Anaerobe 30 (2014) 1e10

Contents lists available at ScienceDirect

Anaerobe journal homepage: www.elsevier.com/locate/anaerobe

Clinical microbiology

In vitro evaluation of the probiotic and functional potential of Lactobacillus strains isolated from fermented food and human intestine Dayong Ren a, b, Chang Li a, *, Yanqing Qin a, b, Ronglan Yin c, Shouwen Du a, Fei Ye a, Cunxia Liu a, Hongfeng Liu a, Maopeng Wang a, Yi Li a, Yang Sun a, Xiao Li a, Mingyao Tian a, Ningyi Jin a, * a

Key Laboratory of Jilin Province for Zoonosis Prevention and Control, Institute of Military Veterinary, Academy of Military Medical Sciences, Changchun 130122, PR China b College of Food Science and Engineering, Jilin Agricultural University, Changchun 130118, PR China c Academy of Animal Science and Veterinary Medicine in Jilin Province, Changchun 130062, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 22 January 2013 Received in revised form 29 June 2014 Accepted 11 July 2014 Available online 19 July 2014

This study aims to evaluate the functional and probiotic characteristics of eight indigenous Lactobacillus strains in vitro. The selected lactobacilli include strains of Lactobacillus casei subsp. casei, Lactobacillus salivarius subsp. salicinius, Lactobacillus fermentum, Lactobacillus plantarum, Lactobacillus delbrueckii subsp. lactis, Lactobacillus delbrueckii subsp. bulgaricus, and Lactobacillus rhamnosus. All strains tolerated both pH 2 for 3 h and 1% bile salt for 24 h. The strains CICC 23174 and CGMCC 1.557 were the most adhesive strains producing the highest quantity of EPS. Although a wide variation in the ability of the eight strains to deplete cholesterol and nitrite, antagonize pathogens, scavenge free radical, and stimulate innate immune response were observed, the strains CICC 23174 and CGMCC 1.557 showed the widest range of these useful traits. Taken together, the strains CICC 23174 and CGMCC 1.557 exhibited the best probiotic properties with the potential for use in the production of probiotic fermented foods. © 2014 Published by Elsevier Ltd.

Keywords: Lactobacillus spp Probiotics In vitro properties Gastrointestinal tolerance Adhesion

1. Introduction Many lactobacilli species are normal inhabitants of the human gastrointestinal (GI) tract and are a subdominant genus in the colon, where it is outnumbered by dominant species of Bifidobacterium and Bacteroides. Therefore, they are generally regarded as safe (GRAS). Lactobacillus plays an important role as starters in healthy fermented foods. As probiotics, Lactobacillus has many beneficial biological effects on health; consequently, are mainly used for treating or preventing diarrhea, for stimulating the immune system, and for promoting the growth and colonization of beneficial intestinal bacteria. Over the past decades, probiotic Lactobacillus has been widely studied. Several new lactobacilli strains have been selected

* Corresponding authors. Institute of Military Veterinary Medicine, LiuYingXi Road No. 666, Changchun 130122, PR China. Tel.: þ86 431 86985929; fax: þ86 431 86985861. E-mail addresses: [email protected] (C. Li), [email protected] (N. Jin). http://dx.doi.org/10.1016/j.anaerobe.2014.07.004 1075-9964/© 2014 Published by Elsevier Ltd.

and used as probiotic bacteria in both functional foods and biotherapeutic agents Although no efficacious microbial phenotypic markers that have the functional features of probiotics, these promising probiotic strains should have some common features such as ability to survive in the GI tract and be retained in the host intestines, and have been proven safe for human use [1]. Survival and colonization in the GI tract are critical properties that confer health benefits to the host [2]. Lactobacillus requires certain cell surface properties such as hydrophobicity and extracellular protein profiles to colonize the intestines [3]. Moreover, presumptive probiotic Lactobacillus strains must tolerate low pH, bile, lysozyme [4]. They should also have functional attributes like antioxidative and immunomodulatory activity to exert useful physiologic functions [5]. However, increasing evidence showed that these aforementioned probiotic properties are not applicable to other investigated strains without specific functional assessment [6]. Therefore, the aim of this study is to determine the functional and probiotic

