Original Paper Received: February 3, 2015 Accepted after revision: April 9, 2015 Published online: May 22, 2015
Pharmacology 2015;95:271–278 DOI: 10.1159/000398812
Is Klotho F352V Polymorphism the Missing Piece of the Bone Loss Puzzle in Renal Transplant Recipients? Sebahat Ozdem a Vural Taner Yılmaz b Sadi S. Ozdem c Levent Donmez d Ramazan Cetinkaya b Gultekin Suleymanlar b F. Fevzi Ersoy b
Departments of Medical Biochemistry, Akdeniz University Medical School, b Division of Nephrology, Internal Medicine, c Medical Pharmacology, d Public Health, Antalya, Turkey
Key Words Bone · Klotho polymorphism · Osteoporosis · Renal transplantation
Abstract Background: Bone disorders are next to cardiovascular problems in frequency in renal transplant (RT) recipients. Reduction in 1,25-dihydroxycholecalciferol (1,25D) levels is among the reasons causing bone loss in these patients. Klotho (KL) serves as a co-receptor for fibroblast growth factor 23 (FGF23), and functions in vitamin D metabolism. KL polymorphisms have been identified in several studies, and phenylalanine to valine substitution at amino acid position 352 seemed to be important to KL function. We investigated KL F352V polymorphism and its relation with 1,25D levels in RT recipients. Methods: The study included 25 RT recipients (8 female, 17 male) and 26 (14 female, 12 male) healthy control subjects who were wild (FF) phenotypes in terms of KL F352V polymorphism. RT recipients with (FV, n = 11) and without (FF, n = 14) a heterozygote polymorphism were determined with high resolution DNA melting analysis of KL F352V polymorphism. Serum 1,25D levels were measured using the RIA method. Results: RT recipients with FV phenotype had significantly lower 1,25D levels (17.58 ± 18.38 pg/ml) compared to recipients with FF phenotype (44.91 ± 24.68 pg/ml) and control subjects (28.24 ± 12.13 pg/
© 2015 S. Karger AG, Basel 0031–7012/15/0956–0271$39.50/0 E-Mail [email protected] www.karger.com/pha
ml). 1,25D levels in RT recipients with FF phenotype were significantly higher than control subjects. Conclusions: KL F352V polymorphism may increase the expression of FGF23 co-receptor, KL protein and thus may decrease renal expression of 1α-hydroxylase, and/or stimulate 24-hydroxylase in RT recipients. The resultant decrease 1,25D levels may participate in bone loss in these patients. © 2015 S. Karger AG, Basel
Introduction
Renal transplantation is the most important treatment modality increasing the quality of life in end-stage renal failure patients. Many patients who were previously on dialysis reported fewer complications following renal transplantation. Chronic complications are more frequent in renal transplant (RT) recipients who are in line with the increments in graft survival [1]. Bone disorders such as osteoporosis and osteopenia are next to cardiovascular problems in frequency among RT recipients. Renal osteodystrophy refers to multiple skeletal and mineral metabolism disorders associated with chronic kidney disease (CKD) [1, 2], whereas the newly defined more broader term CKD-mineral and bone disorder (CKDMBD) better defines the mineral, bone, hormonal and calcific cardiovascular abnormalities seen in CKD. CalSebahat Ozdem Department of Medical Biochemistry Akdeniz University Medical School TR–07070, Konyaalti, Antalya (Turkey) E-Mail ozdem @ akdeniz.edu.tr
Downloaded by: University of Pittsburgh 198.143.32.65 - 1/28/2016 7:10:28 AM
a
272
Pharmacology 2015;95:271–278 DOI: 10.1159/000398812
Table 1. Immunosuppressives used in renal transplant (RT) recipients in the study
RT FF RT recipients sub-group sub-group TAC + MFA + PRE CYC + MFA + PRE TAC + SIR + MFA + PRE CYC + EVE + MFA + PRE TAC + EVE + MFA + PRE CYC + SIR + MFA + PRE
10 8 3 2 1 1
4 2 2 1 1 1
6 6 1 1 0 0
TAC = Tacrolimus; MFA = mycophenolic acid; CYC = cyclosporine; PRE = prednisolone; EVE = everolimus; SIR = sirolimus.
