Developmental and Comparative Immunology 52 (2015) 236–244
Contents lists available at ScienceDirect
Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i
Involvement of Relish gene from Macrobrachium rosenbergii in the expression of anti-microbial peptides Yan-Ru Shi a, Min Jin b, Fu-Tong Ma a, Ying Huang a, Xin Huang a, Jin-Ling Feng a, Ling-Ling Zhao a, Yi-Hong Chen c, Qian Ren a,* a Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China b State Key Laboratory Breeding Base of Marine Genetic Resource, Third Institute of Oceanography, SOA, Xiamen 361005, China c MOE Key Laboratory of Aquatic Product Safety/State Key Laboratory of Biocontrol, School of Marine Sciences, Sun Yat-sen University, Guangzhou, China
A R T I C L E
I N F O
Article history: Received 10 April 2015 Revised 18 May 2015 Accepted 20 May 2015 Available online 27 May 2015 Keywords: Macrobrachium rosenbergii Relish Antimicrobial peptide Innate immunity
A B S T R A C T
Relish is an NF-kB transcription factor involved in immune-deficiency (IMD) signal pathway. In this study, a Relish gene (MrRelish) was identified from Macrobrachium rosenbergii. The full length of MrRelish comprises 5072 bp, including a 3510 bp open reading frame encoding a 1169 bp amino acid protein. MrRelish contains a Rel homology domain (RHD), a nucleus localization signal, an IκB-like domain (6 ankyrin repeats), and a death domain. Phylogenetic analysis showed that MrRelish and other Relish from crustaceans belong to one group. MrRelish was expressed in all detected tissues, with the highest expression level in hemocytes and intestines. MrRelish was also upregulated in hepatopancreas at 6 h after Vibrio anguillarum challenge. The over-expression of MrRelish could induce the expression of antimicrobial peptides (AMPs), such as Drosophila Metchnikowin (Mtk), Attacin (Atta), Drosomycin (Drs), and Cecropin (CecA) and shrimp Penaeidin (Pen4). The RNAi of MrRelish in gills showed that the expression of crustin (cru) 2, Cru5, Cru8, lysozyme (Lyso) 1, and Lyso2 was inhibited. However, the expression of anti-lipopolysaccharide factor (ALF) 1 and ALF3 did not change when MrRelish was knocked down. These results indicate that MrRelish may play an important role in innate immune defense against V. anguillarum in M. rosenbergii. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Macrobrachium rosenbergii, the giant freshwater prawn, is an important species cultured in China and other Southeast Asian countries (Roustaian et al., 2000). Culture of prawns is seriously threatened by spiroplasma MR-1008 (Liang et al., 2011), viruses (Qian et al., 2003), and bacteria, such as Vibrio (Jayaprakash et al., 2006; Sharshar and Azab, 2008). M. rosenbergii, similar to other crustaceans, relies mainly on innate immunity to protect itself from the attack of foreign pathogens (Loker et al., 2004). Production of anti-microbial peptides (AMPs) is an important humoral immunity, which is controlled by Toll and immune-deficiency (IMD) signal pathways in Drosophila melanogaster (Hoffmann, 2003). Signal pathway activation leads to nuclear factor-kappa B (NF-κB) translocation into the nucleus and finally induces the expression of immune effector molecules, such as AMPs (Lemaitre and Hoffmann, 2007).
* Corresponding author. Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China. Tel.: +86 25 85891955; fax: + 25-85891955. E-mail address: [email protected] (Q. Ren). http://dx.doi.org/10.1016/j.dci.2015.05.008 0145-305X/© 2015 Elsevier Ltd. All rights reserved.
NF-κB is an important nuclear transcription factor involved in innate immune responses, inflammatory responses, cell proliferation, differentiation, and apoptosis (Ghosh et al., 1998). NF-κB presents a common structure called Rel homology domain (RHD), which is involved in DNA binding, dimerization, and interaction with the inhibitor κB (IκB). In mammals and Drosophila, NF-κB could be divided into two different classes: I and II. Class I consists of mammal p105 and p100 and Drosophila Relish, which contain C-terminal IκBlike domain (several ankyrin repeats, ANKs) that inhibit NF-κB molecules. Class II comprises mammal RelA, RelB, and c-Rel and Drosophila Dorsal and Dif, which present C-terminal transactivation domains (Ghosh et al., 1998; Lemaitre and Hoffmann, 2007). Relish is required in the IMD pathway to activate the gene expression of AMPs (Hedengren et al., 1999). Upon stimulation, Relish is activated and cleaved into the N-terminal RHD and C-terminal ANKs. RHD subsequently translocates into the nucleus and activates the expression of AMPs, such as cecropin (Cec) A1, attacin (Atta), and diptericin (Cornwell and Kirkpatrick, 2001). Relish was also found in other insects, such as Bombyx mori (Tanaka et al., 2007). In mollusks, Relish was found in Pinctada fucata and PfRelish was involved in the immune response to Vibrio alginolyticus (Huang et al., 2012). Relish was also identified in Biomphalaria glabrata (Zhang and Coultas, 2011). In recent years, crustacean Relishes were also reported. The IMD pathway could respond to yellow head virus (YHV) infection,
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
and YHV activation could induce PmRelish in Penaeus monodon (Visetnan et al., 2015). LvRelish from Litopenaeus vannamei is required for white spot syndrome virus (WSSV) replication (Qiu et al., 2014). A number of genes are regulated by FcRelish in Fenneropenaeus chinensis (Wang et al., 2013), and silencing of FcRelish can significantly change the expression of AMP genes (Li et al., 2009). Moreover, penaeidin 4 (Pen4) gene is regulated by LvRelish (Huang et al., 2009). Although 2 long Relishes and 3 small Relishes were reported in shrimp, Relish has not been identified from prawns or crayfish. In this study, a relish gene (MrRelish) was identified from the giant freshwater prawns, M. rosenbergii. MrRelish in gills was upregulated by Vibrio anguillarum challenge. The over-expression of MrRelish in Drosophila Schneider cell line 2 (S2) and RNAi of MrRelish in M. rosenbergii showed that AMP genes were regulated by MrRelish. These results indicate that MrRelish may play important roles in the innate immunity of prawns via regulation of the AMP genes. 2. Materials and methods 2.1. Prawns, immune challenge, RNA extraction The giant freshwater prawns were purchased from an aquaculture market in Nanjing, Jiangsu Province. The prawns were acclimatized in freshwater tanks at room temperature (25 °C) in our laboratory. After 24 h of culture, the prawns were divided into control group and V. anguillarum group. In the V. anguillarum group (20 prawns), about 100 μl of bacterial suspension (about 3 × 107 cells) was injected into the abdominal segment of M. rosenbergii by using a 1 ml syringe. Gills were extracted from the prawns challenged with bacteria at 2, 6, 12, and 24 h. Hemolymph was extracted from healthy prawns with an equal volume of 20 mM EDTA as the anticoagulant and was then centrifuged for 10 min at 800 × g at 4 °C. The isolated hemocytes were immediately used for RNA extraction. Heart, hepatopancreas, gill, stomach, and intestine were also extracted from healthy prawns for RNA extraction. 2.2. Total RNA isolation and cDNA synthesis Total RNA was extracted from the samples by using an RNA pure high-purity total RNA rapid extraction kit (Spin-column; Bioteke, Beijing, China) according to the manufacturer’s protocol. RNA quality was assessed through electrophoresis for 15 min on 1% agarose gel, and RNA concentration was measured using NanoDrop 2000. Firststrand cDNA for qRT-PCR was synthesized with the Oligo dT Primer by using the PrimeScript First-Strand cDNA synthesis kit (Takara, Dalian, China). The 3′ RACE-Ready cDNA was synthesized for 3′ fragment cloning by using the Clontech SMARTer RACE 5′/3′ kit (Takara, Dalian). The detailed procedures were performed according to the protocol. 2.3. Cloning of MrRelish, sequence analysis, and phylogenetic analysis When searching for the transcriptome data of hepatopancreas of prawns, an EST sequence with 5′ untranslated region (UTR) similar to Relish was found. A gene specific forward primer (MrRelishF) was designed to clone the 3′ fragment of MrRelsih. The Advantage 2 PCR kits were used to clone the 3′ end of MrRelish. The reaction components included 5 μl of universal primer mix (UPM), 5 μl of 10 × Advantage 2 PCR buffer, 1 μl of 50 × dNTP, 1 μl of 50 × Advantage 2 DNA polymerase, 2.5 μl of 3′ RACE-Ready cDNA, 1 μl of MrRelishF, and 34.5 μl of H2O. PCR conditions were as follows: five cycles at 94 °C for 30 s and 72 °C for 3 min; five cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 3 min; and 20 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 3 min. Similarity analysis was performed with the BLASTX algorithm (http://blast.ncbi.nlm.nih