2

D. Ren et al. / Anaerobe 30 (2014) 1e10

attributes of potentially probiotic Lactobacillus strains. In this study, eight indigenous Lactobacillus strains and the standard probiotic Lactobacillus strain GG were preliminarily compared based on their tolerance to acid and bile in the GI tract and their colonization potential in the intestinal tract was characterized. Furthermore, various functional tests were employed to assess the functional and probiotic properties of Lactobacillus, such as antibacterial and antioxidative activity, cholesterol- and nitrite-lowering ability, and immunoregulation ability.

2.3. Bile salt tolerance 1 mL of fresh Lactobacillus suspension (1  109 CFU/mL) was inoculated into 9 mL of MRS broth supplemented with 0% (control), 0.3%, 0.5%, and 1% bile salts and incubated at 37  C for 24 h under anaerobic conditions. After incubation, bile tolerance was determined in terms of cell survival counts determined by plating, as previously described. 2.4. Isolation and quantification of exopolysaccharides (EPS)

2. Materials and methods 2.1. Bacterial strains and culture conditions The Lactobacillus strains used in this study are listed in Table 1. Strains of Lactobacillus casei subsp. casei, Lactobacillus salivarius subsp. salicinius, and Lactobacillus fermentum were obtained from the China Center of Industrial Culture Collection (CICC). Lactobacillus plantarum, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus acidophilus, and L. delbrueckii subsp. lactis were obtained from the China General Microbiological Culture Collection (CGMCC). Lactobacillus rhamnosus GG (ATCC 53103) was obtained from the American Type Culture Collection (ATCC) and LGG was used as the reference strain. These strains were chosen in the present work because they are extensively used in fermented food. All lactobacilli strains were cultured in de Man, Rogosa, and Sharpe broth (MRS; Qingdao Hope Bio-Technology Co., Ltd, China) or on MRS agar plates (MRS broth supplemented with 1.5% agar) under anaerobic conditions (85% N2, 10% H2 and 5% CO2) at 37  C for 18 h or 48 h, respectively. 2.2. Acid resistance Phosphate-buffered saline (PBS) was adjusted to 2.0, 3.0, and 6.4 (as control) using 1.0 M HCl and were sterilized at 121  C for 15 min. Test tubes filled with 9 mL of PBS at each pH were inoculated with 1 mL of overnight-grown Lactobacillus cultures (1  109 CFU/mL) and incubated at 37  C for 2 h and 3 h. After incubation, 1 mL of culture was collected from each tube and serially diluted 10-fold in 0.85% physiologic saline solution. The residual viable population was calculated by plate counting on MRS agar after incubation at 37  C for 48 h.

EPS was isolated from the media according to a method modified from Liu et al. [5]. Lactobacillus (1  109 CFU/mL) were inoculated (1%, v/v) into 200 mL of MRS broth supplemented with 2% glucose at 37  C for 24 h. The bacterial cells were removed by centrifugation at 6000  g for 10 min. Trichloroacetic acid was added to the supernatant liquid to a final concentration of 4% (w/v), and the mixture was stirred at 4  C for 3 h. The precipitated proteins were removed by centrifugation at 22,000  g for 30 min. The supernatant liquid was then concentrated five times by evaporation. The EPS was precipitated by adding four volumes of 95% cold ethanol and then stored at 4  C for 24 h, followed by centrifugation at 22,000  g at 4  C for 20 min. The precipitated EPS was dialyzed (molecular weight cut-off: 6000 Da to 8000 Da) at 4  C for 48 h and then lyophilized to obtain a dried powder. The amount of total EPS was measured using the phenolesulfuric acid method [7]. 2.5. Adhesion assay An in vitro adhesion assay was performed using the method described by Sugimura et al. [8]. Caco-2 cells were grown in Dulbecco's modified Eagle's medium (DMEM; HyClone, Laboratories Inc., Logan, UT, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; HyClone), L-glutamine (2 mmol/L), penicillin (100 U/mL), and streptomycin (100 mg/mL) in an incubator with 95% (v/v) humidified air and 5% (v/v) CO2 at 37  C. The Caco-2 cells (1  105 cells/mL) were seeded into 24-well tissue culture plates and fully differentiated for 16 days (post-confluence) by changing the culture medium every 2 days. The cells were washed twice with PBS (pH 7.4) to remove the excess unattached cells. One milliliter of each lactobacilli suspension (1  109 CFU/mL in antibiotic-free DMEM) or DMEM solution (as control) was added into each well