poprotein cholesterol, systolic blood pressure, stroke and longevity [24] has also been associated with bone mineral density [25, 26]. Therefore, it might also play a role in bone loss and fracture risk in RT recipients. Therefore, in this study, we investigated the involvement of KL F352V (rs9536314) polymorphism in bone loss and fracture risk together with its relations with biochemical markers of bone metabolism in RT recipients. Material and Methods The study included 25 RT recipients (8 female, 17 male, age: 40.5 ± 12.0) and 26 healthy age- and sex-matched control subjects (14 female, 12 male, age: 45.0 ± 7.0) who were homozygous wild phenotypes (FF) in terms of KL F352V polymorphism. The study was approved by the local medical ethics committee and carried out in agreement with the Declaration of Helsinki. RT recipients with (FV, n = 11) and without (FF, n = 14) a heterozygous polymorphism were determined with high-resolution DNA melting analysis of KL F352V polymorphism. Whole-body and whole femur dual energy X-ray absorptiometry (DEXA) measurements together with the levels of 1,25-dihydroxycholecalciferol (1,25D), intact parathormone (iPTH), C-Terminal FGF23 (FGF23), creatinine, blood urea nitrogen (BUN), calcium, phosphorus and glomerular filtration rate (GFR) and FRAX score calculations were performed in all study subjects. Distribution of RT recipients according to administered immunosuppressive agent protocol was determined (table 1). In all protocols, prednisolone (PRE) was administered starting at the postoperative day 0 in doses of 1,000, 500, 250, 160, 80, 40 and 20 mg/day; till the end of the 1st month 20 mg/day; between 1st and 3rd months 15 mg/day, 3rd–6th months 10 mg/day, 6th–12th months 7.5 mg/ day and after first year 5 mg/day. Starting doses of tacrolimus (TAC), cyclosporine (CYC), everolimus (EVE) and sirolimus (SIR) were 0.15 mg/kg/day, 6–8 mg/kg/day, 2 times 0.75 mg/day, and 2 mg/day, respectively, and doses were titrated according to target plasma levels. Mycophenolic acid (MPA) was started at doses of 2 times 1 g or 720 mg/day, and treatment continued with 25% dose reduction in EVE or SIR combination. Patients with prolonged im-
Ozdem/Yılmaz/Ozdem/Donmez/ Cetinkaya/Suleymanlar/Ersoy
Downloaded by: University of Pittsburgh 198.143.32.65 - 1/28/2016 7:10:28 AM
citriol deficiency, hypocalcemia, hyperphosphatemia, secondary hyperparathyroidism, metabolic acidosis, uremia, and aluminum deposition are among the mechanisms involved in CKD-MBD pathophysiology [3]. Additionally, factors such as age, gender, time on dialysis, low calcium intake and drugs affecting calcium metabolism may also be involved in bone disorders observed in CKD-MBD [1, 3]. Renal transplantation exerts a substantial beneficial effect on various hormonal and metabolic disorders that develop during the course of CKD and result in CKDMBD. Despite these beneficial effects, RT recipients still experience marked degrees of bone loss that develops in short- or long-terms following transplantation. Bone losses in short terms develop quickly [4–7] in ranges of 7–10% in the first year following renal transplantation [8, 9]. Nevertheless, the prevalence of osteopenia or osteoporosis reaches 70% in long-term follow-ups [10–13], which increases the risk of bone fractures [11, 14]. Although the immune suppressive drugs are considered the main reason for bone loss after renal transplantation, the duration of renal failure and time on dialysis, resistant metabolic acidosis, secondary hyperparathyroidism, post-transplantation hypophosphatemia, hypogonadism, advanced age, female gender, accumulation of aluminum or β2-microglobuline, diabetes mellitus, smoking and vitamin D deficiency may also contribute in the process [3, 15, 16]. Despite all these well-defined factors, there are still missing pieces of the bone loss puzzle in RT recipients. Klotho (KL) (MIM*604824) gene located in chromosome 13q12 encodes the transmembrane protein Klotho (also known as α-Klotho), which demonstrates anti-aging properties in mice [17–19]. Besides accelerated aging, KL-knockout mice display findings such as abnormal calcium metabolism, ectopic calcification and osteopenia/osteoporosis [17, 20, 21]. KL, together with fibroblast growth factor 23 (FGF23) has become a novel endocrine axis in phosphate/calcium mineral metabolism [22]. Single nucleotide polymorphisms (SNPs) are common in population. They may occur in critical positions of the genes involved in important pathways for cellular metabolism and thus, may influence the enzymatic activity or function of protein encoded by the affected gene. Phenylalanine to valine substitution at amino acid position 352 seemed to be important to KL function [23]. A functional variant of KL in humans, termed KL-VS, is a haplotype variant consisting of two amino acid substitutions (F352V and C370S) defined by a single SNP [23], rs9536314. KL-VS status, in addition to high-density li-
df/dt
1.25 1.20 1.15 1.10 1.05 1.00 0.95 0.90 0.85 0.80 0.75 0.70 0.65 0.60 0.55 0.50 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0
Wild type Heterozygous type Homozygous mutant type dd H2O
Bin A
Bin B
56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
deg.
Fig. 1. Derivative (df/dt) plot of melting curve consisting of two melting regions. Samples with the V allele (blue) had a lower Tm than samples with the F allele (green). The V/F heterozygous samples (red) manifested both melting peaks of these alleles.
mobilization, systemic illness or malignancy, parathyroidectomy or acute rejection history, active infection and other organ transplants, as well as those receiving drugs that affect bone metabolism except immunosuppressive agents and corticosteroids were excluded.