237
.gov/blast.cgi). Gene translation and prediction of the deduced protein were conducted with ExPASy (http://web.expasy.org/translate/). Motif and domain prediction was performed with SMART (http://smart .embl-heidelberg.de/). MEGA 5.05 was used to construct the phylogenetic tree (Tamura et al., 2011). 2.4. Real-time PCR analysis of mRNA expression of MrRelish Expression of MrRelish at mRNA levels in the hemocytes, heart, hepatopancreas, gills, stomach, and intestine were analyzed using real-time fluorescence quantitative PCR (qRT-PCR) with primers MrRelish-RT-F and MrRelish-RT-R. qRT-PCR was also performed to analyze the expression pattern of MrRelish at mRNA level in the gills of M. rosenbergii after V. anguillarum challenge at 2, 6, 12, 24 h. qRTPCR was performed using 2 × SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) (Takara, Dalian, China) according to the manufacturer’s instructions. The GAPDH was amplified for internal standardization with the primers MrGAPDH-RT-F and MrGAPDH-RT-R). The detailed methods were according to the previous study (Zhang et al., 2014). The 2−ΔΔCt method was adapted to analyze the expression pattern of MrRelish (Livak and Schmittgen, 2001). Unpaired sample t-test was used for statistical analysis, and statistical significance was found if p < 0.05. 2.5. Plasmid construction A pair of primers (PacMrRHD-F and PacMrRHD-R) was designed to amplify the fragment corresponding to the RHD domain
Table 1 Sequences of the primers used in the study. Primers name
Sequences (5′–3′)
Usage
3′-CDS primer A
AAGCAGTGGTATCAACGCAGAGTAC (T)30VN CTAATACGACTCACTATAGGGCAAGC AGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC ATGTATGGTCATCACAGAATAGCCG TATGGTACCATGATCCAAATACTCAA ACAACCAC TTAGGGCCCTCGAGATTGTAAACAA TGTCTGAG GCGTAATACGACTCACTATAGGAGC AGTTTTGAATTTAT GCGTAATACGACTCACTATAGGCCC GAGATGGGAATTCA GCGTAATACGACTCACTATAGGTGG TCCCAATTCTCGTGGAAC GCGTAATACGACTCACTATAGGCTT GAAGTTGACCTTGATGCC ACCTAAGCAACCCGTGGA CTGGAGCGTAGCAGCACT TTGCTCCGTTGACCAGAAG GGCCGCCAATAATAATACT TCCAAATCCTCCTTCAAAAT GGAAACTTCAGGAAAATCAA TGGTGGAGGTGGGATTTTC TCGCTCTCGCAGCAGTAAG GGAAGGCAGACATTGGACC GCAGACGCAGAAGGAAGG GAAAGCCTTCCAGTCCG TGATTGTGCCGTTGAGTAA CCGTCATCTTCGCCTTGGTT TGCCTGTTTGGGTCATCGTTC TGTAAACAAGAGAGACCACGCAT CCGCAGAAATAGGACCCATC CTCCTTCAGCCAGACAAT CTCAACAACCGTACCCTAA AGGTCTTCAACGAGATGAAG GGAGTACTTCTCCAAGTTCA
For 3′RACE
UPM long Short MrRelishF PacMrRHD-F PacMrRHD-R MrRelish-iF MrRelish-iR GFP-iF GFP-iR MrCru2-RT-F MrCru2-RT-R MrCru4-RT-F MrCru4-RT-R MrCru5-RT-F MrCru5-RT-R MrCru8-RT-F MrCru8-RT-R MrALF1-RT-F MrALF1-RT-R MrALF3-RT-F MrALF3-RT-R MrLyso1-RT-F MrLyso1-RT-R MrLyso2-RT-F MrLyso2-RT-R MrRelish -RT-F MrRelish -RT-R MrGAPDH-RT-F MrGAPDH-RT-R
For over-expression
For RNAi
For qRT-PCR
238
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
of MrRelish. After digesting with Kpn I and Apa I (Takara, Japan), the RHD fragment was ligated into the pAc5.1/V5–His B vector (Invitrogen, USA). The positive clone was sequenced to ensure the correct insertion. 2.6. Cell culture and transfection Drosophila Schneider 2 (S2) cells were maintained in Drosophila serum-free medium (Invitrogen, USA) supplemented with 10% fetal bovine serum (Invitrogen) at 27 °C. S2 cells were first seeded overnight, and plasmids were transfected using the Cellfectin II reagent (Invitrogen) according to the manufacturer’s instructions. For dual-luciferase reporter assays, S2 cells in each well (96-well plates, TPP, Switzerland) were transfected with 0.3 μg of expression plasmids, 0.2 μg of reporter gene plasmids, and 0.02 μg of pRL-TK Renilla luciferase plasmid (Promega, USA). The pRL-TK Renilla luciferase plasmid alone was transfected as the internal control. The reporter gene plasmids were constructed using the promoter sequences of Drosophila attacin A (Atta), drosomycin (Drs), cecropin A (Cec A), and metchnikowin (Mtk) and L. vannamei Pen4. All assays were performed with three independent transfections. At 48 h post-transfection, firefly and Renilla luciferase activities were measured using a Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. The detailed methods were according to a previous paper (Huang et al., 2009).
2.7. RNA interference and the expression patterns of AMPs To prepare dsRNA, we designed MrRelish-specific primers (MrRelish-iF, MrRelish-iR) with T7 promoter sequence at the 5′ end of each primer to amplify the fragment of MrRelish (about 500 bp). Another pair of primers (GFP-iF, GFP-iR) was used to amplify the fragment of green fluorescent protein (GFP). The obtained fragments were used as template for dsRNA production. dsRNA was synthesized with T7 polymerase (Ferments, USA) by using a previously described method (Wang et al., 2013). Twelve healthy shrimps were divided into three groups. The first group was the control group, the second was first injected with 15 μg of GFP dsRNA (dsGFP), and the third group was injected with 15 μg of dsMrRelish. After 24 h, another 15 μg of dsGFP in 100 μl of V. anguillarum suspension or 15 μg of dsMrRelish in 100 μl of V. anguillarum suspension was injected into the prawns. After another 24 h post injection, gill tissues were extracted from three prawns for RNA extraction. RNA was then transcribed to cDNA by using the same methods in Section 2.2 for gene expression analysis (Table 1). After RNAi, the expression levels of mRNA were determined by qRT-PCR. Crustin (Cru) 2, Cru5, Cru4, Cru8, anti-lipopolysaccharide factor (ALF) 1, ALF3, lysozyme (Lys) 1, and Lys2 were analyzed in the gills. The primers of genes were as follows: MrCru2-RT-F and MrCru2RT-R, MrCru4-RT-F and MrCru4-RT-R, MrCru5-RT-F and MrCru5-RTR, MrCru8-RT-F and MrCru8-RT-R, MrALF1-RT-F and MrALF1-RT-R,
Fig. 1. (A) The amino acid sequences of MrRelish. The RHD domain was shaded in red, IPT domain shaded in green, 6 ANKs were in blue, a nucleus localization signal was marked with deep red and a death domain was in bold. (B) Schematic diagrams of MrRelish protein predicted by SMART analysis. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
MrALF3-RT-F and MrALF3-RT-R, MrLyso1-RT-F and MrLyso1-RT-R, MrLyso2-RT-F and MrLyso2-RT-R. 3. Results 3.1. cDNA cloning and sequence analysis The full-length cDNA sequence of MrRelish contains 5072 bp, including a 3510 bp open reading frame (ORF) encoding a 1169 bp amino acid protein, with a 1562 bp 3′ UTR. The MrRelish protein
239
contains one RHD, one IPT (Ig-like, plexins, transcription factors), six ANKs, a nucleus localization signal, and a death domain (Fig. 1A and 1B). MrRelish presents a molecular weight of 129.76 kDa and a pI of 5.32. The RHD and IPT domains of crustacean Relishes are highly conserved (Fig. 2). BLASTP analysis showed that MrRelish shared 68% identity with LvRelish from L. vannamei and PmRelish from P. monodon, and 65% identity with EsRelish from Eriocheir sinensis. Multiple alignment analysis showed that Relish proteins from crustaceans contain one Gln-rich region and one Glu-rich region (Fig. 2). The phylogenetic tree showed that crustacean Relishes were
Fig. 2. Multiple alignments of MrRelish protein with Relishes from crustaceans. Asterisks under the sequences indicate the identical amino acids of different relish proteins.