Table 1 Sources and acid tolerance of Lactobacillus strains (n ¼ 3, mean ± SD). Species

Strains

Source

Viable count (log CFU/mL)a Initial

Time (h)

pH 2

L. casei subsp. casei

20296

Yoghourt

9.2 ± 0.1

L. salivarius subsp. salicinius

23174

Intestine

9.3 ± 0.1

L. fermentum

6233

Yak milk

9.0 ± 0.1

L. plantarum

1.557

Vegetable

9.6 ± 0.4

L. delbrueckii subsp. lactis

1.2625

Cheese

9.3 ± 0.3

L. delbrueckii subsp. bulgaricus

1.2161

Yoghourt

9.0 ± 0.1

L. acidophilus

1.1854

Milk

9.3 ± 0.3

L. acidophilus

1.1878

Intestine

9.0 ± 0.2

L. rhamnosus

LGG

Intestine

9.1 ± 0.2

2 3 2 3 2 3 2 3 2 3 2 3 2 3 2 3 2 3

8.4 8.3 8.3 8.1 8.7 8.8 8.7 8.8 8.4 8.1 8.8 8.4 9.1 8.9 8.9 8.6 9.0 8.9

a

Means at different pH values in the same row are not significantly different (P > 0.05).

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

pH 3 0.3 0.3 0.1 0.3 0.2 0.1 0.4 0.2 0.4 0.4 0.3 0.2 0.1 0.4 0.1 0.4 0.1 0.3

9.0 8.7 8.6 8.5 9.0 9.1 9.3 9.0 9.3 8.8 9.0 9.0 9.2 9.0 8.9 8.8 9.1 9.0

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

pH 6.4 0.3 0.1 0.3 0.2 0.3 0.1 0.4 0.1 0.4 0.1 0.3 0.1 0.3 0.4 0.1 0.3 0.1 0.2

8.9 9.0 9.0 8.9 8.9 8.8 9.2 8.9 9.2 8.8 9.0 9.0 9.2 9.0 9.0 8.8 9.1 8.9

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.3 0.4 0.1 0.3 0.1 0.2 0.2 0.1 0.4 0.1 0.4 0.3 0.2 0.1 0.2 0.2 0.3 0.4

D. Ren et al. / Anaerobe 30 (2014) 1e10

and incubated at 37  C under 5% CO2 for 2 h. After incubation, the monolayers were washed three times with sterile PBS to remove the unbound bacteria. The number of Caco-2 cells in each well was about 5  105, which was determined in a Neubauer chamber. The adherent bacteria were detached and dispersed in 1 mL of 0.05% TrypsineEDTA. The adherent lactobacilli cells were serially diluted and spread onto MRS agar plates for counting. The results are expressed as percent adhesion (CFUs/100 cells), the ratio between adherent bacteria and Caco-2 cells per well.

3

mixture stand for an additional 10 min, its absorbance was read at 550 nm against reagent blank. A standard curve was constructed by subjecting 0 mg/mL to 100 mg/mL cholesterol solutions to the aforementioned steps. Absorbance values were compared with a standard curve to determine the cholesterol concentration. Cholesterol assimilation (%) ¼ (1r1/r0)  100, where r0 and r1 are the amounts of cholesterol present in the MRS broth at time ¼ 0 and at time ¼ 24 h, respectively. 2.9. Depletion of sodium nitrite