Table 2. Polymerase chain reaction procedure for Klotho gene
Step
Time
Temperature, °C
Klotho Gene F352V (rs9536314) Polymorphism Analysis DNA extracts were prepared from whole blood samples containing EDTA using Qiagen EZ1 DNA Blood 200 ml kits (Catalog No: 951034, QIAGEN GmbH, Hilden, Germany) and BioRobot® EZ1 (QIAGEN GmbH, Hilden, Germany) apparatus and kept at –80 ° C until the day of gene mutation studies. DNA content was measured in all DNA extracts. Sample DNA was amplified using real-time polymerase chain reaction (PCR) (Fw Primer: ACTATC CCGAGAGCATGAAGAATAAC, Rw Primer: AAAGTCAGCA GTTCCTTTGATGAAC (anti: GTTCATCAAAGGAACTGCTG ACTTT), raZor Prob: TTTTCTCAGATTCAGTAAAATCAGG CAGAATAGATGA (anti: CATCTATTCTGCCTGATTTTACT GAATCTGAGAAAA) with Rotor-Gene® Q) (QIAGEN GmbH, Hilden, Germany) under the conditions shown in table 2. After PCR, High Resolution Melting (HRM)-curve analysis and genotyping were performed by fluorescent signal detection with Rotor-Gene® Q 1.7 software (fig. 1). Positive and negative controls (homozygous wild type, heterozygous, and homozygous mutant) were always included in each assay.
Enzyme activation Touchdown cycles × 6 Denaturation Reduce by 1.0°C/cycle Cycling × 50 Denaturation Data collection
08 min
95
15 s 45 s
95 66–61
15 s 45 s
95 60
Measurements of Biochemical Parameters Serum 1,25D levels were measured with radioimmunoassay (RIA) method using commercial kits (Biosource Europe S.A., Niveles, Belgium). Minimal detectable 1,25D level was 1.65 pg/ml and reference interval was 19.6–54.3 pg/ml. Serum intact parathormone (iPTH) levels were measured with electrochemiluminescence
Klotho F352V Polymorphism in Renal Transplant Recipients
using modular immunoassay analyzer (Roche Diagnostics GmbH, Mannheim, Germany). Plasma FGF23 levels were measured with ELISA using ALPCO Diagnostics kits (Salem, NH 03079). Serum levels of creatinine, BUN, phosphorus and calcium were measured with Roche Modular P otoanalyzer (Roche Diagnostics GmbH, Mannheim, Germany) using modified Jaffe, kinetic UV urea, phosphomolibdate colorimetric and o-kresolftalein endpoint colorimetric methods, respectively. The estimated glomerular filtration rate (GFR) value was calculated using the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) formula [27]. Bone Mineral Density Measurements Whole-body and femur total bone mineral density (BMD) was evaluated with DEXA measurements (GE-LUNAR DPX PRO, General Electric Company, Madison, Wis, USA). BMD
Pharmacology 2015;95:271–278 DOI: 10.1159/000398812
273
Downloaded by: University of Pittsburgh 198.143.32.65 - 1/28/2016 7:10:28 AM
F352V (rs9536314) polymorphism analysis
Age, years Male, n (%) Female, n (%)
RT recipients (n = 25)
Control subjects (n = 26)
40.5±12.0 17 (68) 8 (32)
45.0±7.0 12 (46) 14 (54)
Table 4. Demographic characteristics of renal transplant recipients (n = 25) included in the study
Time on dialysis, months Cause of chronic kidney disease, n (%) Hypertension Chronic glomerulonephritis Diabetes mellitus Amyloidosis Other causes Etiology unknown Replacement therapy, n (%) Peritoneal dialysis before transplantation Hemodialysis before transplantation Preemptive transplantation Type of renal transplantation, n (%) Living donor Cadaver
17.56±3.96 7 (28) 2 (8) 1 (4) 1 (4) 4 (16) 10 (40) 5 (20) 15 (60) 5 (20) 25 (100) 0 (0)
Table 5. Demographics of the renal transplant (RT) recipients with (FV) and without (FF) Klotho F352V polymorphism
RT recipients, n Age, years Male, n (%) Female, n (%)
FV sub-group
FF sub-group
11 37.3±13.4 8 (73) 3 (27)
14 43.1±10.5 9 (64) 5 (36)
scores lower than –2.5 standard deviation compared to young reference group were considered osteoporosis; between –1 and –2.5, osteopenia; and more than –1, normal. BMD was evaluated according to the T-score on the basis of World Health Organization (WHO) criteria, which defines T-score as standard deviation of the comparison of bone mass with the mean peak value in young adult reference population and Z-score as relative to mean normal values for subjects of the same age and gender [28]. FRAX Score FRAX is diagnostic tool developed by the WHO Collaborating Centre for Metabolic Bone Diseases at Sheffield University to evaluate the 10-year probability of bone fracture risk. It integrates clinical risk factors with the BMD at the femoral neck to calculate the
274
Pharmacology 2015;95:271–278 DOI: 10.1159/000398812
10-year probability of hip fracture [29]. The online tool using the UK algorithm was used to calculate FRAX scores. All patients were considered to have a secondary cause of osteoporosis. Following calculation of FRAX scores, patients’ risk was stratified using the age-adjusted National Osteoporosis Guideline Group recommendations on the basis of clinical factors alone and FRAX scores were then re-determined with BMD (g/cm2) included [29]. Statistical Analyses Data are presented as means ± SD, n and %. Unpaired Student’s t-tests were used to compare differences between RT recipients and the control group. Significance of continuous variables without normal distributions was compared using the Mann-Whitney U test. FGF23 and iPTH levels did not reveal a Gaussian distribution and were, therefore, transformed into log 10-values. Correlations between numeric parameters were assessed using Spearman rank order correlations. p < 0.05 was considered statistically significant for all tests.