240
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
Fig. 2. (continued)
clustered into one group, and insect Relishes were grouped into another cluster (Fig. 3). CrRelish from Carcinoscorpius rotundicauda that belongs to Merostomata was classified separately (Fig. 3).
anguillarum challenge. MrRelish was upregulated to the highest level at 6 h and subsequently downregulated at 12 and 24 h. The expression level of MrRelish at 12 and 24 h was higher than that of the control (Fig. 4B).
3.2. Tissue distribution and expression patterns of MrRelish at mRNA level 3.3. Over-expression of MrRHD in Drosophila S2 cell lines MrRelish was mainly expressed in hemocytes, intestine, gills, and stomach, but it could also be detected in heart and hepatopancreas at a relatively low expression level (Fig. 4A). qRT-PCR analysis showed that MrRelish in gills was down-regulated at 2 h after V.
The present study demonstrated that the over-expression of MrRHD could activate the promoters of Drosophila and shrimp AMP genes. MrRHD induced the promoter activities of Mtk, Atta, Drs, Cec
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
241
Fig. 2. (continued)
A, and shrimp Pen4 by about 2.6-, 4.2-, 3.6-, 3.7-, and 3.3-fold, respectively (Fig. 5).
interfered. Cru4, ALF1, and ALF3 were not regulated by MrRelish (Fig. 7).
3.4. RNAi of Relish in gills and the expression of AMP genes
4. Discussion
To investigate the regulated genes of MrRelish, we performed RNAi experiments. In gills, MrRelish showed evident upregulation in prawns challenged with dsGFP plus V. anguillarum at 24 h. MrRelish dsRNA (dsMrRelsih) could down-regulate the expression of MrRelish (Fig. 6). After MrRelish knockdown, eight genes (Cru2, Cru4, Cru5, Cru8, ALF1, ALF3, Lys1, Lys2) were selected as probable effector genes. The results showed that the expression of five genes (Cru2, Cru5, Cru8, Lyso1, and Lyso2) was down-regulated when MrRelish was
The Toll and IMD pathways are two major signal pathways involved in production of antimicrobial peptides in invertebrates. Dorsal is the transcription factor of the Toll pathway, whereas the Relish transcription factor is involved in the IMD pathway (Uvell and Engström, 2007). In the present study, MrRelish was identified from the giant freshwater prawn M. rosenbergii. MrRelish contains RHD, IPT, and ANK domains and represents the long form of Relish. In shrimp, both long and short forms of Relish were found.
242
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
Fig. 3. Phylogenetic analysis of MrRelish and other representative Relish. NtRelish: Relish from Nasutitermes triodiae (AAZ08471.1); NwRelish: relish from Nasutitermes walker (AAZ08469.1); NgRelish: relish from Nasutitermes graveolus (AAZ08468.1); TpRelish: relish from Tumulitermes pastinator (AAZ08472.1); NlRelish: relish from Nasutitermes longipennis (AAZ08473.1); NmRelish: relish from Nasutitermes magnus (AAZ08474.1); NeRelish: relish from Nasutitermes exitiosus (AAZ08470.1); NcRelish: relish from Nasutitermes comatus (AAZ08478.1); NfRelish: relish from Nasutitermes fumigatus (AAZ08477.1); NdRelish: relish from Nasutitermes dixoni (AAZ08475.1); NpRelish: relish from Nasutitermes pluvialis (AAZ08476.1); DrRelish: relish from Drepanotermes rubriceps (AAZ08479.1); TcRelish: relish from Tribolium castaneum (EEZ97717.1); PcRelish: relish from P. carinicauda (AGR39579.1); EsRelish: relish from E. sinensis (ADM14334.1); FcRelish: relish from F. chinensis (ACJ36224.1); LvRelish: relish from L. vannamei (ABR14713.1); PmRelish: relish from P. monodon (AFH66691.1); CrRelish: relish from C. rotundicauda (ABC75034.1).
In L. vannamei, LvRelish and its shorter isoform sLvRelish were identified and sLvRelish only contains the RHD and IPT domains (Huang et al., 2009). The short form of Relish with the RHD and IPT domains was also identified in the Chinese shrimp F. chinensis (Li et al., 2009). In P. monodon, a long relish was found (Visetnan et al., 2015). Therefore, at least two isoforms of Relish have been speculated to exist in shrimp. Tissue distribution analysis showed that MrRelish was mainly expressed in hemocytes and intestine. The highest expression level of FcRelish detected in hemocytes and lymphoid organ may indicate its possible roles in shrimp innate immunity (Li et al., 2009). Hemocytes are very important immune-related organs (Li et al., 2009). The intestine of Drosophila could generate powerful innate immune and inflammatory responses (Ayyaz and Jasper, 2013). Hence, the main expression of MrRelish in hemocytes and intestine may suggest its possible roles in innate immune defense. MrRelish was upregulated in gills after V. anguillarum challenge. FcRelish also increased to the highest level at 1 h after Vibrio challenge (Li et al., 2009). PfRelish from P. fucata was obviously upregulated at 12 h after Vibrio challenge (Huang et al., 2012). Relish is the transcription factor of the IMD signal pathway, which is activated in response to gram-negative bacteria (Takehana et al., 2004). In F. chinensis and Procambarus clarkii, IMD was involved in innate immunity against gram-negative bacteria (Lan et al., 2013). Thus, the upregulation of MrRelish upon Vibrio challenge may suggest its roles in innate immunity against gram-negative bacteria. In the present research, Relish was also reported to have roles in antiYHV immune defense and YHV could activate PmRelish (Visetnan
Fig. 4. (A) Analysis of tissue distribution of MrRelish in hemocytes, heart, hepatopancreas, gill, stomach and intestine of the healthy M. Rosenbergii. (B) Expression pattern of MrRelish in the gills of M. rosenbergii at 0, 2, 6, 12, 24 h after V. anguillarum challenge. Asterisks indicate significant differences (*P < 0.05, **P < 0.01) compared with values of the control. Error bars represent mean ± S.D. of the three independent PCR amplifications and quantifications.
et al., 2015). Moreover, WSSV replication was partially dependent on LvRelish (Qiu et al., 2014). In conclusion, Relish was involved in both anti-bacterial and anti-viral innate immune defenses. IMD pathway activation induces the production of AMP genes. In this study, the over-expression and RNAi results both indicated that MrRelish was associated with AMP production. The overexpression of MrRHD could induce 4 Drosophila AMPs and one shrimp AMP. Both LvRelish and its RHD domain transactivated Pen4 (Huang et al., 2009). RHD is the activated form of Relish, and the recombinant intact LvRelish was cleaved into two fragments in S2 cells. Hence, the over-expression of RHD or intact Relish both activated the expression of AMPs. The RNAi of MrRelish in gills inhibited the expression of 3 Crus and 2 lysos. Pen5 expression was regulated by FcRelish (Li et al., 2009). ALF was highly suppressed in L.