2.6. Cell surface hydrophobicity Cell surface hydrophobicity was evaluated via the microbial adhesion to hydrocarbons (MATH) [9,10] with slight modifications. Bacterial cells grown in MRS broth at 37  C for 18 h were harvested by centrifugation at 6000  g for 10 min. The pellet was washed twice with sterilized PBS (pH 7.2), and then resuspended and diluted in sterilized 0.1 M KNO3 solution to reach an optical density (OD) of 0.5 ± 0.02 at 600 nm (A0). Then, 3 mL of the cell suspension and 1 mL of xylene were mixed and preincubated at room temperature for 10 min. The two-phase system was then mixed for 2 min through vortexing and allowed to stand for 20 min to separate into two phases (water and xylene phases). The aqueous phase was carefully collected to measure its absorbance at 600 nm (A1). The surface hydrophobicity (%) was calculated using the formula: H% ¼ (1  A1/A0)  100. The hydrophobicity determination was performed in triplicate. 2.7. Autoaggregation assay The autoaggregation assay was performed according to the method by Xu et al. [3] with modifications. Freshly grown bacterial cells were harvested at 6000  g for 10 min at room temperature. The cell pellet was washed twice with PBS and resuspended in PBS to an absorbance of 0.5 ± 0.02 at 600 nm (A0 h). Then, each bacterial suspension (2 mL) was vortexed for 10 s and incubated at 37  C for 2 h. After incubation, 1 mL of the supernatant suspension was collected to measure its absorbance at 600 nm (A2 h). The autoaggregation percentage was expressed as 1  (A2 h/A0 h)  100. 2.8. Cholesterol assimilation The ability of lactobacilli to assimilate cholesterol was measured according to the method described by Wang et al. [11]. Lactobacillus (1  109 CFU/mL) was inoculated (1%, v/v) into 10 mL of MRS broth supplemented with 0.2% (w/v) sodium thioglycollate, 0.3% (w/v) oxgall, and 100 mg/mL water soluble cholesterol. Uninoculated MRS broth was used as the control. After incubation at 37  C for 24 h, the supernatant liquid was collected by centrifugation for 10 min at 12,000  g and 4  C. The remaining cholesterol concentrations in the supernatant liquid and the uninoculated MRS broth were determined using the o-phthalaldehyde method [12]. Briefly, 3 mL of 95% ethanol, 2 mL of 50% (w/v) KOH, and 1 mL of the samples (supernatants) were placed in a test tube and were mixed thoroughly. The mixture was heated at 60  C for 10 min and then cooled to room temperature. Then, 5 mL of hexane and 3 mL of distilled water were added to the mixture and shaken for 1 min. The test tubes were left for 15 min at room temperature to permit phase separation. Then, 3 mL of the hexane layer was collected and evaporated at 60  C with flowing nitrogen gas. Freshly prepared ophthalaldehyde (4 mL, 0.5 mg of o-phthalaldehyde per milliliter of glacial acetic acid) was added to each tube and thoroughly mixed to dissolve the remaining residue. The tubes were kept at room temperature for 10 min, and then, 2 mL of concentrated sulfuric acid was carefully added and immediately mixed. After letting the