Results
There were no significant differences in age and gender between RT recipients and control subjects (table 3). Demographic characteristics of the RT recipients were given in table 4. Bone losses in control subjects and RT recipients, respectively, were as follows: 31% (7 osteopenia) vs. 64% (4 osteoporosis, 12 osteopenia) with wholebody T-score; 23% (6 osteopenia) vs. 68% (3 osteoporosis, 14 osteopenia) with femur total T-score. RT recipients were divided into two sub-groups based on the presence (heterozygous polymorphism, FV subgroup, n = 11) or absence (wild, FF sub-group, n = 14) of KL F352V (rs9536314) polymorphism. There were no homozygous mutant patients. Demographic information of the sub-groups was presented in table 5. Height, weight and body mass index (BMI) did not differ significantly between RT recipients and control subjects. Time on dialysis and time after renal transplantation were similar in FV and FF sub-groups of RT recipients (table 6). Serum creatinine, BUN, GFR, calcium, phosphorus, iPTH and FGF23 levels did not differ significantly between sub-groups of RT recipients. Creatinine was significantly high and GFR and phosphorus values were significantly low in both (FF and FV) sub-groups of RT recipients compared to control subjects. FGF23 levels did not differ significantly between control subjects and RT recipients. On the other hand, iPTH levels of the RT recipients (both FF and FV sub-groups) were significantly higher than the control group. RT recipients with FV phenotype had significantly lower levels of 1,25D compared to both recipients with FF phenotype and control subOzdem/Yılmaz/Ozdem/Donmez/ Cetinkaya/Suleymanlar/Ersoy
Downloaded by: University of Pittsburgh 198.143.32.65 - 1/28/2016 7:10:28 AM
Table 3. Distribution of subjects according to age and gender in renal transplant (RT) recipients and control subjects
Table 6. Measured parameters in renal transplant (RT) recipients with (FV) or without (FF) Klotho gene F352V (rs9536314) polymor-
phism and control subjects Parameters
Height, cm Weight, kg BMI, kg/m2 Time on dialysis, months Range Time after transplantation, months Range Creatinine, mg/dl BUN, mg/dl GFR, ml/min/1.73 m2 Ca, mg/dl Pi, mg/dl log iPTH log FGF23 1,25D, pg/ml Whole-body BMD, g/cm2 Whole-body T-score Whole-body Z-score Femur total BMD, g/cm2 Femur total T-score Femur total Z-score FRAX score
RT FV sub-group
RT FF sub-group
Control group
p value
169.60±8.12 68.70±10.72 23.81±2.85 41.2±46.4 0–159 17.3±4.4 13–21 1.20±0.51 16.18±4.93 82.82±25.25 9.81±0.58 3.24±0.94 1.834±0.228 1.74±0.530 17.58±18.38 1.114±0.082 –1.00±1.02 –0.83±1.07 0.870±0.098 –1.68±1.35 –1.35±0.79 7.06±1.91
165.90±6.41 73.07±9.85 26.23±3.82 31.9±40.7 0–137 17.9±3.4 12–24 1.21±0.31 16.43±5.36 69.93±15.93 9.55±0.64 3.12±0.83 1.878±0.381 1.626±0.370 44.91±24.68 1.097±0.100 –1.13±1.26 –0.87±1.36 0.900±0.168 –1.29±1.26 –0.82±1.22 7.06±3.33
168.00±8.70 70.62±11.24 24.98±3.16
0.25 0.32 0.061 0.599
FV vs. FF
FV vs. control
FF vs. control
0.60 0.64 0.31
0.40 0.48 0.15
0.695 0.84±0.15 13.85±2.93 95.42±10.90 9.58±0.33 3.81±0.41 1.547±0.131 1.794±0.280 28.24±12.13 1.171±0.126 –0.51±0.86 –0.26±1.04 1.004±0.109 –0.13±0.84 0.27±0.80 3.14±0.86
0.92 0.90 0.132 0.292 0.73 0.735 0.549 0.0055 0.65 0.77 0.94 0.602 0.378 0.23 0.99
0.003 0.081 0.039 0.134 0.014
Pharmacology 2015;95:271–278 DOI: 10.1159/000398812
Is Klotho F352V Polymorphism the Missing Piece of the Bone Loss Puzzle in Renal Transplant Recipients? Sebahat Ozdem a Vural Taner Yılmaz b Sadi S. Ozdem c Levent Donmez d Ramazan Cetinkaya b Gultekin Suleymanlar b F. Fevzi Ersoy b