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
243
Fig. 5. Relative induction of luciferase activity by MrRHD (RHD domain of MrRelish). The bars indicate the mean ± SD of the luciferase activities (n = 3). The statistical significance was calculated by Student’s t-test (*p < 0.05).
Fig. 6. Analysis of the expression level of MrRelish in gills from the freshwater prawns (normal group, dsGFP + 24 h V. anguillarum challenge group, dsMrRelish + 24 h V. anguillarum challenge group). Identical letters are not significant difference (p > 0.05), while different letters indicate significant difference among groups (p < 0.05).
vannamei when LvIMD was silenced (Hou et al., 2014). In the present study, ALF expression was not regulated by MrRelish and PcIMD from P. clarkii or MjIMD from Marsupenaeus japonicus knockdown affected the expression of Crus, ALFs, and lysos (Lan et al., 2013). Therefore, MrRelish was involved in the production of AMP genes. In conclusion, a Relish gene was identified from the giant freshwater prawns. The gene was mainly expressed in hemocytes and intestine and upregulated after V. anguillarum challenge. The overexpression or RNAi experiments both suggested the roles of this gene in production of AMP genes. MrRelish was speculated to be involved in anti-gram-negative bacteria innate immune defense. Acknowledgments The current study was supported by the National Natural Science Foundation of China (Grant No. 31101926), the Natural Science
Fig. 7. Analysis of the expression of AMP genes including MrCru2, MrCru4, MrCru5, MrCru8, MrALF1, MrALF3, MrLyso1 and MrLyso2 in gills from the giant freshwater prawns with MrRelish knockdown. The experiments were divided into 3 groups (normal group, dsGFP + 24 h V. anguillarum challenge group, dsMrRelish + 24 h V. anguillarum challenge group). Identical letters are not significant difference (p > 0.05), while different letters indicate significant difference among groups (p < 0.05).
Foundation of Jiangsu Province (BK20131401), Natural Science Fund of Colleges and Universities in Jiangsu Province (13KJB240002, 14KJA240002), NSFC for Talents Training in Basic Science (J1103507), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
244
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
References Ayyaz, A., Jasper, H., 2013. Intestinal inflammation and stem cell homeostasis in aging Drosophila melanogaster. Front. Cell Infect. Microbiol. 3, 98. Cornwell, W.D., Kirkpatrick, R.B., 2001. Cactus-independent nuclear translocation of Drosophila RELISH. J. Cell. Biochem. 82, 22–37. Ghosh, S., May, M.J., Kopp, E.B., 1998. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16, 225–260. Hedengren, M., Asling, B., Dushay, D.S., Ando, I., Ekengren, S., Wihlborg, M., et al., 1999. Relish, a central factor in the control of humoral but not cellular immunity in Drosophila. Mol. Cell 4, 827–837. Hoffmann, J.A., 2003. The immune response of Drosophila. Nature 426, 33–38. Hou, F., He, S., Liu, Y., Zhu, X., Sun, C., Liu, X., 2014. RNAi knock-down of shrimp Litopenaeus vannamei Toll gene and immune deficiency gene reveals their difference in regulating antimicrobial peptides transcription. Dev. Comp. Immunol. 44, 255–260. Huang, X.D., Yin, Z.X., Liao, J.X., Wang, P.H., Yang, L.S., Ai, H.S., et al., 2009. Identification and functional study of a shrimp Relish homologue. Fish Shellfish Immunol. 27, 230–238. Huang, X.D., Liu, W.G., Guan, Y.Y., Shi, Y., Wang, Q., Zhao, M., et al., 2012. Molecular cloning and characterization of class I NF-κB transcription factor from pearl oyster (Pinctada fucata). Fish Shellfish Immunol. 33, 659–666. Jayaprakash, N.S., Pai, S.S., Philip, R., Singh, I.S., 2006. Isolation of a pathogenic strain of Vibrio alginolyticus from necrotic larvae of Macrobrachium rosenbergii (de Man). J. Fish Dis. 29, 187–191. Lan, J.F., Zhou, J., Zhang, X.W., Wang, Z.H., Zhao, X.F., Ren, Q., et al., 2013. Characterization of an immune deficiency homolog (IMD) in shrimp (Fenneropenaeus chinensis) and crayfish (Procambarus clarkii). Dev. Comp. Immunol. 41, 608–617. Lemaitre, B., Hoffmann, J., 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. Li, F., Yan, H., Wang, D., Priya, T.A., Li, S., Wang, B., et al., 2009. Identification of a novel relish homolog in Chinese shrimp Fenneropenaeus chinensis and its function in regulating the transcription of antimicrobial peptides. Dev. Comp. Immunol. 33, 1093–1101. Liang, T., Li, X., Du, J., Yao, W., Sun, G., Dong, X., 2011. Identification and isolation of a Spiroplasma pathogens from diseased freshwater prawns, Macrobrachium rosenbergii, in China: a new freshwater crustacean host. Aquaculture 318, 1–6.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25, 402–408. Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T.B., 2004. Invertebrate immune systems not homogeneous, not simple, not well understood. Immunol. Rev. 198, 10–24. Qian, D., Shi, Z., Zhang, S., Cao, Z., Liu, W., Li, L., 2003. Extra small virus-like particles (XSV) and nodavirus associated with whitish muscle disease in the giant freshwater prawn, Macrobrachium rosenbergii. J. Fish Dis. 26, 521–527. Qiu, W., Zhang, S., Chen, Y.G., Wang, P.H., Xu, X.P., Li, C.Z., et al., 2014. Litopenaeus vannamei NF-κB is required for WSSV replication. Dev. Comp. Immunol. 45, 156–162. Roustaian, P., Kamarudin, M.S., Bin Omar, H., Saad, C.R., Ahmad, M.H., 2000. Amino acid composition of developing larval freshwater prawn Macrobrachium rosenbergii. J. World Aquac. Soc. 31, 130–136. Sharshar, K.M., Azab, E.A., 2008. Studies on diseased freshwater prawn Macrobrachium rosenbergii infected with Vibrio vulnificus. Pak. J. Biol. Sci. 11, 2092–2100. Takehana, A., Yano, T., Mita, S., Kotani, A., Oshima, Y., Kurata, S., 2004. Peptidoglycan recognition protein (PGRP)-LE and PGRP-LC act synergistically in Drosophila immunity. EMBO J. 23, 4690–4700. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tanaka, H., Matsuki, H., Furukawa, S., Sagisaka, A., Kotani, E., Mori, H., et al., 2007. Identification and functional analysis of Relish homologs in the silkworm, Bombyx mori. Biochim. Biophys. Acta 1769, 559–568. Uvell, H., Engström, Y., 2007. A multilayered defense against infection: combinatorial control of insect immune genes. Trends Genet. 23, 342–349. Visetnan, S., Supungul, P., Hirono, I., Tassanakajon, A., Rimphanitchayakit, V., 2015. Activation of PmRelish from Penaeus monodon by yellow head virus. Fish Shellfish Immunol. 42, 335–344. Wang, D., Li, S., Li, F., 2013. Screening of genes regulated by Relish in Chinese shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 41, 209–216. Zhang, S.M., Coultas, K.A., 2011. Identification and characterization of five transcription factors that are associated with evolutionarily conserved immune signaling pathways in the schistosome-transmitting snail Biomphalaria glabrata. Mol. Immunol. 48, 1868–1881. Zhang, X.W., Wang, X.W., Huang, Y., Hui, K.M., Shi, Y.R., Wang, W., et al., 2014. Cloning and characterization of two different ficolins from the giant freshwater prawn Macrobrachium rosenbergii. Dev. Comp. Immunol. 44, 359–369.