Sodium nitrite depletion by lactobacilli in MRS broth was determined using the method by Wu et al. [13] with slight modifications. 1 mL of sterilized sodium nitrite solution (1500 mg/mL) was added to 9 mL of MRS broth (pH 6.5) in test tubes to reach a final concentration of 150 mg/mL. Then, 0.1 mL of fresh Lactobacillus culture (1  109 CFU/mL) was inoculated separately into the media, followed by incubation at 37  C for 48 h under anaerobic conditions. Sterile water, instead of inoculums, was added as a control. Sodium nitrite depletion was determined via a colorimetric nitrite assay by calculating the initial and final nitrite concentrations at 538 nm, as described by Yan et al. [14]. Briefly, 5 mL of inoculated MRSenitrite solution was defatted and deproteinated with 10 mL of ZnSO4 (0.42 mol/L), followed by filtration. Three color development solutions (1 mL each), namely 0.2% (w/v) sulfanilamide, 0.1% (w/v) N-1-naphtyethylene diamine dihydrochloride, and 44.5% (v/v) HCl were sequentially added to the filtrates and mixed thoroughly. The mixture was allowed to stand for 5 min at room temperature in the dark. The ODs of the colored mixtures were read at 538 nm against the reagent blank. Standard sodium nitrite solution (3000 mg/mL) was serially diluted to construct a standard curve using the similar aforementioned method. Nitrite depletion (%) ¼ (1  C1/C0)  100, where C0 and C1 are the amounts of nitrite present in the MRS broth at time ¼ 0 and time ¼ 48 h, respectively. 2.10. Antagonistic activity against pathogens 2.10.1. H2O2 production The H2O2 production by lactobacilli was qualitatively determined by the method described by Maldonado et al. [15]. Briefly, horseradish peroxidase (HRP) and tetramethyl-benzidine (TMB) (Solarbio, Beijing, China) were added to MRS agar medium to reach a final concentration of 0.25 mg/mL and 0.01 mg/mL, respectively. The tested lactobacilli strains were inoculated in the TMB-MRS plates. The ability of lactobacilli to produce H2O2 was evaluated according to the intensity of blue color of lactobacilli colonies in the TMB-MRS plates:  (negative), þ (weakly positive), þþ (moderately positive), and þþþ (strongly positive). 2.10.2. Antibacterial activity The antibacterial activity of Lactobacillus against Escherichia coli, Bacillus cereus, Klebsiella pneumoniae, Salmonella typhimurium, and Staphylococcus aureus was analyzed using the agar well diffusion assay described by Sgouras et al. [16]. B. cereus, K. pneumoniae, and S. typhimurium were isolated from environment and provided by Dr. Sun from Academy of Military Medical Sciences. E. coli and S. aureus were provided by Prof. Chen of the Department of Food Science at Jilin Agricultural University. Each Lactobacillus strain was anaerobically grown in MRS broth for 24 h. The MRS agar plates were overlaid with 10 mL of soft MRS agar inoculated with 0.2 mL of an overnight culture of the indicator strains (1  107 to 5  107 CFU/mL) grown in LuriaeBertani (LB) broth at 37  C. After the media were allowed to solidify at room temperature for 15 min, 6 mm diameter wells were punched into the surface using a sterile borer. The wells were