Departments of Medical Biochemistry, Akdeniz University Medical School, b Division of Nephrology, Internal Medicine, c Medical Pharmacology, d Public Health, Antalya, Turkey
Key Words Bone · Klotho polymorphism · Osteoporosis · Renal transplantation
Abstract Background: Bone disorders are next to cardiovascular problems in frequency in renal transplant (RT) recipients. Reduction in 1,25-dihydroxycholecalciferol (1,25D) levels is among the reasons causing bone loss in these patients. Klotho (KL) serves as a co-receptor for fibroblast growth factor 23 (FGF23), and functions in vitamin D metabolism. KL polymorphisms have been identified in several studies, and phenylalanine to valine substitution at amino acid position 352 seemed to be important to KL function. We investigated KL F352V polymorphism and its relation with 1,25D levels in RT recipients. Methods: The study included 25 RT recipients (8 female, 17 male) and 26 (14 female, 12 male) healthy control subjects who were wild (FF) phenotypes in terms of KL F352V polymorphism. RT recipients with (FV, n = 11) and without (FF, n = 14) a heterozygote polymorphism were determined with high resolution DNA melting analysis of KL F352V polymorphism. Serum 1,25D levels were measured using the RIA method. Results: RT recipients with FV phenotype had significantly lower 1,25D levels (17.58 ± 18.38 pg/ml) compared to recipients with FF phenotype (44.91 ± 24.68 pg/ml) and control subjects (28.24 ± 12.13 pg/
© 2015 S. Karger AG, Basel 0031–7012/15/0956–0271$39.50/0 E-Mail [email protected] www.karger.com/pha
ml). 1,25D levels in RT recipients with FF phenotype were significantly higher than control subjects. Conclusions: KL F352V polymorphism may increase the expression of FGF23 co-receptor, KL protein and thus may decrease renal expression of 1α-hydroxylase, and/or stimulate 24-hydroxylase in RT recipients. The resultant decrease 1,25D levels may participate in bone loss in these patients. © 2015 S. Karger AG, Basel
Introduction
Renal transplantation is the most important treatment modality increasing the quality of life in end-stage renal failure patients. Many patients who were previously on dialysis reported fewer complications following renal transplantation. Chronic complications are more frequent in renal transplant (RT) recipients who are in line with the increments in graft survival [1]. Bone disorders such as osteoporosis and osteopenia are next to cardiovascular problems in frequency among RT recipients. Renal osteodystrophy refers to multiple skeletal and mineral metabolism disorders associated with chronic kidney disease (CKD) [1, 2], whereas the newly defined more broader term CKD-mineral and bone disorder (CKDMBD) better defines the mineral, bone, hormonal and calcific cardiovascular abnormalities seen in CKD. CalSebahat Ozdem Department of Medical Biochemistry Akdeniz University Medical School TR–07070, Konyaalti, Antalya (Turkey) E-Mail ozdem @ akdeniz.edu.tr
Downloaded by: University of Pittsburgh 198.143.32.65 - 1/28/2016 7:10:28 AM
a
272
Pharmacology 2015;95:271–278 DOI: 10.1159/000398812
Table 1. Immunosuppressives used in renal transplant (RT) recipients in the study
RT FF RT recipients sub-group sub-group TAC + MFA + PRE CYC + MFA + PRE TAC + SIR + MFA + PRE CYC + EVE + MFA + PRE TAC + EVE + MFA + PRE CYC + SIR + MFA + PRE
10 8 3 2 1 1
4 2 2 1 1 1
6 6 1 1 0 0
TAC = Tacrolimus; MFA = mycophenolic acid; CYC = cyclosporine; PRE = prednisolone; EVE = everolimus; SIR = sirolimus.
