether the lactate induced rise in TREK1 current could be elicited by other monocarboxylates as well, we applied 30 mM sodium pyruvate at pH 7.4. Pyruvate failed to activate TREK1 current, clearly indicating that lactate specifically increases the activity of TREK1 channels in CA1sr astrocytes (Fig. 1D and E). We subtracted the lactate induced whole cell TREK1 current traces from their respective control current traces to reveal its outward rectifying profile (Fig. 1B and C). 30 mM lactate increased TREK1 current by 17.4 ± 3.7% at 20 mV compared to 2.3 ± 2% at –160 mV, indicating a preferential increase in conductance at depolarized potentials (Fig. 3C). Rectification index (RI) was also significantly higher in 30 mM lactate (1.2 ± 0.1) compared to control (1.05 ± 0.08) further establishing that lactate selectively activates an outward rectifying current, TREK1 (Fig. 3C). The consequence of the increase in TREK1 channel activity by 30 mM lactate in CA1sr astrocytes was a significant hyperpolarizing shift by 5 ± 0.6 mV of the resting membrane potential (Fig. 3B). We next investigated the increase in TREK1 channel activity by lactate at the molecular level using heterologously expressed hTREK1 channels in HEK293 cells. Rat TREK1 (accession no. Q920B6) and human TREK1 (accession no. NP 001017425) channels show 98% sequence homology. HEK293 cells express low levels of only one monocarboxylate transporter, MCT1, which has a much lower capacity of lactate transport than MCT4

J Physiol 594.1

(Castro et al. 2008; Erlichman et al. 2008). Whole cell hTREK1 current did not increase remarkably in the presence of 30 mM lactate, probably due to the low capacity of lactate transport by MCTs expressed in its membrane, leading to inefficient modulation of hTREK1 channels (Fig. 3D). The characteristics of MCT1 expressed in HEK293 may differ from that of astrocytes. It has been shown that the Km of MCT1 in Xenopus oocytes is 3.5 mM while in astrocytes it is 5–7 mM (Halestrap & Price, 1999). Therefore, the transport efficiency of MCTs to lactate might vary between cells lines and astrocytes. The identity of hTREK1 in single channel recordings in inside-out patch was confirmed with the characteristic properties of TREK1 (Nayak et al. 2009), viz. expected reversal potential of expressed channel, the directionality of the current with changes in the membrane potential, outward rectification property, mechanosensitivity, activation by 10 μM arachidonic acid and two open states (O∗ = blocked, O = unblocked, Figs 4 and 7A). hTREK1 activity increased in a concentration dependent manner upon application of 10–50 mM lactate, pH 7.4 (Fig. 5A–C). The channel open probability (NPo ) increased from 1.7 (± 0.11)-fold with 10 mM lactate to 5.11 (± 0.64)-fold with 50 mM lactate. The effect of lactate reached saturation at 50 mM concentration (Fig. 5D). Basal levels of brain lactate (3 mM) did not affect hTREK1 activity (Fig. 6C–E). The increase in activity of hTREK1 caused by lactate was not due to chelation of divalent cations such as Mg2+ and Ca2+ as shown previously in acid sensing ion channels (ASICs) (Immke & McCleskey, 2001) (Fig. 6A, D and E). The specificity of lactate action on hTREK1 channels was confirmed by using 30 mM potassium acetate at pH 7.4, which did not affect hTREK1 activity in inside-out patches (Fig. 6B, D and E). This, along with the results of pyruvate on CA1sr astrocytes, suggests that among the intracellular monocarboxylates, lactate alone modulates TREK1 channel activity.

Lactate decreases hTREK1 channel dwell time in the longer closed state

Since lactate increased hTREK1 current, we next probed the changes in single channel biophysics using kinetic

A, representative whole cell CA1sr TREK1 currents and current density vs. voltage plot with 1 mM lactate solution, pH 7.4. B, representative whole cell CA1sr TREK1 currents and current density vs. voltage plot with 3 mM lactate solution, pH 7.4. The last three points of each of the current density vs. voltage plots in A and B have been magnified as insets for better visualization of representative symbols. C1, representative whole cell CA1sr TREK1 currents and C2, current density vs. voltage plot with TREK1 channel blocker quinine (200 μM) at pH 7.4. D, representative whole cell CA1sr TREK1 currents with TREK channel blocker fluoxetine (100 μM) and TREK1 channel activator arachidonic acid (10 μM) in the same cell after washout. The symbols (circles, triangles, crosses and squares) beside the traces indicate their respective current density vs. voltage profiles. The voltage clamp protocol used is same as shown in Fig. 1A.  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

Interaction of lactate and TREK1

J Physiol 594.1

67

****

*** ***

4 3 2 1 0 –100 –50

0

50

100

Figure 3. Effect of monocarboxylate transporter blocker (4CIN) on TREK1 currents, lactate induced hyperpolarization and outward rectification of CA1sr astrocytes A, representative whole cell CA1sr TREK1 currents and current density vs. voltage plot with non-specific MCT blocker α-cyano-4-hydroxycinnamate (4CIN) at pH 7.4. The symbols (open circles, crosses and filled triangles) beside the traces indicate their respective current density vs. voltage profiles. The last three points of the current density vs. voltage plot have been magnified as insets for better visualization of representative symbols. The voltage clamp protocol used is same as shown in Fig. 1A. B, current clamp recordings of RMP from a CA1sr astrocyte in control, during application of 30 mM lactate and following washout. Note the membrane hyperpolarization and the reversibility of the RMP to control level after washout. RMP plot at control and 30 mM lactate conditions

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

68

S. Ghatak and others

analysis. The dwell time analysis of single hTREK1 channel activity showed a decrease in the longer close time by 48.33 ± 2.65% upon application of 30 mM lactate (Control = 45.72 ± 7.62 ms, Lactate = 23.2 ± 3.55 ms), while the shorter close time (Control = 0.72 ± 0.05 ms, Lactate = 0.73 ± 0.41 ms) and the open time (Control = 2.15 ± 0.13 ms, Lactate = 2.32 ± 0.18 ms)

J Physiol 594.1

remained unaffected (Fig. 7A–D). The increased channel activity in the presence of intracellular lactate can thus be explained by a decrease in the time that the channel spends in the longer closed state. Decrease in the longer close time was dependent on the concentration of lactate while the shorter close time and open time remained constant. Lactate at 10 mM and 50 mM decreased the longer close

(n = 14; ∗∗∗∗ P < 0.0001; paired t test). C, rectification index histogram showed significant outward rectification with 30 mM lactate (n = 11; ∗∗∗ P < 0.001; Wilcoxon matched pairs signed ranks test). Plot of percentage change in whole cell CA1sr TREK1 current with 30 mM lactate at –160 mV and +20 mV (n = 11; ∗∗∗ P < 0.001; Wilcoxon matched pairs signed rank test). Data are represented as means ± SEM in B and C. D, whole cell TREK1 current recorded from HEK293 cells overexpressing human TREK1 (hTREK1) channels using a ramp protocol from –80 mV to +80 mV in control, 30 mM lactate and washout conditions. HEK293 cells do not express MCT4, unlike astrocytes, which accounts for the feeble increase in lactate induced whole cell hTREK1 current.