4

D. Ren et al. / Anaerobe 30 (2014) 1e10

sealed with one drop of soft agar. 60 mL aliquots of fresh overnight lactobacilli strains cultures, supernatants adjusted to pH 6.5, or washed lactobacilli cells resuspended in fresh MRS broth were suspended in the agar wells. The plates were kept for 2 h at room temperature so that the supernatant diffused into the agar, then incubated for 48 h at 37  C. Antimicrobial activity was recorded as the diameter of growth inhibition zones around the well. The diameter of the clear zone was scored as follows: e, no inhibition; þ, diameter between 0 and 3 mm (weak); þþ, diameter between 3 and 6 mm (good) and þþþ, diameter larger than 6 mm (strong) [17]. MRS adjusted to pH 6.5 served as the control. Each experiment was performed in triplicate. 2.11. Antibiotic susceptibility assay Antibiotic susceptibility of the lactobacilli strains was determined using agar overlay diffusion method [18]. Previously prepared MRS agar plates overlaid with 100 mL of an active culture at 37  C. The plates were maintained at room temperature for 1 h. Antibiotic discs (Hangzhou Binhe Microorganism Reagent Co., Ltd, China) were placed on the plates. After 24 h incubation at 37  C, the diameter of the inhibition zone was measured. All strains were screened for their susceptibility to ten antibiotics (kanamycin, gentamicin, vancomycin, chloramphenicol, tetracycline, clindamycin, streptomycin, ampicillin, erythromycin and penicillin). 2.12. Antioxidative properties Two complementary methods were performed to assess the antioxidant activity of the tested strains. Hydroxyl radical scavenging assay. The assay was carried out using the method described by Wang et al. [19] with modifications. Lactobacilli cells were harvested after 18 h of incubation by centrifugation at 6000  g for 10 min. The cell pellets were washed twice with PBS (pH 7.2) and resuspended at 109 CFU/mL in PBS. Then, 0.5 mL of 1,10-phenanthroline (6 mmol/L) and 0.5 mL of FeSO4 (6 mmol/L) were dissolved in 1 mL of PBS (pH 7.2) and immediately mixed. 0.5 mL of cell suspension (109 CFU/ mL), 0.5 mL of H2O2 (0.1%) and sterile water were added to the final total volume of 4 mL. The mixture was incubated at 37  C for 1 h, while a blank experiment was performed. The absorbance was read at 536 nm. The results were calculated using the following equation: hydroxyl radical scavenging activity (%) ¼ ((AS  A1)/(A0  A1))  100. where AS is the absorbance of the sample; A1 is the absorbance of the control solution containing 1,10-phenanthroline, FeSO4, and H2O2; A0 is the absorbance of blank solution containing 1,10-phenanthroline and FeSO4. Superoxide anion scavenging assay. The assay was carried out via pyrogallol autoxidation [20] with modifications. Lactobacilli cell suspension (50 mL, 109 CFU/mL in PBS) and 910 mL of sterile water were added into 2 mL of Tris-HCl buffer (50 mmol/L, pH 8.2) and immediately mixed. Deionized water was used as the control, replacing the lactobacilli cell suspension. Pyrogallol solution (40 mL; 10 mmol/L) was added and the autoxidation was calculated at 325 nm. The absorbance of each sample and the control was recorded every minute for 10 min to find the maximum inhibition point of the reaction. The scavenging activity of the superoxide anion (O2) was calculated as the inhibition rate of pyrogallol autoxidation using the following formula: superoxide anion scavenging activity (%) ¼ (DA0  DA)  100/DA0, where DA0 and DA are the autoxidation rates of the pyrogallol before and after the addition of the sample and deionized water, respectively.

2.13. Modulation of Toll-like receptor (TLR) expression in Caco-2 cells The ability of Lactobacillus to modulate TLR expression in Caco-2 cells was investigated using quantitative real-time polymerase chain reaction (qRT-PCR) as described by Vizoso et al. [21] with modifications. 1 mL of Caco-2 cells (1  106 cells/mL) were seeded in six-well plates and cultured for 48 h to obtain confluent monolayers. The monolayers were coincubated with 1 mL of each lactobacillus suspension (1  109 CFU/mL in antibiotic-free DMEM) and with antibiotic-free DMEM alone (as control). After coincubation for 24 h at 37  C under 5% CO2, the bacteria were aspirated off. The Caco-2 cells were detached from the plates with a cell scraper, washed twice with PBS (pH 7.2), and collected by centrifugation at 1500  g for 10 min for subsequent RNA extraction. Total cellular RNA was isolated from each treated sample using UNIQ-10 Column Trizol Total RNA Extraction Kit (Sangon, Shanghai, China), followed by reverse transcription to synthesize cDNA with the First Strand cDNA Synthesis Kit (Sangon, Shanghai, China) according to the manufacturer's instructions. The relative expression of TLR-2, TLR-4, and TLR-9 mRNA was quantified via qRT-PCR according to the standard protocol using the SYBR Green PCR Master Mix and ABI-Prism 7700 Sequence Detection System (Applied Biosystems, Tokyo, Japan). The PCR mixture contained 5 mL of cDNA (0.5 mg/mL) as the template, 0.5 mL of each primer, and 12.5 mL of SYBR Green Supermix. PCR water was added to a final volume of 25 mL. The following standard amplification program was used: initial denaturation at 95  C for 1 min, followed by 40 cycles of denaturation at 95  C for 30 s, annealing at an appropriate temperature (Table 2) for 30 s, and of extension at 72  C for 40 s. The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase was amplified as the internal standard. The data were analyzed using the equation as follows:

Amount of TLR mRNA ¼ 2DDCT where the threshold cycle (CT) indicates the fractional number at which the amount of amplified target reaches a fixed threshold. DCT ¼ (average TLR CT  average GAPDH CT). DDCT ¼ (average ;DCT untreated sample  average DCT treated sample). 2.14. Statistical analysis For comparisons, one-way analysis of variance (ANOVA) was performed with the TukeyeKramer post-hoc comparison. Significant differences were assessed using a Student's t-test. All data were expressed as means ± standard deviation (SD). A minimum of three independent experiments were carried out for each assay. Statistical analyses were performed using SPSS 14.0 for Windows (SPSS Inc., USA). Differences with P-values less than 0.05 were considered statistically significant. 3. Results 3.1. Acid tolerance The survival rates of nine Lactobacillus strains under different pH values are shown in Table 1. All tested strains showed good tolerance under pH 2, at which the number of surviving Lactobacillus cells exceeded 108 CFU/mL after incubation for 3 h. The strains CICC 6233, CGMCC 1.2161, CGMCC 1.1854, and CGMCC 1.1878 possessed excellent tolerance at pH 2 compared with the reference strain LGG, which is the well-documented probiotic strain. The strains were only slightly affected or unaffected at pH 3.0.

D. Ren et al. / Anaerobe 30 (2014) 1e10

5

Table 2 Primer sequences used for RT-PCR analysis of TLRs expression in Caco-2 cells. Genes

Primer (50 e30 )a

Size (bp)

Annealing temperature ( C)

GenBank accession number

References

TLR-2

F:GCCAAAGTCTTGATTGATTGG R:TTGAAGTTCTCCAGCTCCTG F:GGTGGAAGTTGAACGAATGG R:CCAGCAAGAAGCATCAGGTG F:GAGCGCAGTGGCAGACTGGGTG R:CACAGGTTCTCAAAGAGGGT F:GGAAGGTGAAGGTCGGAGTC R:TCAGCCTTGACGGTGCCATG

347

62

NM003264.3

[21]

186

62

NM003266.3

[24]

132

54

NM017442.3

[24]

184

66

NM002046.3

This study

TLR-4 TLR-9 GAPDH a

F, forward; R, reverse; bp, base pairs.

respectively) compared with the control strain L. rhamnosus GG (131 bacterial cells/100 cells).

3.2. Bile salt tolerance The results of the bile salt tolerance test are shown in Table 3. All tested strains survived at 0.3%e1% bile concentration. In this case, the residual counts of surviving Lactobacillus cells were more than 108 CFU/mL after incubation for 24 h. The strains CICC 6233, CGMCC 1.2625, and CGMCC 1.2161 were fairly tolerant of 1% bile. 3.3. Production of EPS The potential of Lactobacillus to produce EPS are shown in Table 3. The EPS production capacities of all tested Lactobacillus strains were examined, with each strain exhibiting very different EPS production capacities even within the same species. The reference strain LGG produced the highest EPS concentration (287 mg/L), followed by CICC 23174 (282 mg/L), and CGMCC 1.557 (259 mg/L). The strains CICC 6233 and CICC 20296 produced the lowest quantity of EPS (52 and 63 mg/L, respectively).

3.5. Physicochemical properties of bacterial cell surfaces The cell surface hydrophobicities of the tested strains are presented in Table 4. Only two stains, CICC 23174 and CGMCC 1.557, showed relatively higher hydrophobicities (59% and 43%, respectively) compared with the reference strain LGG (35%). The strains CICC 6233, CGMCC 1.2625, and CGMCC 1.1878 exhibited the lowest hydrophobicities at 14%, 16%, and 18%, respectively. The cellular autoaggregation rates of the tested strains are shown in Table 4. Only three stains, CICC 23174, CGMCC 1.1854, and CGMCC 1.557, exhibited relatively higher autoaggregation values (46%, 45%, and 34%, respectively) compared with the reference strain LGG (33%). The CGMCC 1.2625 strain exhibited the lowest autoaggregation rate (15%). 3.6. Assimilation of cholesterol