Contents lists available at ScienceDirect
Developmental and Comparative Immunology j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / d c i
Involvement of Relish gene from Macrobrachium rosenbergii in the expression of anti-microbial peptides Yan-Ru Shi a, Min Jin b, Fu-Tong Ma a, Ying Huang a, Xin Huang a, Jin-Ling Feng a, Ling-Ling Zhao a, Yi-Hong Chen c, Qian Ren a,* a Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China b State Key Laboratory Breeding Base of Marine Genetic Resource, Third Institute of Oceanography, SOA, Xiamen 361005, China c MOE Key Laboratory of Aquatic Product Safety/State Key Laboratory of Biocontrol, School of Marine Sciences, Sun Yat-sen University, Guangzhou, China
A R T I C L E
I N F O
Article history: Received 10 April 2015 Revised 18 May 2015 Accepted 20 May 2015 Available online 27 May 2015 Keywords: Macrobrachium rosenbergii Relish Antimicrobial peptide Innate immunity
A B S T R A C T
Relish is an NF-kB transcription factor involved in immune-deficiency (IMD) signal pathway. In this study, a Relish gene (MrRelish) was identified from Macrobrachium rosenbergii. The full length of MrRelish comprises 5072 bp, including a 3510 bp open reading frame encoding a 1169 bp amino acid protein. MrRelish contains a Rel homology domain (RHD), a nucleus localization signal, an IκB-like domain (6 ankyrin repeats), and a death domain. Phylogenetic analysis showed that MrRelish and other Relish from crustaceans belong to one group. MrRelish was expressed in all detected tissues, with the highest expression level in hemocytes and intestines. MrRelish was also upregulated in hepatopancreas at 6 h after Vibrio anguillarum challenge. The over-expression of MrRelish could induce the expression of antimicrobial peptides (AMPs), such as Drosophila Metchnikowin (Mtk), Attacin (Atta), Drosomycin (Drs), and Cecropin (CecA) and shrimp Penaeidin (Pen4). The RNAi of MrRelish in gills showed that the expression of crustin (cru) 2, Cru5, Cru8, lysozyme (Lyso) 1, and Lyso2 was inhibited. However, the expression of anti-lipopolysaccharide factor (ALF) 1 and ALF3 did not change when MrRelish was knocked down. These results indicate that MrRelish may play an important role in innate immune defense against V. anguillarum in M. rosenbergii. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Macrobrachium rosenbergii, the giant freshwater prawn, is an important species cultured in China and other Southeast Asian countries (Roustaian et al., 2000). Culture of prawns is seriously threatened by spiroplasma MR-1008 (Liang et al., 2011), viruses (Qian et al., 2003), and bacteria, such as Vibrio (Jayaprakash et al., 2006; Sharshar and Azab, 2008). M. rosenbergii, similar to other crustaceans, relies mainly on innate immunity to protect itself from the attack of foreign pathogens (Loker et al., 2004). Production of anti-microbial peptides (AMPs) is an important humoral immunity, which is controlled by Toll and immune-deficiency (IMD) signal pathways in Drosophila melanogaster (Hoffmann, 2003). Signal pathway activation leads to nuclear factor-kappa B (NF-κB) translocation into the nucleus and finally induces the expression of immune effector molecules, such as AMPs (Lemaitre and Hoffmann, 2007).
* Corresponding author. Jiangsu Key Laboratory for Biodiversity & Biotechnology and Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210046, China. Tel.: +86 25 85891955; fax: + 25-85891955. E-mail address: [email protected] (Q. Ren). http://dx.doi.org/10.1016/j.dci.2015.05.008 0145-305X/© 2015 Elsevier Ltd. All rights reserved.
NF-κB is an important nuclear transcription factor involved in innate immune responses, inflammatory responses, cell proliferation, differentiation, and apoptosis (Ghosh et al., 1998). NF-κB presents a common structure called Rel homology domain (RHD), which is involved in DNA binding, dimerization, and interaction with the inhibitor κB (IκB). In mammals and Drosophila, NF-κB could be divided into two different classes: I and II. Class I consists of mammal p105 and p100 and Drosophila Relish, which contain C-terminal IκBlike domain (several ankyrin repeats, ANKs) that inhibit NF-κB molecules. Class II comprises mammal RelA, RelB, and c-Rel and Drosophila Dorsal and Dif, which present C-terminal transactivation domains (Ghosh et al., 1998; Lemaitre and Hoffmann, 2007). Relish is required in the IMD pathway to activate the gene expression of AMPs (Hedengren et al., 1999). Upon stimulation, Relish is activated and cleaved into the N-terminal RHD and C-terminal ANKs. RHD subsequently translocates into the nucleus and activates the expression of AMPs, such as cecropin (Cec) A1, attacin (Atta), and diptericin (Cornwell and Kirkpatrick, 2001). Relish was also found in other insects, such as Bombyx mori (Tanaka et al., 2007). In mollusks, Relish was found in Pinctada fucata and PfRelish was involved in the immune response to Vibrio alginolyticus (Huang et al., 2012). Relish was also identified in Biomphalaria glabrata (Zhang and Coultas, 2011). In recent years, crustacean Relishes were also reported. The IMD pathway could respond to yellow head virus (YHV) infection,
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
and YHV activation could induce PmRelish in Penaeus monodon (Visetnan et al., 2015). LvRelish from Litopenaeus vannamei is required for white spot syndrome virus (WSSV) replication (Qiu et al., 2014). A number of genes are regulated by FcRelish in Fenneropenaeus chinensis (Wang et al., 2013), and silencing of FcRelish can significantly change the expression of AMP genes (Li et al., 2009). Moreover, penaeidin 4 (Pen4) gene is regulated by LvRelish (Huang et al., 2009). Although 2 long Relishes and 3 small Relishes were reported in shrimp, Relish has not been identified from prawns or crayfish. In this study, a relish gene (MrRelish) was identified from the giant freshwater prawns, M. rosenbergii. MrRelish in gills was upregulated by Vibrio anguillarum challenge. The over-expression of MrRelish in Drosophila Schneider cell line 2 (S2) and RNAi of MrRelish in M. rosenbergii showed that AMP genes were regulated by MrRelish. These results indicate that MrRelish may play important roles in the innate immunity of prawns via regulation of the AMP genes. 2. Materials and methods 2.1. Prawns, immune challenge, RNA extraction The giant freshwater prawns were purchased from an aquaculture market in Nanjing, Jiangsu Province. The prawns were acclimatized in freshwater tanks at room temperature (25 °C) in our laboratory. After 24 h of culture, the prawns were divided into control group and V. anguillarum group. In the V. anguillarum group (20 prawns), about 100 μl of bacterial suspension (about 3 × 107 cells) was injected into the abdominal segment of M. rosenbergii by using a 1 ml syringe. Gills were extracted from the prawns challenged with bacteria at 2, 6, 12, and 24 h. Hemolymph was extracted from healthy prawns with an equal volume of 20 mM EDTA as the anticoagulant and was then centrifuged for 10 min at 800 × g at 4 °C. The isolated hemocytes were immediately used for RNA extraction. Heart, hepatopancreas, gill, stomach, and intestine were also extracted from healthy prawns for RNA extraction. 2.2. Total RNA isolation and cDNA synthesis Total RNA was extracted from the samples by using an RNA pure high-purity total RNA rapid extraction kit (Spin-column; Bioteke, Beijing, China) according to the manufacturer’s protocol. RNA quality was assessed through electrophoresis for 15 min on 1% agarose gel, and RNA concentration was measured using NanoDrop 2000. Firststrand cDNA for qRT-PCR was synthesized with the Oligo dT Primer by using the PrimeScript First-Strand cDNA synthesis kit (Takara, Dalian, China). The 3′ RACE-Ready cDNA was synthesized for 3′ fragment cloning by using the Clontech SMARTer RACE 5′/3′ kit (Takara, Dalian). The detailed procedures were performed according to the protocol. 2.3. Cloning of MrRelish, sequence analysis, and phylogenetic analysis When searching for the transcriptome data of hepatopancreas of prawns, an EST sequence with 5′ untranslated region (UTR) similar to Relish was found. A gene specific forward primer (MrRelishF) was designed to clone the 3′ fragment of MrRelsih. The Advantage 2 PCR kits were used to clone the 3′ end of MrRelish. The reaction components included 5 μl of universal primer mix (UPM), 5 μl of 10 × Advantage 2 PCR buffer, 1 μl of 50 × dNTP, 1 μl of 50 × Advantage 2 DNA polymerase, 2.5 μl of 3′ RACE-Ready cDNA, 1 μl of MrRelishF, and 34.5 μl of H2O. PCR conditions were as follows: five cycles at 94 °C for 30 s and 72 °C for 3 min; five cycles at 94 °C for 30 s, 70 °C for 30 s, and 72 °C for 3 min; and 20 cycles at 94 °C for 30 s, 68 °C for 30 s, and 72 °C for 3 min. Similarity analysis was performed with the BLASTX algorithm (http://blast.ncbi.nlm.nih