5 pA

A C

5 pA

50 mV

500 ms

B 80 mV

D 60 mV 40 mV

Control

20 mV 0 mV –20 mV

10 μM arachidonic acid

–60 mV

–80 mV

5 pA

–40 mV

Washout 100 ms

5 pA

–100 mV

250 ms

Figure 4. Characterization of hTREK1 current expressed in HEK293 cells in inside-out recordings A, hTREK1 channel current trace following a voltage ramp from –100 mV to +100 mV for 2 s. B, representative current traces at voltage steps of +20 mV starting from –100 mV. C, representative hTREK1 current trace with the line above the trace showing the application of negative pressure for 500 ms and then maintaining the pressure by clamping the suction tubing. D, representative hTREK1 current trace during control, in the presence 10 μM arachidonic acid and washout conditions.  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

Interaction of lactate and TREK1

J Physiol 594.1

69

A

B 12000

Events

Control, pH 7.4

Control (C)

C

8000 4000 0

–8 –6 –4 –2

0

2

Amplitude (pA) 12000

Events

10 mM lactate, pH 7.4

10 mM lactate (10 L)

10 L

8000 4000 0

–8 –6 –4 –2

0

2

Amplitude (pA) 12000

Events

50 mM lactate, pH 7.4

50 L

8000 4000 0

50 mM lactate (50 L)

–8 –6 –4 –2

0

2

Amplitude (pA) 12000

5pA

5pA

Events

Washout, pH 7.4

Washout (W) 500 ms

W

8000 4000 0

–8 –6 –4 –2

50 ms

0

Amplitude (pA)

C

D C

0.5

10L

50L

Normalized NP O

5

0.4 NP O

(10)

6

W

0.3 0.2 0.1

(9)

(12)

4 3 2

(7) (8)

1 0

0.0 0

200

400

600

Time (s)

10

20

30

40

50

Concentration of lactate (mM)

Figure 5. Intracellular lactate increases activity of hTREK1 channel expressed in HEK293 cell in a concentration dependent manner at a constant pH of 7.4 Representative inside-out recording of hTREK1 activity (A) and its corresponding amplitude histogram (B) in control, 10 mM lactate, 50 mM lactate and washout conditions. The arrows on the traces in the leftmost panel indicate the part of the trace that has been magnified to its right. C, open probability histogram (NPo vs. time) of the representative hTREK1 activity shown in A. Data shown in A, B and C are from the same inside-out recording. D, plot of normalized NPo (NPo lactate/NPo control) at different concentrations of lactate. The numbers above the data points indicate the sample size for each experiment. The increase in NPo with each of the lactate concentrations was significantly higher with respect to its control (P < 0.05; paired t test). Data are represented as means ± SEM.

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

2

70

S. Ghatak and others

J Physiol 594.1

Figure 6. hTREK1 channel activity remains unaffected in absence of divalent cations, presence of acetate and basal concentration of lactate Representative hTREK1 single channel traces from inside-out patches and open probability (NPo vs. time) histograms are shown for 0 mM Mg2+ and Ca2+ (A), 30 mM acetate (B) and 3 mM lactate (C), respectively. D, summary plot of normalized NPo of 0 mM Mg2+ and Ca2+ , 30 mM acetate and 3 mM lactate. Statistical comparisons between NPo of 0 mM Mg2+ and Ca2+ , 30 mM acetate (A), 3 mM lactate (3L) and their respective controls using paired t test showed no significant difference. The sample size for each experiment is indicated above their corresponding bars. Data are represented as means ± SEM. The dashed line indicates control. E, schematic diagram showing that absence of divalent ions, another monocarboxylate and basal concentration of lactate do not affect hTREK1 activity in inside-out patch configuration.  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

Interaction of lactate and TREK1

J Physiol 594.1

time by 23.63 ± 2.87% and 75.93 ± 2.01%, respectively (Fig. 7E). The similar trend in decrease of longer close time and increase of NPo with increased concentrations of lactate (Figs 5D and 7E) suggests that increased hTREK1 activity may be due to a change in the probability of ion channel opening, Po .

71

A histidine residue in the cytoplasmic domain controls functional interaction of lactate with hTREK1

The polymodal regulation of TREK1 activity by pH, cyclic nucleotides, protein kinases and neuroprotective agents is mediated through phosphorylation and protonation of

A

B 1000 800 600

C O*

Events

Control, pH 7.4

O

C O* O

Events

30 mM lactate, pH 7.4

5 pA 50 ms

2 1 0 –4

open (counts/bin)1/2

(counts/bin)1/2

5 4 3

–3 –2 –1 Log duration (s)

(counts/bin)1/2 –3 –2 –1 Log duration (s)

1 –4

–3 –2 –1 Log duration (s)

0

0

4

close

0.3

1 0

2

3

τC1

0.6

0.9

40

60

control –4

–3 –2 –1 Log duration (s)

0

0

τC0 40 20 0 30

40

50

Concentration of lactate (mM)

20 τC2

τC1

20

τ0

* * * *

30 mM lactate

2

60

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

0

3

τC2

10

1

control

80

–20

0 30 mM lactate

D % change in time constant

2 1 0 –4

open

ns

control

2

30 mM lactate 5 4 3

700 600 500 400 300 200 100 0 –8 –6 –4 –2 0 2 Amplitude (pA)

30 mM lactate

3

0

0

close

4

2

D

No. of events =2000

control

(counts/bin)1/2

Figure 7. Lactate preferentially modulates kinetics of the long closed state (τc2 ) of hTREK1 channel A, representative trace of hTREK1 single channel current in control and in the presence of 30 mM lactate. Shown are the two open conductances, O∗ (blocked, 2.7 pA) and O (unblocked, 6.4 pA), and closed conductance C, at hyperpolarized potential (–60 mV) in the inside-out recording. B, amplitude histogram of hTREK1 current in control (top) and in the presence of 30 mM lactate (bottom). C, dwell time distribution histograms for open times (τ o ) and close times (τ c1 , τ c2 ) of hTREK1 in control and in the presence of 30 mM lactate. The vertical dashed grey line shows leftward shift in the mean dwell time of the longer closed state (τ c2 ). The continuous grey curves represent the probability density functions fitted to the histograms. D, comparison of mean dwell times of hTREK1 in control and in the presence of 30 mM lactate. Dwell time in the longer closed state (τ c2 ) was reduced after lactate application (n = 9; ∗∗∗∗ P < 0.0001; paired t test). E, plot of percentage change in the open (τ o ) and close time constants (τ c1 , τ c2 ) in the presence of various concentrations of lactate with respect to control. The longer close time (τ c2 ) for each concentration of lactate was significantly lower than their respective controls (n = 5; P < 0.05; paired t test). Data are represented as means ± SEM in D and E.