poprotein cholesterol, systolic blood pressure, stroke and longevity [24] has also been associated with bone mineral density [25, 26]. Therefore, it might also play a role in bone loss and fracture risk in RT recipients. Therefore, in this study, we investigated the involvement of KL F352V (rs9536314) polymorphism in bone loss and fracture risk together with its relations with biochemical markers of bone metabolism in RT recipients. Material and Methods The study included 25 RT recipients (8 female, 17 male, age: 40.5 ± 12.0) and 26 healthy age- and sex-matched control subjects (14 female, 12 male, age: 45.0 ± 7.0) who were homozygous wild phenotypes (FF) in terms of KL F352V polymorphism. The study was approved by the local medical ethics committee and carried out in agreement with the Declaration of Helsinki. RT recipients with (FV, n = 11) and without (FF, n = 14) a heterozygous polymorphism were determined with high-resolution DNA melting analysis of KL F352V polymorphism. Whole-body and whole femur dual energy X-ray absorptiometry (DEXA) measurements together with the levels of 1,25-dihydroxycholecalciferol (1,25D), intact parathormone (iPTH), C-Terminal FGF23 (FGF23), creatinine, blood urea nitrogen (BUN), calcium, phosphorus and glomerular filtration rate (GFR) and FRAX score calculations were performed in all study subjects. Distribution of RT recipients according to administered immunosuppressive agent protocol was determined (table 1). In all protocols, prednisolone (PRE) was administered starting at the postoperative day 0 in doses of 1,000, 500, 250, 160, 80, 40 and 20 mg/day; till the end of the 1st month 20 mg/day; between 1st and 3rd months 15 mg/day, 3rd–6th months 10 mg/day, 6th–12th months 7.5 mg/ day and after first year 5 mg/day. Starting doses of tacrolimus (TAC), cyclosporine (CYC), everolimus (EVE) and sirolimus (SIR) were 0.15 mg/kg/day, 6–8 mg/kg/day, 2 times 0.75 mg/day, and 2 mg/day, respectively, and doses were titrated according to target plasma levels. Mycophenolic acid (MPA) was started at doses of 2 times 1 g or 720 mg/day, and treatment continued with 25% dose reduction in EVE or SIR combination. Patients with prolonged im-
Ozdem/Yılmaz/Ozdem/Donmez/ Cetinkaya/Suleymanlar/Ersoy
Downloaded by: University of Pittsburgh 198.143.32.65 - 1/28/2016 7:10:28 AM
citriol deficiency, hypocalcemia, hyperphosphatemia, secondary hyperparathyroidism, metabolic acidosis, uremia, and aluminum deposition are among the mechanisms involved in CKD-MBD pathophysiology [3]. Additionally, factors such as age, gender, time on dialysis, low calcium intake and drugs affecting calcium metabolism may also be involved in bone disorders observed in CKD-MBD [1, 3]. Renal transplantation exerts a substantial beneficial effect on various hormonal and metabolic disorders that develop during the course of CKD and result in CKDMBD. Despite these beneficial effects, RT recipients still experience marked degrees of bone loss that develops in short- or long-terms following transplantation. Bone losses in short terms develop quickly [4–7] in ranges of 7–10% in the first year following renal transplantation [8, 9]. Nevertheless, the prevalence of osteopenia or osteoporosis reaches 70% in long-term follow-ups [10–13], which increases the risk of bone fractures [11, 14]. Although the immune suppressive drugs are considered the main reason for bone loss after renal transplantation, the duration of renal failure and time on dialysis, resistant metabolic acidosis, secondary hyperparathyroidism, post-transplantation hypophosphatemia, hypogonadism, advanced age, female gender, accumulation of aluminum or β2-microglobuline, diabetes mellitus, smoking and vitamin D deficiency may also contribute in the process [3, 15, 16]. Despite all these well-defined factors, there are still missing pieces of the bone loss puzzle in RT recipients. Klotho (KL) (MIM*604824) gene located in chromosome 13q12 encodes the transmembrane protein Klotho (also known as α-Klotho), which demonstrates anti-aging properties in mice [17–19]. Besides accelerated aging, KL-knockout mice display findings such as abnormal calcium metabolism, ectopic calcification and osteopenia/osteoporosis [17, 20, 21]. KL, together with fibroblast growth factor 23 (FGF23) has become a novel endocrine axis in phosphate/calcium mineral metabolism [22]. Single nucleotide polymorphisms (SNPs) are common in population. They may occur in critical positions of the genes involved in important pathways for cellular metabolism and thus, may influence the enzymatic activity or function of protein encoded by the affected gene. Phenylalanine to valine substitution at amino acid position 352 seemed to be important to KL function [23]. A functional variant of KL in humans, termed KL-VS, is a haplotype variant consisting of two amino acid substitutions (F352V and C370S) defined by a single SNP [23], rs9536314. KL-VS status, in addition to high-density li-
df/dt
1.25 1.20 1.15 1.10 1.05 1.00 0.95 0.90 0.85 0.80 0.75 0.70 0.65 0.60 0.55 0.50 0.45 0.40 0.35 0.30 0.25 0.20 0.15 0.10 0.05 0
Wild type Heterozygous type Homozygous mutant type dd H2O
Bin A
Bin B
56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
deg.
Fig. 1. Derivative (df/dt) plot of melting curve consisting of two melting regions. Samples with the V allele (blue) had a lower Tm than samples with the F allele (green). The V/F heterozygous samples (red) manifested both melting peaks of these alleles.
mobilization, systemic illness or malignancy, parathyroidectomy or acute rejection history, active infection and other organ transplants, as well as those receiving drugs that affect bone metabolism except immunosuppressive agents and corticosteroids were excluded.