237
.gov/blast.cgi). Gene translation and prediction of the deduced protein were conducted with ExPASy (http://web.expasy.org/translate/). Motif and domain prediction was performed with SMART (http://smart .embl-heidelberg.de/). MEGA 5.05 was used to construct the phylogenetic tree (Tamura et al., 2011). 2.4. Real-time PCR analysis of mRNA expression of MrRelish Expression of MrRelish at mRNA levels in the hemocytes, heart, hepatopancreas, gills, stomach, and intestine were analyzed using real-time fluorescence quantitative PCR (qRT-PCR) with primers MrRelish-RT-F and MrRelish-RT-R. qRT-PCR was also performed to analyze the expression pattern of MrRelish at mRNA level in the gills of M. rosenbergii after V. anguillarum challenge at 2, 6, 12, 24 h. qRTPCR was performed using 2 × SYBR® Premix Ex TaqTM II (Tli RNaseH Plus) (Takara, Dalian, China) according to the manufacturer’s instructions. The GAPDH was amplified for internal standardization with the primers MrGAPDH-RT-F and MrGAPDH-RT-R). The detailed methods were according to the previous study (Zhang et al., 2014). The 2−ΔΔCt method was adapted to analyze the expression pattern of MrRelish (Livak and Schmittgen, 2001). Unpaired sample t-test was used for statistical analysis, and statistical significance was found if p < 0.05. 2.5. Plasmid construction A pair of primers (PacMrRHD-F and PacMrRHD-R) was designed to amplify the fragment corresponding to the RHD domain
Table 1 Sequences of the primers used in the study. Primers name
Sequences (5′–3′)
Usage
3′-CDS primer A
AAGCAGTGGTATCAACGCAGAGTAC (T)30VN CTAATACGACTCACTATAGGGCAAGC AGTGGTATCAACGCAGAGT CTAATACGACTCACTATAGGGC ATGTATGGTCATCACAGAATAGCCG TATGGTACCATGATCCAAATACTCAA ACAACCAC TTAGGGCCCTCGAGATTGTAAACAA TGTCTGAG GCGTAATACGACTCACTATAGGAGC AGTTTTGAATTTAT GCGTAATACGACTCACTATAGGCCC GAGATGGGAATTCA GCGTAATACGACTCACTATAGGTGG TCCCAATTCTCGTGGAAC GCGTAATACGACTCACTATAGGCTT GAAGTTGACCTTGATGCC ACCTAAGCAACCCGTGGA CTGGAGCGTAGCAGCACT TTGCTCCGTTGACCAGAAG GGCCGCCAATAATAATACT TCCAAATCCTCCTTCAAAAT GGAAACTTCAGGAAAATCAA TGGTGGAGGTGGGATTTTC TCGCTCTCGCAGCAGTAAG GGAAGGCAGACATTGGACC GCAGACGCAGAAGGAAGG GAAAGCCTTCCAGTCCG TGATTGTGCCGTTGAGTAA CCGTCATCTTCGCCTTGGTT TGCCTGTTTGGGTCATCGTTC TGTAAACAAGAGAGACCACGCAT CCGCAGAAATAGGACCCATC CTCCTTCAGCCAGACAAT CTCAACAACCGTACCCTAA AGGTCTTCAACGAGATGAAG GGAGTACTTCTCCAAGTTCA
For 3′RACE
UPM long Short MrRelishF PacMrRHD-F PacMrRHD-R MrRelish-iF MrRelish-iR GFP-iF GFP-iR MrCru2-RT-F MrCru2-RT-R MrCru4-RT-F MrCru4-RT-R MrCru5-RT-F MrCru5-RT-R MrCru8-RT-F MrCru8-RT-R MrALF1-RT-F MrALF1-RT-R MrALF3-RT-F MrALF3-RT-R MrLyso1-RT-F MrLyso1-RT-R MrLyso2-RT-F MrLyso2-RT-R MrRelish -RT-F MrRelish -RT-R MrGAPDH-RT-F MrGAPDH-RT-R
For over-expression
For RNAi
For qRT-PCR
238
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
of MrRelish. After digesting with Kpn I and Apa I (Takara, Japan), the RHD fragment was ligated into the pAc5.1/V5–His B vector (Invitrogen, USA). The positive clone was sequenced to ensure the correct insertion. 2.6. Cell culture and transfection Drosophila Schneider 2 (S2) cells were maintained in Drosophila serum-free medium (Invitrogen, USA) supplemented with 10% fetal bovine serum (Invitrogen) at 27 °C. S2 cells were first seeded overnight, and plasmids were transfected using the Cellfectin II reagent (Invitrogen) according to the manufacturer’s instructions. For dual-luciferase reporter assays, S2 cells in each well (96-well plates, TPP, Switzerland) were transfected with 0.3 μg of expression plasmids, 0.2 μg of reporter gene plasmids, and 0.02 μg of pRL-TK Renilla luciferase plasmid (Promega, USA). The pRL-TK Renilla luciferase plasmid alone was transfected as the internal control. The reporter gene plasmids were constructed using the promoter sequences of Drosophila attacin A (Atta), drosomycin (Drs), cecropin A (Cec A), and metchnikowin (Mtk) and L. vannamei Pen4. All assays were performed with three independent transfections. At 48 h post-transfection, firefly and Renilla luciferase activities were measured using a Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions. The detailed methods were according to a previous paper (Huang et al., 2009).
2.7. RNA interference and the expression patterns of AMPs To prepare dsRNA, we designed MrRelish-specific primers (MrRelish-iF, MrRelish-iR) with T7 promoter sequence at the 5′ end of each primer to amplify the fragment of MrRelish (about 500 bp). Another pair of primers (GFP-iF, GFP-iR) was used to amplify the fragment of green fluorescent protein (GFP). The obtained fragments were used as template for dsRNA production. dsRNA was synthesized with T7 polymerase (Ferments, USA) by using a previously described method (Wang et al., 2013). Twelve healthy shrimps were divided into three groups. The first group was the control group, the second was first injected with 15 μg of GFP dsRNA (dsGFP), and the third group was injected with 15 μg of dsMrRelish. After 24 h, another 15 μg of dsGFP in 100 μl of V. anguillarum suspension or 15 μg of dsMrRelish in 100 μl of V. anguillarum suspension was injected into the prawns. After another 24 h post injection, gill tissues were extracted from three prawns for RNA extraction. RNA was then transcribed to cDNA by using the same methods in Section 2.2 for gene expression analysis (Table 1). After RNAi, the expression levels of mRNA were determined by qRT-PCR. Crustin (Cru) 2, Cru5, Cru4, Cru8, anti-lipopolysaccharide factor (ALF) 1, ALF3, lysozyme (Lys) 1, and Lys2 were analyzed in the gills. The primers of genes were as follows: MrCru2-RT-F and MrCru2RT-R, MrCru4-RT-F and MrCru4-RT-R, MrCru5-RT-F and MrCru5-RTR, MrCru8-RT-F and MrCru8-RT-R, MrALF1-RT-F and MrALF1-RT-R,
Fig. 1. (A) The amino acid sequences of MrRelish. The RHD domain was shaded in red, IPT domain shaded in green, 6 ANKs were in blue, a nucleus localization signal was marked with deep red and a death domain was in bold. (B) Schematic diagrams of MrRelish protein predicted by SMART analysis. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
MrALF3-RT-F and MrALF3-RT-R, MrLyso1-RT-F and MrLyso1-RT-R, MrLyso2-RT-F and MrLyso2-RT-R. 3. Results 3.1. cDNA cloning and sequence analysis The full-length cDNA sequence of MrRelish contains 5072 bp, including a 3510 bp open reading frame (ORF) encoding a 1169 bp amino acid protein, with a 1562 bp 3′ UTR. The MrRelish protein
239
contains one RHD, one IPT (Ig-like, plexins, transcription factors), six ANKs, a nucleus localization signal, and a death domain (Fig. 1A and 1B). MrRelish presents a molecular weight of 129.76 kDa and a pI of 5.32. The RHD and IPT domains of crustacean Relishes are highly conserved (Fig. 2). BLASTP analysis showed that MrRelish shared 68% identity with LvRelish from L. vannamei and PmRelish from P. monodon, and 65% identity with EsRelish from Eriocheir sinensis. Multiple alignment analysis showed that Relish proteins from crustaceans contain one Gln-rich region and one Glu-rich region (Fig. 2). The phylogenetic tree showed that crustacean Relishes were
Fig. 2. Multiple alignments of MrRelish protein with Relishes from crustaceans. Asterisks under the sequences indicate the identical amino acids of different relish proteins.