400 200 0 –8 –6 –4 –2 0 Amplitude (pA)

72

S. Ghatak and others

the cytoplasmic domain (Noel et al. 2011). We searched for the site of action of lactate on TREK1 by targeting specific regions of the CTD by using three C-terminal deletion mutants, 119, 100 and 89 of hTREK1. The 119 and 100 mutant did not show a change in hTREK1 activity in the presence of lactate (Fig. 8A, B, E and F). However, the 89 mutant showed a 2.79 (± 0.3)-fold increase in hTREK1 activity with lactate, similar to wild-type (Fig. 8C, E and F). These results suggested that the sequence between 327th and 337th residues was crucial for functional interaction of lactate with hTREK1. Based on previous literature (Giardina et al. 1996; Pineda et al. 2007; Furuichi et al. 2008) we hypothesized that the histidine at the 328th position (H328) might be important for the interaction; therefore, we mutated H328 to alanine (H328A) by site directed mutagenesis. The H328A mutant was insensitive to intracellular lactate suggesting that the H328 residue was crucial for functional interaction with lactate (Fig. 8D–F). In order to examine if the nature of interaction was structural or charge-based, we mutated H328 to glutamine, which is isosteric with histidine, but possesses an uncharged side chain. The H328Q mutant was unaffected by lactate suggesting that the charge on the histidine side chain is important for the interaction with lactate (Fig. 9A, C and D). Arginine has also been shown to be important for interaction with lactate in proteins such as lactate dehydrogenase and G protein-coupled lactate receptor GPR81 (Pineda et al. 2007; Furuichi et al. 2008; Liu et al. 2009). In the case of enzymes such as lactate dehydrogenase, arginine is in structural proximity to histidine, while in hTREK1 the structure of CTD is unknown. Therefore, we considered the arginine residue (R326) sequentially proximal to histidine (H328) to be important for interaction with lactate although it was outside the amino acid stretch of interest. However, lactate increased hTREK1 activity in the R326A mutant, like the wild-type hTREK1, indicating that H328 was the sole functionally important residue for interaction with lactate (Fig. 9B–D). Kinetic analysis of the CTD89 mutant also followed the trend shown by wild-type hTREK1 (Fig. 10A). The longer close time (Control = 45.30 ± 6.23 ms, Lactate = 22.84 ± 3.71 ms) decreased by 50% but the shorter close time (Control = 0.80 ± 0.05 ms, Lactate = 0.79 ± 0.29 ms) and the open time (Control = 2.09 ± 0.22 ms, Lactate = 2.10 ± 0.11 ms) remained unchanged (Fig. 10B). The kinetic analysis of single H328A-hTREK1 mutant showed no change in the longer close time (Control = 52.28 ± 6.10 ms, Lactate = 50.81 ± 6.75 ms), unlike the wild-type and CTD89 mutant (Fig. 10C). The shorter close time (Control = 1.76 ± 0.15 ms, Lactate = 1.79 ± 0.20 ms) and open time (Control = 1.36 ± 0.12 ms, Lactate = 1.27 ± 0.08 ms) were unaffected, similar to

J Physiol 594.1

wild-type and CTD89 (Fig. 10D). Since the H328A mutant was not affected by lactate, we conclude that lactate decreases the longer close time of hTREK1 channel by interacting with the H328 residue of CTD. Lactate induced increase in TREK1 current is independent of change in pH

CTD100 and H328A mutants which are insensitive to lactate show a 5.67- and 6.04-fold increase in NPo , respectively, similar to wild-type hTREK1 (6.57-fold) on exposure to pH 5.5 solution on the cytosolic side (Fig. 11A–D). Both the mutants have an E321 residue which is responsible for a robust increase in TREK1 activity (Honor´e et al. 2002) on application of pH 5.5 solution (Fig. 11E). These results suggest that lactate mediated increase in hTREK1 activity is independent of changes in intracellular pH. However, during cerebral ischaemia the lowest pH observed in the brain interstitium is 6.5 along with high lactate concentrations (Siemkowicz & Hansen, 1981; Mutch & Hansen, 1984). Therefore we further investigated the effect of lactate on hTREK1 in the presence of pH 6.5. The normalized open probability of the hTREK1 channel in the presence of 30 mM lactate at pH 6.5 showed a 6.14 ± 0.87 fold increase which was significantly higher compared to hTREK1 activity in the presence of 30 mM lactate at pH 7.4 (3.82 ± 0.42 fold) (Fig. 12A and C). hTREK1 activity (NPo ) was also significantly higher than the NPo of the channel in the presence of pH 6.5 alone (2.7 ± 0.32 fold), reiterating the significance of lactate as a potent activator of hTREK1 and its possible role in neuroprotection (Fig. 12). Discussion We chose hippocampal CA1sr astrocytes as the cellular system for evaluating the effect of lactate on TREK1 electrophysiology because (1) they are native to an ischaemic insult-prone region (Nikonenko et al. 2009), (2) they express MCT4 (Km for lactate 28–35 mM), which can internalize ischaemic concentrations of lactate (Erlichman et al. 2008), and (3) they express TREK1 channels (Zhou et al. 2009). Ischaemic concentrations of lactate increased whole cell TREK1 current of rat CA1sr astrocytes (Fig. 1). It is unlikely that 15–30 mM lactate would act on neurons directly since they express MCT2 (Km for lactate 0.7 mM) (Erlichman et al. 2008) that cannot internalize ischaemic amounts of lactate (Dienel & Hertz, 2005). The I–V relationships of the passive conductance of CA1sr astrocytes in hippocampal slices are linear, which is attributed to the inadequate spatial control of membrane potential under voltage clamp resulting from the high leakage conductance; this is different from the I–V profiles  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

J Physiol 594.1

Interaction of lactate and TREK1

73

hTREK1 WT CTD Δ119 CTD Δ100 CTD Δ89 H328A

426 307 326 337 426

Figure 8. Identification of the site of interaction of lactate with the C-terminal domain (CTD) of hTREK1 In A, B, C and D representative hTREK1 single channel current traces from inside-out patches and open probability (NPo vs. time) histograms of CTD119, CTD100, CTD89 and H328A are shown in control, 30 mM lactate and washout conditions, respectively. Arrows on the condensed traces of channel activity indicate the part of the trace that has been magnified below each of them. E, summary plot of normalized NPo of different deletion and point mutants of hTREK1 after application of 30 mM lactate. The dashed line represents control. Sample size for each experiment is indicated above their corresponding bars. NPo of CTD89 in the presence of 30 mM lactate exhibited a significant increase from its control (P < 0.0001; paired t test). Data are represented as means ± SEM. F, the 47 residues of hTREK1 CTD sequence from end of the transmembrane domain are shown and the lines below indicate the deletions made and the mutated amino acid is underlined with bold line. The deletions (CTD119, CTD100) and the point mutation (H328A) which showed no functional changes in hTREK1 channel activity and CTD89, which retained the 30 mM lactate induced increase in hTREK1 channel activity, are indicated by grey and black lines, respectively.