Table 2. Polymerase chain reaction procedure for Klotho gene
Step
Time
Temperature, °C
Klotho Gene F352V (rs9536314) Polymorphism Analysis DNA extracts were prepared from whole blood samples containing EDTA using Qiagen EZ1 DNA Blood 200 ml kits (Catalog No: 951034, QIAGEN GmbH, Hilden, Germany) and BioRobot® EZ1 (QIAGEN GmbH, Hilden, Germany) apparatus and kept at –80 ° C until the day of gene mutation studies. DNA content was measured in all DNA extracts. Sample DNA was amplified using real-time polymerase chain reaction (PCR) (Fw Primer: ACTATC CCGAGAGCATGAAGAATAAC, Rw Primer: AAAGTCAGCA GTTCCTTTGATGAAC (anti: GTTCATCAAAGGAACTGCTG ACTTT), raZor Prob: TTTTCTCAGATTCAGTAAAATCAGG CAGAATAGATGA (anti: CATCTATTCTGCCTGATTTTACT GAATCTGAGAAAA) with Rotor-Gene® Q) (QIAGEN GmbH, Hilden, Germany) under the conditions shown in table 2. After PCR, High Resolution Melting (HRM)-curve analysis and genotyping were performed by fluorescent signal detection with Rotor-Gene® Q 1.7 software (fig. 1). Positive and negative controls (homozygous wild type, heterozygous, and homozygous mutant) were always included in each assay.
Enzyme activation Touchdown cycles × 6 Denaturation Reduce by 1.0°C/cycle Cycling × 50 Denaturation Data collection
08 min
95
15 s 45 s
95 66–61
15 s 45 s
95 60
Measurements of Biochemical Parameters Serum 1,25D levels were measured with radioimmunoassay (RIA) method using commercial kits (Biosource Europe S.A., Niveles, Belgium). Minimal detectable 1,25D level was 1.65 pg/ml and reference interval was 19.6–54.3 pg/ml. Serum intact parathormone (iPTH) levels were measured with electrochemiluminescence
Klotho F352V Polymorphism in Renal Transplant Recipients
using modular immunoassay analyzer (Roche Diagnostics GmbH, Mannheim, Germany). Plasma FGF23 levels were measured with ELISA using ALPCO Diagnostics kits (Salem, NH 03079). Serum levels of creatinine, BUN, phosphorus and calcium were measured with Roche Modular P otoanalyzer (Roche Diagnostics GmbH, Mannheim, Germany) using modified Jaffe, kinetic UV urea, phosphomolibdate colorimetric and o-kresolftalein endpoint colorimetric methods, respectively. The estimated glomerular filtration rate (GFR) value was calculated using the Chronic Kidney Disease Epidemiology Collaboration (CKD-EPI) formula [27]. Bone Mineral Density Measurements Whole-body and femur total bone mineral density (BMD) was evaluated with DEXA measurements (GE-LUNAR DPX PRO, General Electric Company, Madison, Wis, USA). BMD
Pharmacology 2015;95:271–278 DOI: 10.1159/000398812
273
Downloaded by: University of Pittsburgh 198.143.32.65 - 1/28/2016 7:10:28 AM
F352V (rs9536314) polymorphism analysis
Age, years Male, n (%) Female, n (%)
RT recipients (n = 25)
Control subjects (n = 26)
40.5±12.0 17 (68) 8 (32)
45.0±7.0 12 (46) 14 (54)
Table 4. Demographic characteristics of renal transplant recipients (n = 25) included in the study
Time on dialysis, months Cause of chronic kidney disease, n (%) Hypertension Chronic glomerulonephritis Diabetes mellitus Amyloidosis Other causes Etiology unknown Replacement therapy, n (%) Peritoneal dialysis before transplantation Hemodialysis before transplantation Preemptive transplantation Type of renal transplantation, n (%) Living donor Cadaver
17.56±3.96 7 (28) 2 (8) 1 (4) 1 (4) 4 (16) 10 (40) 5 (20) 15 (60) 5 (20) 25 (100) 0 (0)
Table 5. Demographics of the renal transplant (RT) recipients with (FV) and without (FF) Klotho F352V polymorphism
RT recipients, n Age, years Male, n (%) Female, n (%)
FV sub-group
FF sub-group
11 37.3±13.4 8 (73) 3 (27)
14 43.1±10.5 9 (64) 5 (36)
scores lower than –2.5 standard deviation compared to young reference group were considered osteoporosis; between –1 and –2.5, osteopenia; and more than –1, normal. BMD was evaluated according to the T-score on the basis of World Health Organization (WHO) criteria, which defines T-score as standard deviation of the comparison of bone mass with the mean peak value in young adult reference population and Z-score as relative to mean normal values for subjects of the same age and gender [28]. FRAX Score FRAX is diagnostic tool developed by the WHO Collaborating Centre for Metabolic Bone Diseases at Sheffield University to evaluate the 10-year probability of bone fracture risk. It integrates clinical risk factors with the BMD at the femoral neck to calculate the
274
Pharmacology 2015;95:271–278 DOI: 10.1159/000398812
10-year probability of hip fracture [29]. The online tool using the UK algorithm was used to calculate FRAX scores. All patients were considered to have a secondary cause of osteoporosis. Following calculation of FRAX scores, patients’ risk was stratified using the age-adjusted National Osteoporosis Guideline Group recommendations on the basis of clinical factors alone and FRAX scores were then re-determined with BMD (g/cm2) included [29]. Statistical Analyses Data are presented as means ± SD, n and %. Unpaired Student’s t-tests were used to compare differences between RT recipients and the control group. Significance of continuous variables without normal distributions was compared using the Mann-Whitney U test. FGF23 and iPTH levels did not reveal a Gaussian distribution and were, therefore, transformed into log 10-values. Correlations between numeric parameters were assessed using Spearman rank order correlations. p < 0.05 was considered statistically significant for all tests.