240
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
Fig. 2. (continued)
clustered into one group, and insect Relishes were grouped into another cluster (Fig. 3). CrRelish from Carcinoscorpius rotundicauda that belongs to Merostomata was classified separately (Fig. 3).
anguillarum challenge. MrRelish was upregulated to the highest level at 6 h and subsequently downregulated at 12 and 24 h. The expression level of MrRelish at 12 and 24 h was higher than that of the control (Fig. 4B).
3.2. Tissue distribution and expression patterns of MrRelish at mRNA level 3.3. Over-expression of MrRHD in Drosophila S2 cell lines MrRelish was mainly expressed in hemocytes, intestine, gills, and stomach, but it could also be detected in heart and hepatopancreas at a relatively low expression level (Fig. 4A). qRT-PCR analysis showed that MrRelish in gills was down-regulated at 2 h after V.
The present study demonstrated that the over-expression of MrRHD could activate the promoters of Drosophila and shrimp AMP genes. MrRHD induced the promoter activities of Mtk, Atta, Drs, Cec
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
241
Fig. 2. (continued)
A, and shrimp Pen4 by about 2.6-, 4.2-, 3.6-, 3.7-, and 3.3-fold, respectively (Fig. 5).
interfered. Cru4, ALF1, and ALF3 were not regulated by MrRelish (Fig. 7).
3.4. RNAi of Relish in gills and the expression of AMP genes
4. Discussion
To investigate the regulated genes of MrRelish, we performed RNAi experiments. In gills, MrRelish showed evident upregulation in prawns challenged with dsGFP plus V. anguillarum at 24 h. MrRelish dsRNA (dsMrRelsih) could down-regulate the expression of MrRelish (Fig. 6). After MrRelish knockdown, eight genes (Cru2, Cru4, Cru5, Cru8, ALF1, ALF3, Lys1, Lys2) were selected as probable effector genes. The results showed that the expression of five genes (Cru2, Cru5, Cru8, Lyso1, and Lyso2) was down-regulated when MrRelish was
The Toll and IMD pathways are two major signal pathways involved in production of antimicrobial peptides in invertebrates. Dorsal is the transcription factor of the Toll pathway, whereas the Relish transcription factor is involved in the IMD pathway (Uvell and Engström, 2007). In the present study, MrRelish was identified from the giant freshwater prawn M. rosenbergii. MrRelish contains RHD, IPT, and ANK domains and represents the long form of Relish. In shrimp, both long and short forms of Relish were found.
242
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
Fig. 3. Phylogenetic analysis of MrRelish and other representative Relish. NtRelish: Relish from Nasutitermes triodiae (AAZ08471.1); NwRelish: relish from Nasutitermes walker (AAZ08469.1); NgRelish: relish from Nasutitermes graveolus (AAZ08468.1); TpRelish: relish from Tumulitermes pastinator (AAZ08472.1); NlRelish: relish from Nasutitermes longipennis (AAZ08473.1); NmRelish: relish from Nasutitermes magnus (AAZ08474.1); NeRelish: relish from Nasutitermes exitiosus (AAZ08470.1); NcRelish: relish from Nasutitermes comatus (AAZ08478.1); NfRelish: relish from Nasutitermes fumigatus (AAZ08477.1); NdRelish: relish from Nasutitermes dixoni (AAZ08475.1); NpRelish: relish from Nasutitermes pluvialis (AAZ08476.1); DrRelish: relish from Drepanotermes rubriceps (AAZ08479.1); TcRelish: relish from Tribolium castaneum (EEZ97717.1); PcRelish: relish from P. carinicauda (AGR39579.1); EsRelish: relish from E. sinensis (ADM14334.1); FcRelish: relish from F. chinensis (ACJ36224.1); LvRelish: relish from L. vannamei (ABR14713.1); PmRelish: relish from P. monodon (AFH66691.1); CrRelish: relish from C. rotundicauda (ABC75034.1).
In L. vannamei, LvRelish and its shorter isoform sLvRelish were identified and sLvRelish only contains the RHD and IPT domains (Huang et al., 2009). The short form of Relish with the RHD and IPT domains was also identified in the Chinese shrimp F. chinensis (Li et al., 2009). In P. monodon, a long relish was found (Visetnan et al., 2015). Therefore, at least two isoforms of Relish have been speculated to exist in shrimp. Tissue distribution analysis showed that MrRelish was mainly expressed in hemocytes and intestine. The highest expression level of FcRelish detected in hemocytes and lymphoid organ may indicate its possible roles in shrimp innate immunity (Li et al., 2009). Hemocytes are very important immune-related organs (Li et al., 2009). The intestine of Drosophila could generate powerful innate immune and inflammatory responses (Ayyaz and Jasper, 2013). Hence, the main expression of MrRelish in hemocytes and intestine may suggest its possible roles in innate immune defense. MrRelish was upregulated in gills after V. anguillarum challenge. FcRelish also increased to the highest level at 1 h after Vibrio challenge (Li et al., 2009). PfRelish from P. fucata was obviously upregulated at 12 h after Vibrio challenge (Huang et al., 2012). Relish is the transcription factor of the IMD signal pathway, which is activated in response to gram-negative bacteria (Takehana et al., 2004). In F. chinensis and Procambarus clarkii, IMD was involved in innate immunity against gram-negative bacteria (Lan et al., 2013). Thus, the upregulation of MrRelish upon Vibrio challenge may suggest its roles in innate immunity against gram-negative bacteria. In the present research, Relish was also reported to have roles in antiYHV immune defense and YHV could activate PmRelish (Visetnan
Fig. 4. (A) Analysis of tissue distribution of MrRelish in hemocytes, heart, hepatopancreas, gill, stomach and intestine of the healthy M. Rosenbergii. (B) Expression pattern of MrRelish in the gills of M. rosenbergii at 0, 2, 6, 12, 24 h after V. anguillarum challenge. Asterisks indicate significant differences (*P < 0.05, **P < 0.01) compared with values of the control. Error bars represent mean ± S.D. of the three independent PCR amplifications and quantifications.
et al., 2015). Moreover, WSSV replication was partially dependent on LvRelish (Qiu et al., 2014). In conclusion, Relish was involved in both anti-bacterial and anti-viral innate immune defenses. IMD pathway activation induces the production of AMP genes. In this study, the over-expression and RNAi results both indicated that MrRelish was associated with AMP production. The overexpression of MrRHD could induce 4 Drosophila AMPs and one shrimp AMP. Both LvRelish and its RHD domain transactivated Pen4 (Huang et al., 2009). RHD is the activated form of Relish, and the recombinant intact LvRelish was cleaved into two fragments in S2 cells. Hence, the over-expression of RHD or intact Relish both activated the expression of AMPs. The RNAi of MrRelish in gills inhibited the expression of 3 Crus and 2 lysos. Pen5 expression was regulated by FcRelish (Li et al., 2009). ALF was highly suppressed in L.