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

74

S. Ghatak and others

J Physiol 594.1

hTREK1WT

426

H328Q

426

R326A

A

426

Figure 9. Identification of residues in the C-terminal domain of hTREK1 that interact with lactate In A and B, representative hTREK1 single channel current traces from inside-out patches and open probability (NPo vs. time) histograms of H328Q and R326A hTREK1 mutants are shown in control, 30 mM lactate and washout conditions. Arrows on the condensed traces of channel activity indicate the part of the trace that has been magnified below each of them. C, summary plot of normalized NPo of different point mutants of hTREK1 after application of 30 mM lactate. The dashed line represents control. Sample size for each experiment is indicated above their corresponding bars. Data are represented as means ± SEM. NPo of R326A in the presence of 30 mM lactate exhibited significant increase from its control (P < 0.0001; paired t test). D, the 47 residues of the hTREK1 CTD sequence from the end of the transmembrane domain are shown and the mutated amino acid is underlined with a bold line. The point mutant (H328Q), which showed no functional changes in hTREK1 channel activity, and R326A, which retained the 30 mM lactate induced increase in hTREK1 channel activity, are indicated by grey and black lines, respectively.

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

Interaction of lactate and TREK1

J Physiol 594.1

A

75

B

CTD Δ 89 Control Open

Close (counts/bin)1/2

(counts/bin)1/2

5 4 3 2 1

4

30 mM lactate

3

Control

2 0

1 0

0 –4

–3

–2

–1

ns

–4

0

–3

–2

–1

0

Log duration (s)

Log duration (s)

1

τ0

2

3

30 mM lactate

ns

Control 30 mM lactate 5

4

4

(counts/bin)1/2

(counts/bin)1/2

Open 5 3 2 1

0

Close

0.3

0.6

0.9

40

60

τ C1

2

30 mM lactate

1

Control

3

* *

0

0 –4

–3

–2

–1

–4

0

Log duration (s)

C

–3

–2

–1

0

0

20

Log duration (s)

τ C2

D

H328A Control Open (counts/bin)1/2

(counts/bin)1/2

5 4 3 2 1

30 mM lactate

Close

4 3

Control

2 0

1 0

0 –4

–3 –2 –1 Log duration (s)

ns

–4

0

–3 –2 –1 Log duration (s)

0

0.5

τ0

1

1.5 ns

30 mM lactate Control

30 mM lactate Open (counts/bin)1/2

(counts/bin)1/2

4 3 2 1

0

Close

4

5

3 2

30 mM lactate

1

Control

0.8 τ C1

2.4

1.6

ns

0

0 –4

–3 –2 –1 Log duration (s)

0

–4

–3 –2 –1 Log duration (s)

0

0

20

τ C2

40

60

Figure 10. H328A-hTREK1 mutant nullifies the effect of lactate on longer close time (τc2 ) of the channel A, dwell time distribution histograms for open times (τ o ) and close times (τ c1 , τ c2 ) of CTD89 mutant in control and in the presence of 30 mM lactate. The dashed vertical grey line shows leftward shift in the mean dwell time of the longer closed state (τ c2 ). B, comparison of mean dwell times of CTD89 in control and in the presence of 30 mM lactate. Dwell time in the longer closed state (τ c2 ) was reduced after lactate application (n = 7; ∗∗ P < 0.001; paired t test). C, dwell time distribution histograms for open times (τ ) and close times (τ , τ ) of o c1 c2 H328A mutant in control and in the presence of 30 mM lactate. Mean dwell time of the longer closed state (τ c2 ) remains unchanged as shown by dashed vertical grey line. D, comparison of mean dwell times of H328A in control and in the presence of 30 mM lactate. Dwell times in open (τ o ) and closed states (τ c1 , τ c2 ) remain unchanged (n = 6; paired t test). In A and C, data were obtained from inside-out patches containing only one channel. The continuous grey curves represent the probability density functions fitted to the histograms. Data are represented as means ± SEM in B and D.

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

76

S. Ghatak and others

of whole cell TREK1 currents obtained from heterologous expression systems (Zhou et al. 2009; Hwang et al. 2014). The lactate induced current obtained by subtracting control currents revealed the outward rectifying profile of whole cell TREK1 channels (Fig. 1). Although TREK2 mRNA was found in 23% of Kir 4.1-positive mouse hippocampal astrocytes, immunostaining studies reveal no TREK2 protein expression in CA1sr astrocytes of rat hippocampal slices (Seifert et al. 2009; Minieri et al. 2013). Further, treatment of mouse CA1sr astrocytes with TREK2 small hairpin (sh)RNA did not affect their passive conductance (Hwang et al. 2014).

J Physiol 594.1

We observed lactate to increase an outward rectifying current which could be blocked by known TREK1 channel blockers quinine/fluoxetine, and enhanced by the activator arachidonic acid (Figs 1 and 2). Since TREK1 and TWIK1 are the major contributors of passive conductance in CA1sr astrocytes and not TREK2 (Zhou et al. 2009; Hwang et al. 2014), the major component of the lactate induced outward current could be attributed to activation of TREK1 channels. The activation of TREK1 channels in CA1sr astrocytes required uptake of lactate by monocarboxylate transporters (MCTs), since blockade of MCTs with 4CIN

hTREK1 WT AYFAAVLSMI GDWLRVISKKTKEEVGEFRAHAAEWTANVTAEFKETR..426 CTD Δ100 AYFAAVLSMI GDWLRVISKKTKEEVGEFR

326

H328A AYFAAVLSMI GDWLRVISKKTKEEVGEFRAAAAEWTANVTAEFKETR..426

Figure 11. Lactate interacts with hTREK1 independent of pH In A, B and C representative single channel current traces from inside-out patches of wild-type hTREK1, CTD100 and H328A are shown in control, pH 5.5 and washout conditions. Arrows on the condensed traces of channel activity indicate the part of the trace that has been magnified below each of them. D, summary plot of normalized NPo of different point mutants of hTREK1 after application of pH 5.5. The dashed line represents control. Sample size for each experiment is indicated above their corresponding bars. Data are represented as means ± SEM. NPo of wild-type hTREK1, CTD100 and H328A in the presence of pH 5.5 exhibited a significant increase from their respective controls (P < 0.0001; paired t test). E, the 47 residues of hTREK1 CTD sequence from the end of the transmembrane domain are shown and the mutated amino acid is underlined with a bold line. The grey box shows the presence of E321 in wild-type hTREK1, CTD100 and H328A, highlighting the reason for their similar response to acidosis.  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