Results
There were no significant differences in age and gender between RT recipients and control subjects (table 3). Demographic characteristics of the RT recipients were given in table 4. Bone losses in control subjects and RT recipients, respectively, were as follows: 31% (7 osteopenia) vs. 64% (4 osteoporosis, 12 osteopenia) with wholebody T-score; 23% (6 osteopenia) vs. 68% (3 osteoporosis, 14 osteopenia) with femur total T-score. RT recipients were divided into two sub-groups based on the presence (heterozygous polymorphism, FV subgroup, n = 11) or absence (wild, FF sub-group, n = 14) of KL F352V (rs9536314) polymorphism. There were no homozygous mutant patients. Demographic information of the sub-groups was presented in table 5. Height, weight and body mass index (BMI) did not differ significantly between RT recipients and control subjects. Time on dialysis and time after renal transplantation were similar in FV and FF sub-groups of RT recipients (table 6). Serum creatinine, BUN, GFR, calcium, phosphorus, iPTH and FGF23 levels did not differ significantly between sub-groups of RT recipients. Creatinine was significantly high and GFR and phosphorus values were significantly low in both (FF and FV) sub-groups of RT recipients compared to control subjects. FGF23 levels did not differ significantly between control subjects and RT recipients. On the other hand, iPTH levels of the RT recipients (both FF and FV sub-groups) were significantly higher than the control group. RT recipients with FV phenotype had significantly lower levels of 1,25D compared to both recipients with FF phenotype and control subOzdem/Yılmaz/Ozdem/Donmez/ Cetinkaya/Suleymanlar/Ersoy
Downloaded by: University of Pittsburgh 198.143.32.65 - 1/28/2016 7:10:28 AM
Table 3. Distribution of subjects according to age and gender in renal transplant (RT) recipients and control subjects
Table 6. Measured parameters in renal transplant (RT) recipients with (FV) or without (FF) Klotho gene F352V (rs9536314) polymor-
phism and control subjects Parameters
Height, cm Weight, kg BMI, kg/m2 Time on dialysis, months Range Time after transplantation, months Range Creatinine, mg/dl BUN, mg/dl GFR, ml/min/1.73 m2 Ca, mg/dl Pi, mg/dl log iPTH log FGF23 1,25D, pg/ml Whole-body BMD, g/cm2 Whole-body T-score Whole-body Z-score Femur total BMD, g/cm2 Femur total T-score Femur total Z-score FRAX score
RT FV sub-group
RT FF sub-group
Control group
p value
169.60±8.12 68.70±10.72 23.81±2.85 41.2±46.4 0–159 17.3±4.4 13–21 1.20±0.51 16.18±4.93 82.82±25.25 9.81±0.58 3.24±0.94 1.834±0.228 1.74±0.530 17.58±18.38 1.114±0.082 –1.00±1.02 –0.83±1.07 0.870±0.098 –1.68±1.35 –1.35±0.79 7.06±1.91
165.90±6.41 73.07±9.85 26.23±3.82 31.9±40.7 0–137 17.9±3.4 12–24 1.21±0.31 16.43±5.36 69.93±15.93 9.55±0.64 3.12±0.83 1.878±0.381 1.626±0.370 44.91±24.68 1.097±0.100 –1.13±1.26 –0.87±1.36 0.900±0.168 –1.29±1.26 –0.82±1.22 7.06±3.33
168.00±8.70 70.62±11.24 24.98±3.16
0.25 0.32 0.061 0.599
FV vs. FF
FV vs. control
FF vs. control
0.60 0.64 0.31
0.40 0.48 0.15
0.695 0.84±0.15 13.85±2.93 95.42±10.90 9.58±0.33 3.81±0.41 1.547±0.131 1.794±0.280 28.24±12.13 1.171±0.126 –0.51±0.86 –0.26±1.04 1.004±0.109 –0.13±0.84 0.27±0.80 3.14±0.86
0.92 0.90 0.132 0.292 0.73 0.735 0.549 0.0055 0.65 0.77 0.94 0.602 0.378 0.23 0.99
0.003 0.081 0.039 0.134 0.014