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
243
Fig. 5. Relative induction of luciferase activity by MrRHD (RHD domain of MrRelish). The bars indicate the mean ± SD of the luciferase activities (n = 3). The statistical significance was calculated by Student’s t-test (*p < 0.05).
Fig. 6. Analysis of the expression level of MrRelish in gills from the freshwater prawns (normal group, dsGFP + 24 h V. anguillarum challenge group, dsMrRelish + 24 h V. anguillarum challenge group). Identical letters are not significant difference (p > 0.05), while different letters indicate significant difference among groups (p < 0.05).
vannamei when LvIMD was silenced (Hou et al., 2014). In the present study, ALF expression was not regulated by MrRelish and PcIMD from P. clarkii or MjIMD from Marsupenaeus japonicus knockdown affected the expression of Crus, ALFs, and lysos (Lan et al., 2013). Therefore, MrRelish was involved in the production of AMP genes. In conclusion, a Relish gene was identified from the giant freshwater prawns. The gene was mainly expressed in hemocytes and intestine and upregulated after V. anguillarum challenge. The overexpression or RNAi experiments both suggested the roles of this gene in production of AMP genes. MrRelish was speculated to be involved in anti-gram-negative bacteria innate immune defense. Acknowledgments The current study was supported by the National Natural Science Foundation of China (Grant No. 31101926), the Natural Science
Fig. 7. Analysis of the expression of AMP genes including MrCru2, MrCru4, MrCru5, MrCru8, MrALF1, MrALF3, MrLyso1 and MrLyso2 in gills from the giant freshwater prawns with MrRelish knockdown. The experiments were divided into 3 groups (normal group, dsGFP + 24 h V. anguillarum challenge group, dsMrRelish + 24 h V. anguillarum challenge group). Identical letters are not significant difference (p > 0.05), while different letters indicate significant difference among groups (p < 0.05).
Foundation of Jiangsu Province (BK20131401), Natural Science Fund of Colleges and Universities in Jiangsu Province (13KJB240002, 14KJA240002), NSFC for Talents Training in Basic Science (J1103507), and the Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
244
Y.-R. Shi et al./Developmental and Comparative Immunology 52 (2015) 236–244
References Ayyaz, A., Jasper, H., 2013. Intestinal inflammation and stem cell homeostasis in aging Drosophila melanogaster. Front. Cell Infect. Microbiol. 3, 98. Cornwell, W.D., Kirkpatrick, R.B., 2001. Cactus-independent nuclear translocation of Drosophila RELISH. J. Cell. Biochem. 82, 22–37. Ghosh, S., May, M.J., Kopp, E.B., 1998. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu. Rev. Immunol. 16, 225–260. Hedengren, M., Asling, B., Dushay, D.S., Ando, I., Ekengren, S., Wihlborg, M., et al., 1999. Relish, a central factor in the control of humoral but not cellular immunity in Drosophila. Mol. Cell 4, 827–837. Hoffmann, J.A., 2003. The immune response of Drosophila. Nature 426, 33–38. Hou, F., He, S., Liu, Y., Zhu, X., Sun, C., Liu, X., 2014. RNAi knock-down of shrimp Litopenaeus vannamei Toll gene and immune deficiency gene reveals their difference in regulating antimicrobial peptides transcription. Dev. Comp. Immunol. 44, 255–260. Huang, X.D., Yin, Z.X., Liao, J.X., Wang, P.H., Yang, L.S., Ai, H.S., et al., 2009. Identification and functional study of a shrimp Relish homologue. Fish Shellfish Immunol. 27, 230–238. Huang, X.D., Liu, W.G., Guan, Y.Y., Shi, Y., Wang, Q., Zhao, M., et al., 2012. Molecular cloning and characterization of class I NF-κB transcription factor from pearl oyster (Pinctada fucata). Fish Shellfish Immunol. 33, 659–666. Jayaprakash, N.S., Pai, S.S., Philip, R., Singh, I.S., 2006. Isolation of a pathogenic strain of Vibrio alginolyticus from necrotic larvae of Macrobrachium rosenbergii (de Man). J. Fish Dis. 29, 187–191. Lan, J.F., Zhou, J., Zhang, X.W., Wang, Z.H., Zhao, X.F., Ren, Q., et al., 2013. Characterization of an immune deficiency homolog (IMD) in shrimp (Fenneropenaeus chinensis) and crayfish (Procambarus clarkii). Dev. Comp. Immunol. 41, 608–617. Lemaitre, B., Hoffmann, J., 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. Li, F., Yan, H., Wang, D., Priya, T.A., Li, S., Wang, B., et al., 2009. Identification of a novel relish homolog in Chinese shrimp Fenneropenaeus chinensis and its function in regulating the transcription of antimicrobial peptides. Dev. Comp. Immunol. 33, 1093–1101. Liang, T., Li, X., Du, J., Yao, W., Sun, G., Dong, X., 2011. Identification and isolation of a Spiroplasma pathogens from diseased freshwater prawns, Macrobrachium rosenbergii, in China: a new freshwater crustacean host. Aquaculture 318, 1–6.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25, 402–408. Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T.B., 2004. Invertebrate immune systems not homogeneous, not simple, not well understood. Immunol. Rev. 198, 10–24. Qian, D., Shi, Z., Zhang, S., Cao, Z., Liu, W., Li, L., 2003. Extra small virus-like particles (XSV) and nodavirus associated with whitish muscle disease in the giant freshwater prawn, Macrobrachium rosenbergii. J. Fish Dis. 26, 521–527. Qiu, W., Zhang, S., Chen, Y.G., Wang, P.H., Xu, X.P., Li, C.Z., et al., 2014. Litopenaeus vannamei NF-κB is required for WSSV replication. Dev. Comp. Immunol. 45, 156–162. Roustaian, P., Kamarudin, M.S., Bin Omar, H., Saad, C.R., Ahmad, M.H., 2000. Amino acid composition of developing larval freshwater prawn Macrobrachium rosenbergii. J. World Aquac. Soc. 31, 130–136. Sharshar, K.M., Azab, E.A., 2008. Studies on diseased freshwater prawn Macrobrachium rosenbergii infected with Vibrio vulnificus. Pak. J. Biol. Sci. 11, 2092–2100. Takehana, A., Yano, T., Mita, S., Kotani, A., Oshima, Y., Kurata, S., 2004. Peptidoglycan recognition protein (PGRP)-LE and PGRP-LC act synergistically in Drosophila immunity. EMBO J. 23, 4690–4700. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739. Tanaka, H., Matsuki, H., Furukawa, S., Sagisaka, A., Kotani, E., Mori, H., et al., 2007. Identification and functional analysis of Relish homologs in the silkworm, Bombyx mori. Biochim. Biophys. Acta 1769, 559–568. Uvell, H., Engström, Y., 2007. A multilayered defense against infection: combinatorial control of insect immune genes. Trends Genet. 23, 342–349. Visetnan, S., Supungul, P., Hirono, I., Tassanakajon, A., Rimphanitchayakit, V., 2015. Activation of PmRelish from Penaeus monodon by yellow head virus. Fish Shellfish Immunol. 42, 335–344. Wang, D., Li, S., Li, F., 2013. Screening of genes regulated by Relish in Chinese shrimp Fenneropenaeus chinensis. Dev. Comp. Immunol. 41, 209–216. Zhang, S.M., Coultas, K.A., 2011. Identification and characterization of five transcription factors that are associated with evolutionarily conserved immune signaling pathways in the schistosome-transmitting snail Biomphalaria glabrata. Mol. Immunol. 48, 1868–1881. Zhang, X.W., Wang, X.W., Huang, Y., Hui, K.M., Shi, Y.R., Wang, W., et al., 2014. Cloning and characterization of two different ficolins from the giant freshwater prawn Macrobrachium rosenbergii. Dev. Comp. Immunol. 44, 359–369.