J Physiol 594.1

Interaction of lactate and TREK1

77

lactate can have an additive effect on the open probability of the channel. Indeed, the open probability of the hTREK1 channel in the presence of 30 mM lactate at pH 6.5 was significantly higher compared to 30 mM lactate at pH 7.4 in inside-out single hTREK1 channel recordings (Fig. 12). Lactate has been shown to modulate ion channels such as voltage gated sodium channels (Nav ) (Rannou et al. 2012) and chloride channels (ClC-1) in skeletal muscles (de Paoli et al. 2010). In the case of Nav channels, the action of lactate was suggested to be extracellular, but the exact mechanism is unknown (Rannou et al. 2012). Lactate activates the ATP-sensitive potassium channel (KATP ) (Han et al. 1993) and the ASIC in a concentration dependent manner. Lactate acted on hTREK1 intracellularly (Fig. 5), similar to KATP channels. In the case of the ASIC, the enhancing effect of lactate was due to chelation of divalent cations (Immke & McCleskey, 2001). However, experiments that mimicked the chelation effect by perfusion of 0 mM Mg2+ and 0 mM Ca2+ solution on the intracellular side of hTREK1 channels in inside-out patch recordings failed to reproduce the effects of lactate (Fig. 6). Moreover, it is known that the rectification properties of the TREK1 channel are specifically modulated by extracellular Mg2+ (Enyedi & Czirjak, 2010). Thus the mode of action of lactate on this channel must be quite different from its mode of action on ASIC, which led us to explore alternative mechanisms. A functional hTREK1 channel has two closed states and one open state (Nayak et al. 2009). The mean close time for long closures decreased significantly while other kinetic parameters – mean close time for shorter closures, mean open time and unitary conductance – were unaltered in the presence of lactate (Fig. 7). This signifies that hTREK1 spends a lesser time in the longer closed state in the presence of lactate. CTD determines hTREK1 activity by

abolished the effect (Fig. 3). Monocarboxylates such as lactate and pyruvate are internalized via MCTs which symport an anion along with a proton (Halestrap & Price, 1999), causing intracellular acidosis. Rat MCT4 transports lactate and pyruvate with almost equal affinity (Km = 34 mM for lactate and Km = 36.3 mM for pyruvate) (Morris & Felmlee, 2008). Thus the intracellular acidosis within the CA1sr astrocyte caused by transport of 30 mM lactate or 30 mM pyruvate should be similar. However, external 30 mM pyruvate failed to increase TREK1 current in the whole cell configuration with pipette solution maintained at pH 7.4 in CA1sr astrocytes. This indicates that intracellular acidification caused by internalization of monocarboxylates cannot explain the increase in TREK1 activity by lactate (Figs 1 and 3). In undialysed cells, bath application of 10–20 mM lactate (pH 7.4) to corpus callosum, cerebellar white matter, oligodendrocytes, C6 glioma cells and thalamocortical neurons reduced intracellular pH by 0.05–0.19 pH units (Volk et al. 1997; Munsch & Pape, 1999; Rinholm et al. 2011). Intracellular acidification has been shown to increase TREK1 activity but the reduction in pH observed in the above studies is not enough to appreciably increase TREK1 activity (Honor´e et al. 2002). Further, inside-out recordings of CTD100 and H328A mutants of hTREK1, both of which contain the pH-sensitive amino acid E321, show robust increase in activity with low pH but are insensitive to 30 mM lactate (Fig. 11). This indicates that among other monocarboxylates, lactate specifically interacts with TREK1 channels, independent of pH. However, during cerebral ischaemia the extracellular pH decreases to 6.5–6.9 in the brain interstitium (Siemkowicz & Hansen, 1981; Mutch & Hansen, 1984) that lowers intracellular pH (Mellerg˚ard et al. 1994). Since low intracellular pH is a known activator of TREK1 channels (Honor´e et al. 2002), both low pH and

A

B

pH6.5 C pH6 .5 +30L W

0.8

0.4 0.2

pH6.5

pH6 .5 + 30 mM lactate (pH6 .5+30L)

Washout (W)

5pA 500 ms

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

0.0

Normalized NP O

Figure 12. Effect of lactate on hTREK1 channels in the presence of acidic pH A, representative inside-out recordings of hTREK1 channel overexpressed in HEK293 cells under the mentioned conditions. (Note the increase in hTREK1 channel activity in the presence of pH 6.5 and 30 mM lactate.) B, open probability histogram (NPo vs. time) for the data represented in A. C, comparative analysis of normalized open probability of hTREK1 channel across three conditions, i.e. pH 7.4 + 30 mM lactate, pH 6.5, pH 6.5 + 30 mM lactate. Data are represented as means ± SEM and the sample size is mentioned above the corresponding bars. Statistical comparisons were made with the Mann–Whitney test (∗∗∗ P < 0.0001). Note the significant increase in open probability of hTREK1 channel in the presence of pH 6.5 + 30 mM lactate.

0.6 NP O

Control (C)

0

200 400 Time (s) ***

8 6 4

4

600 ***

4

4

2 0

pH7 .4+30L pH6.5 pH6 .5+30L

78

S. Ghatak and others

mediating gating transitions between the longer closed state and the open state. The frequency and duration of the longer closed state is dependent on the interaction of kinases with CTD (Zilberberg et al. 2000). Hence, we argued that the interaction of lactate with CTD might be involved in modulating the longer close time of hTREK1. CTD89 showed a similar increase in activity as wild-type hTREK1 with lactate while CTD119 and CTD100 did not, leading us to identify the residues in the stretch between 327 and 337 of the C-terminal as crucial for this interaction (Fig. 8). Lactate is known to interact with the amino acid histidine, which is found in the active site of proteins such as lactate dehydrogenase and lactate oxidase (Pineda et al. 2007; Furuichi et al. 2008). The imidazole ring of histidine has a basic nitrogen at physiological pH which extracts a proton from lactate (Pineda et al. 2007). A pocket containing histidine in myoglobin is implicated in the interaction with lactate (Giardina et al. 1996). The histidine present at the 328th position in the amino acid stretch between 327 and 337 of the C-terminal of hTREK1 was inferred to be important for interaction with lactate. Mutation of H328 to alanine abolished the functional interaction of hTREK1 with lactate. Thus, we inferred that lactate interacts with the H328 residue to cause changes in single hTREK1 channel kinetics (Figs 8, 9 and 10). Lactate acts as a signalling molecule at physiological concentrations via extracellular interaction with hydroxycarboxylic acid 1 receptor (HCA1R, previously known as GPR81, a G protein-coupled receptor), to cause various downstream effects such as inhibition of lipolysis in adipocytes (Ahmed et al. 2010; Kuei et al. 2011). Therefore, it was important to know whether the regulation of TREK1 channel by lactate was mediated intracellularly or extracellularly. Blockade of MCTs abolished the effect of lactate on TREK1 activity (Fig. 3) indicating that transport of lactate across the membrane and its intracellular accumulation was required for mediating the immediate functional effect on TREK1 channel activity. Further, HCA1R localization has been found to be mainly on hippocampal neurons rather than hippocampal astrocytes (Lauritzen et al. 2014). A number of astrocytic homeostatic functions, including K+ buffering, glutamate uptake and pH regulation, depend upon their negative resting membrane potential (RMP) (Wang et al. 2012; Wu et al. 2013). Quinine-sensitive two-pore domain potassium channels are involved in glial K+ buffering in the rat hippocampus (Pasler et al. 2007). Quantitative single cell RT-PCR revealed distinct astrocytic subpopulations with heterogeneity in expression of two-pore domain potassium channels in both hippocampus and cortex (Seifert et al. 2009; Benesova et al. 2012). One of the astrocytic subpopulation which showed low swelling expressed TREK1 strongly and was hypothesized to

J Physiol 594.1

contribute to spatial buffering by releasing potassium into the extracellular space. Moreover, electron micrograph studies show that TREK1 is preferentially located in the processes of astrocyte as compared to astrocyte microdomains near synapses, which experience high concentrations of extracellular potassium (Woo et al. 2012). The physiological relevance of our experiments is supported by the observation that TREK1 channels are activated by ischaemic concentrations but not by basal concentrations of lactate (Fig. 1). Ischaemic concentrations of lactate hyperpolarize the astrocyte membrane by 5 mV (Fig. 3) and a hyperpolarization of 5 mV is physiologically significant since it could increase the conductance of astrocyte glutamate transporter channels and reduce glutamate excitotoxicity (Vandenberg & Ryan, 2013). The findings of our study have important implications since ischaemic concentrations of lactate increase TREK1 activity which might promote efficient potassium clearance, spatial buffering and volume regulation. Current therapeutic interventions used for the early treatment of ischaemic stroke involve administration of tissue plasminogen activator (tPA, thrombolytic therapy), aspirin, dipyridamole and clopidogrel (antiplatelet therapy), and heparin, warfarin and dabigatran (anticoagulant therapy) (Mocco et al. 2007; Whitehead et al. 2007; Melani et al. 2010; Woodruff et al. 2011; Kono et al. 2014; Ozdemir et al. 2014). Treatment with tPA caused a marked detachment of astrocyte end feet from pericytes in the gliovascular unit leading to neurotoxicity and presenting a threat to the safe use of thrombolytic therapy (Deguchi et al. 2014). Antiplatelet drugs such as aspirin and clopidogrel could not decrease neuronal apoptosis and cerebral infarct size in rats (Lee et al. 2005). Therefore there is a scarcity of clinical strategies which focus on post-ischaemic neuronal and glial health. The findings reported in the present study have therapeutic significance in ischaemia, since increased activity of a neuroprotective potassium channel in astrocytes can reduce cell death. In conclusion, our study highlights the regulation of TREK1 channel activity by lactate via an interaction with histidine 328. Increase in TREK1 activation could be one of the important underlying mechanisms that cause lactate-mediated neuroprotection in the hippocampus. References Ahmed K, Tunaru S, Tang C, M¨uller M, Gille A, Sassmann A, Hanson J & Offermanns S (2010). An autocrine lactate loop mediates insulin-dependent inhibition of lipolysis through GPR81. Cell Metab 11, 311–319. Allen NJ & Attwell D (2002). Modulation of ASIC channels in rat cerebellar Purkinje neurons by ischaemia-related signals. J Physiol 543, 521–529.  C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

J Physiol 594.1

Interaction of lactate and TREK1

Benesova J, Rusnakova V, Honsa P, Pivonkova H, Dzamba D, Kubista M & Anderova M (2012). Distinct expression/function of potassium and chloride channels contributes to the diverse volume regulation in cortical astrocytes of GFAP/EGFP mice. PLoS One 7, e29725. Berthet C, Castillo X, Magistretti PJ & Hirt L (2012). New evidence of neuroprotection by lactate after transient focal cerebral ischaemia: extended benefit after intracerebroventricular injection and efficacy of intravenous administration. Cerebrovasc Dis 34, 329–335. Blondeau N, Petrault O, Manta S, Giordanengo V, Gounon P, Bordet R, Lazdunski M & Heurteaux C (2007). Polyunsaturated fatty acids are cerebral vasodilators via the TREK-1 potassium channel. Circ Res 101, 176–184. Boakye P, White EJ & Clark JB (1991). Protection of ischaemic synaptosomes from calcium overload by addition of exogenous lactate. J Neurochem 57, 88–94. Buckler KJ & Honor´e E (2005). The lipid-activated two-pore domain K+ channel TREK-1 is resistant to hypoxia: implication for ischaemic neuroprotection. J Physiol 562, 213–222. Cadaveira-Mosquera A, Ribeiro SJ, Reboreda A, Perez M & Lamas JA (2011). Activation of TREK currents by the neuroprotective agent riluzole in mouse sympathetic neurons. J Neurosci 31, 1375–1385. Castro MA, Angulo C, Brauchi S, Nualart F & Concha, II (2008). Ascorbic acid participates in a general mechanism for concerted glucose transport inhibition and lactate transport stimulation. Pflugers Arch 457, 519–528. de Paoli FV, Ortenblad N, Pedersen TH, Jorgensen R & Nielsen OB (2010). Lactate per se improves the excitability of depolarized rat skeletal muscle by reducing the Cl− conductance. J Physiol 588, 4785–4794. Deguchi K, Liu N, Liu W, Omote Y, Kono S, Yunoki T, Deguchi S, Yamashita T, Ikeda Y & Abe K (2014). Pericyte protection by edaravone after tissue plasminogen activator treatment in rat cerebral ischemia. J Neurosci Res 92, 1509–1519. Dienel GA & Hertz L (2005). Astrocytic contributions to bioenergetics of cerebral ischemia. Glia 50, 362–388. Dimlich RV & Nelson MM (1992). Facilitating postischemic reduction of cerebral lactate in rats. Stroke 23, 1145–1152. Enyedi P & Czirjak G (2010). Molecular background of leak K+ currents: two-pore domain potassium channels. Physiol Rev 90, 559–605. Erlichman JS, Hewitt A, Damon TL, Hart M, Kurascz J, Li A & Leiter JC (2008). Inhibition of monocarboxylate transporter 2 in the retrotrapezoid nucleus in rats: a test of the astrocyte-neuron lactate-shuttle hypothesis. J Neurosci 28, 4888–4896. Furuichi M, Suzuki N, Dhakshnamoorhty B, Minagawa H, Yamagishi R, Watanabe Y, Goto Y, Kaneko H, Yoshida Y, Yagi H, Waga I, Kumar PK & Mizuno H (2008). X-ray structures of Aerococcus viridans lactate oxidase and its complex with D-lactate at pH 4.5 show an α-hydroxyacid oxidation mechanism. J Mol Biol 378, 436–446. Giardina B, Ascenzi P, Clementi ME, De Sanctis G, Rizzi M & Coletta M (1996). Functional modulation by lactate of myoglobin. A monomeric allosteric hemoprotein. J Biol Chem 271, 16999–17001.

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

79

Glenn TC, Martin NA, Horning MA, McArthur DL, Hovda DA, Vespa P & Brooks GA (2015). Lactate: brain fuel in human traumatic brain injury: a comparison with normal healthy control subjects. J Neurotrauma 32, 820–832. Halestrap AP & Price NT (1999). The proton-linked monocarboxylate transporter (MCT) family: structure, function and regulation. Biochem J 343, 281–299. Han J, So I, Kim EY & Earm YE (1993). ATP-sensitive potassium channels are modulated by intracellular lactate in rabbit ventricular myocytes. Pflugers Arch 425, 546–548. Harinath S & Sikdar SK (2004). Trichloroethanol enhances the activity of recombinant human TREK-1 and TRAAK channels. Neuropharmacology 46, 750–760. Heurteaux C, Guy N, Laigle C, Blondeau N, Duprat F, Mazzuca M, Lang-Lazdunski L, Widmann C, Zanzouri M, Romey G & Lazdunski M (2004). TREK-1, a K+ channel involved in neuroprotection and general anesthesia. EMBO J 23, 2684–2695. Hillered L, Hallstr¨om A, Segersv¨ard S, Persson L & Ungerstedt U (1989). Dynamics of extracellular metabolites in the striatum after middle cerebral artery occlusion in the rat monitored by intracerebral microdialysis. J Cereb Blood Flow Metab 9, 607–616. Holloway R, Zhou Z, Harvey HB, Levasseur JE, Rice AC, Sun D, Hamm RJ & Bullock MR (2007). Effect of lactate therapy upon cognitive deficits after traumatic brain injury in the rat. Acta Neurochir (Wien) 149, 919–927. Honor´e E, Maingret F, Lazdunski M & Patel AJ (2002). An intracellular proton sensor commands lipid- and mechano-gating of the K+ channel TREK-1. EMBO J 21, 2968–2976. Hwang EM, Kim E, Yarishkin O, Woo DH, Han KS, Park N, Bae Y, Woo J, Kim D, Park M, Lee CJ & Park JY (2014). A disulphide-linked heterodimer of TWIK-1 and TREK-1 mediates passive conductance in astrocytes. Nat Commun 5, 3227. Immke DC & McCleskey EW (2001). Lactate enhances the acid-sensing Na+ channel on ischemia-sensing neurons. Nat Neurosci 4, 869–870. Kono S, Deguchi K, Omote Y, Yunoki T, Yamashita T, Kurata T, Ikeda Y & Abe K (2014). Reducing hemorrhagic complication by dabigatran via neurovascular protection after recanalization with tissue plasminogen activator in ischemic stroke of rat. J Neurosci Res 92, 46–53. Kucheryavykh LY, Kucheryavykh YV, Inyushin M, Shuba YM, Sanabria P, Cubano LA, Skatchkov SN & Eaton MJ (2009). Ischemia increases TREK-2 channel expression in astrocytes: relevance to glutamate clearance. Open Neurosci J 3, 40–47. Kuei C, Yu J, Zhu J, Wu J, Zhang L, Shih A, Mirzadegan T, Lovenberg T & Liu C (2011). Study of GPR81, the lactate receptor, from distant species identifies residues and motifs critical for GPR81 functions. Mol Pharmacol 80, 848–858. Lauritzen KH, Morland C, Puchades M, Holm-Hansen S, Hagelin EM, Lauritzen F, Attramadal H, Storm-Mathisen J, Gjedde A & Bergersen LH (2014). Lactate receptor sites link neurotransmission, neurovascular coupling, and brain energy metabolism. Cereb Cortex 24, 2784–2795.

80

S. Ghatak and others

Lee JH, Park SY, Lee WS & Hong KW (2005). Lack of antiapoptotic effects of antiplatelet drug, aspirin and clopidogrel, and antioxidant, MCI-186, against focal ischemic brain damage in rats. Neurol Res 27, 483–492. Lee S, Yoon BE, Berglund K, Oh SJ, Park H, Shin HS, Augustine GJ & Lee CJ (2010). Channel-mediated tonic GABA release from glia. Science 330, 790–796. Liu C, Wu J, Zhu J, Kuei C, Yu J, Shelton J, Sutton SW, Li X, Yun SJ, Mirzadegan T, Mazur C, Kamme F & Lovenberg TW (2009). Lactate inhibits lipolysis in fat cells through activation of an orphan G-protein-coupled receptor, GPR81. J Biol Chem 284, 2811–2822. Maran A, Cranston I, Lomas J, Macdonald I & Amiel SA (1994). Protection by lactate of cerebral function during hypoglycaemia. Lancet 343, 16–20. Mazella J, Petrault O, Lucas G, Deval E, Beraud-Dufour S, Gandin C, El-Yacoubi M, Widmann C, Guyon A, Chevet E, Taouji S, Conductier G, Corinus A, Coppola T, Gobbi G, Nahon JL, Heurteaux C & Borsotto M (2010). Spadin, a sortilin-derived peptide, targeting rodent TREK-1 channels: a new concept in the antidepressant drug design. PLoS Biol 8, e1000355. Melani A, Cipriani S, Corti F & Pedata F (2010). Effect of intravenous administration of dipyridamole in a rat model of chronic cerebral ischemia. Ann N Y Acad Sci 1207, 89–96. Mellerg˚ard P, Ouyang YB & Siesj¨o BK (1994). The regulation of intracellular pH is strongly dependent on extracellular pH in cultured rat astrocytes and neurons. Acta Neurochir Suppl (Wien) 60, 34–37. Minieri L, Pivonkova H, Caprini M, Harantova L, Anderova M & Ferroni S (2013). The inhibitor of volume-regulated anion channels DCPIB activates TREK potassium channels in cultured astrocytes. Br J Pharmacol 168, 1240–1254. Mocco J, Shelton CE, Sergot P, Ducruet AF, Komotar RJ, Otten ML, Sosunov SA, MacArthur RB, Kennedy TP & Connolly ES Jr (2007). O-desulfated heparin improves outcome after rat cerebral ischemia/reperfusion injury. Neurosurgery 61, 1297–1304. Morris ME & Felmlee MA (2008). Overview of the proton-coupled MCT (SLC16A) family of transporters: characterization, function and role in the transport of the drug of abuse γ-hydroxybutyric acid. AAPS J 10, 311–321. Munsch T & Pape HC (1999). Modulation of the hyperpolarization-activated cation current of rat thalamic relay neurones by intracellular pH. J Physiol 519, 493–504. Mutch WA & Hansen AJ (1984). Extracellular pH changes during spreading depression and cerebral ischemia: mechanisms of brain pH regulation. J Cereb Blood Flow Metab 4, 17–27. Nayak TK, Harinath S, Nama S, Somasundaram K & Sikdar SK (2009). Inhibition of human two-pore domain K+ channel TREK1 by local anesthetic lidocaine: negative cooperativity and half-of-sites saturation kinetics. Mol Pharmacol 76, 903–917. Nikonenko AG, Radenovic L, Andjus PR & Skibo GG (2009). Structural features of ischemic damage in the hippocampus. Anat Rec (Hoboken) 292, 1914–1921.

J Physiol 594.1

Noel J, Sandoz G & Lesage F (2011). Molecular regulations governing TREK and TRAAK channel functions. Channels (Austin) 5, 402–409. Oddo M, Levine JM, Frangos S, Maloney-Wilensky E, Carrera E, Daniel RT, Levivier M, Magistretti PJ & LeRoux PD (2012). Brain lactate metabolism in humans with subarachnoid hemorrhage. Stroke 43, 1418–1421. Ozdemir O, Ozbek Z, Vural M, Durmaz R, Cosan E, Arslantas A & Atasoy MA (2014). Early decompressive surgery after combined intra-venous thrombolysis and endovascular stroke treatment. Clin Neurol Neurosurg 122, 66–69. Pasler D, Gabriel S & Heinemann U (2007). Two-pore-domain potassium channels contribute to neuronal potassium release and glial potassium buffering in the rat hippocampus. Brain Res 1173, 14–26. Pellerin L & Magistretti PJ (1994). Glutamate uptake into astrocytes stimulates aerobic glycolysis: a mechanism coupling neuronal activity to glucose utilization. Proc Natl Acad Sci USA 91, 10625–10629. Phillis JW & O’Regan MH (2002). Evidence for swelling-induced adenosine and adenine nucleotide release in rat cerebral cortex exposed to monocarboxylate-containing or hypotonic artificial cerebrospinal fluids. Neurochem Int 40, 629–635. Phillis JW, Song D, Guyot LL & O’Regan MH (1999). Lactate reduces amino acid release and fuels recovery of function in the ischemic brain. Neurosci Lett 272, 195–198. Pineda JR, Callender R & Schwartz SD (2007). Ligand binding and protein dynamics in lactate dehydrogenase. Biophys J 93, 1474–1483. Pivonkova H, Benesova J, Butenko O, Chvatal A & Anderova M (2010). Impact of global cerebral ischemia on K+ channel expression and membrane properties of glial cells in the rat hippocampus. Neurochem Int 57, 783–794. Rannou F, Leschiera R, Giroux-Metges MA & Pennec JP (2012). Effects of lactate on the voltage-gated sodium channels of rat skeletal muscle: modulating current opinion. J Appl Physiol (1985) 112, 1454–1465. Rinholm JE, Hamilton NB, Kessaris N, Richardson WD, Bergersen LH & Attwell D (2011). Regulation of oligodendrocyte development and myelination by glucose and lactate. J Neurosci 31, 538–548. Rossi DJ, Brady JD & Mohr C (2007). Astrocyte metabolism and signaling during brain ischemia. Nat Neurosci 10, 1377–1386. Seifert G, Huttmann K, Binder DK, Hartmann C, Wyczynski A, Neusch C & Steinhauser C (2009). Analysis of astroglial K+ channel expression in the developing hippocampus reveals a predominant role of the Kir4.1 subunit. J Neurosci 29, 7474–7488. Siemkowicz E & Hansen AJ (1981). Brain extracellular ion composition and EEG activity following 10 minutes ischemia in normo- and hyperglycemic rats. Stroke 12, 236–240. Vandenberg RJ & Ryan RM (2013). Mechanisms of glutamate transport. Physiol Rev 93, 1621–1657. Volk C, Kempski B & Kempski OS (1997). Inhibition of lactate export by quercetin acidifies rat glial cells in vitro. Neurosci Lett 223, 121–124.

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

J Physiol 594.1

Interaction of lactate and TREK1

Walz W & Harold DE (1990). Brain lactic acidosis and synaptic function. Can J Physiol Pharmacol 68, 164–169. Walz W & Mukerji S (1990). Simulation of aspects of ischemia in cell culture: changes in lactate compartmentation. Glia 3, 522–528. Wang M, Song J, Xiao W, Yang L, Yuan J, Wang W, Yu Z & Xie M (2012). Changes in lipid-sensitive two-pore domain potassium channel TREK-1 expression and its involvement in astrogliosis following cerebral ischemia in rats. J Mol Neurosci 46, 384–392. Whitehead SN, Bayona NA, Cheng G, Allen GV, Hachinski VC & Cechetto DF (2007). Effects of triflusal and aspirin in a rat model of cerebral ischemia. Stroke 38, 381–387. Woo DH, Han KS, Shim JW, Yoon BE, Kim E, Bae JY, Oh SJ, Hwang EM, Marmorstein AD, Bae YC, Park JY & Lee CJ (2012). TREK-1 and Best1 channels mediate fast and slow glutamate release in astrocytes upon GPCR activation. Cell 151, 25–40. Woodruff TM, Thundyil J, Tang SC, Sobey CG, Taylor SM & Arumugam TV (2011). Pathophysiology, treatment, and animal and cellular models of human ischemic stroke. Mol Neurodegener 6, 11. Wu X, Liu Y, Chen X, Sun Q, Tang R, Wang W, Yu Z & Xie M (2013). Involvement of TREK-1 activity in astrocyte function and neuroprotection under simulated ischemia conditions. J Mol Neurosci 49, 499–506. Zhou M, Xu G, Xie M, Zhang X, Schools GP, Ma L, Kimelberg HK & Chen H (2009). TWIK-1 and TREK-1 are potassium channels contributing significantly to astrocyte passive conductance in rat hippocampal slices. J Neurosci 29, 8551–8564. Zilberberg N, Ilan N, Gonzalez-Colaso R & Goldstein SA (2000). Opening and closing of KCNKO potassium leak channels is tightly regulated. J Gen Physiol 116, 721–734.

 C 2015 The Authors. The Journal of Physiology  C 2015 The Physiological Society

81

Additional information Competing interests None declared.

Author contributions S.G. performed whole cell and inside-out electrophysiology in HEK293 cells, site directed mutagenesis and single channel data analysis. A.B. performed acute slicing, astrocyte electrophysiology on hippocampal slices and data analysis. S.G., A.B. and S.K.S. designed the experiments and wrote the manuscript. S.K.S. supervised the project. All authors have approved the final version of the manuscript and agree to be accountable for all aspects of the work. All persons designated as authors qualify for authorship, and all those who qualify for authorship are listed.

Funding The research was funded by the Department of Biotechnology, Ministry of Science and Technology, DBT-IISc Partnership Programme for Advanced Research in Biological Sciences and Bioengineering (DBT/BF/PRIns/2011-12/IISc). This work was also supported by Council for Scientific and Industrial Research (CSIR) fellowships to S. Ghatak and A. Banerjee.

Acknowledgements We thank Professor Steve A. N. Goldstein of Yale University for kindly donating the pRAT-hTREK1 plasmid.