3.4. Adhesion properties The Caco-2 cell line was used as a model to select adhesive Lactobacillus strains in vitro. The well-characterized lactobacillus L. rhamnosus GG was used as the positive control (adhesive strain). The ability of the nine strains to adhere to Caco-2 cells is shown in Table 4. The results show that each strain did not exhibit similar adhesion ability, even though the strains were in the same genus. The most adhesive strain was CGMCC 1.557 with an adhesion value of 912 bacterial cells/100 cells, followed by CICC 23174 and CICC 20296 (665 and 492 bacterial cells/100 cells, respectively). The strains CGMCC 1.1854 and CGMCC 1.1878 showed the lowest capacities to adhere Caco-2 cells (73 and 81 bacterial cells/100 cells, Table 3 Bile tolerance and EPS production of Lactobacillus strains (n ¼ 3, mean ± SD). Strains

Bile tolerance (log CFU/mL) 0%

CICC 20296 CICC 23174 CICC 6233 CGMCC 1.557 CGMCC 1.2625 CGMCC 1.2161 CGMCC 1.1854 CGMCC 1.1878 LGG

8.57 8.59 8.82 8.53

0.3% ± ± ± ±

0.21 0.32 0.22 0.15

8.45 8.51 8.82 8.41

0.14 0.30 0.20 0.33

8.43 8.45 8.82 8.42

3.7. Depletion of sodium nitrite The capacities of the Lactobacillus strains to deplete sodium nitrite (150 mg/mL) are displayed in Table 5. The results show that

EPS (mg/L)

0.5% ± ± ± ±

The results of the screening of Lactobacillus for cholesterollowering capacity are shown in Table 5. Cholesterol concentrations in the cell culture medium decreased after the initial solution was cocultured with all of the Lactobacillus strains. Among the tested strains, CICC 20296, CICC 23174, and CGMCC 1.557 exhibited the highest cholesterol removal rates (74%, 65%, and 58%, respectively), followed by CGMCC 1.2161 (42%). The strains CGMCC 1.1878 and CICC 6233 showed relatively lower cholesterol removal rate (31% and 35%, respectively) compared with the reference strain LGG (39%).

1% ± ± ± ±

0.17 0.22 0.31 0.34

8.41 8.44 8.81 8.41

± ± ± ±

0.30 0.24 0.14 0.41

63 282 52 259

± ± ± ±

7.4D 7.3AB 5.8E 5.9AB

250 ± 3.1B

8.72 ± 0.13

8.70 ± 0.13 8.68 ± 0.22

8.61 ± 0.22

8.93 ± 0.41

8.93 ± 0.18 8.87 ± 0.10

8.86 ± 0.13

8.61 ± 0.44

8.49 ± 0.24 8.48 ± 0.19

8.47 ± 0.15

109 ± 7.2C

8.49 ± 0.10

8.37 ± 0.17 8.38 ± 0.37

8.35 ± 0.48

242 ± 2.0B

8.94 ± 0.14

8.92 ± 0.13 8.92 ± 0.17

8.86 ± 0.39

287 ± 2.3A

93 ± 7.6CD

AeE: Data bearing different uppercase superscript letters were significantly different (P < 0.05).

Table 4 Adhesive ability and cell surface properties of Lactobacillus strains (n ¼ 3, mean ± SD). Strains

Adhesion (bacteria/ 100 cells)

CICC 20296 CICC 23174 CICC 6233 CGMCC 1.557 CGMCC 1.2625 CGMCC 1.2161 CGMCC 1.1854 CGMCC 1.1878 LGG

492 665 165 912 142 215 73 81 131

± ± ± ± ± ± ± ± ±

43B 40B 20C 46A 27C 41C 24C 28C 19C

Hydrophobicity (%) 21 59 14 43 16 22 23 18 35

± ± ± ± ± ± ± ± ±

1.8C 1.4A 2.1C 1.7B 1.3C 0.8C 1.4C 1.1C 3.2B

Autoaggregation (%) 23 46 24 34 15 32 45 24 33

± ± ± ± ± ± ± ± ±

2.2C 1.8A 1.0C 1.1B 0.9D 1.5B 0.9A 1.3C 1.4B

Average values within the same column followed by different uppercase superscript letters are significantly different (P < 0.05).

6

D. Ren et al. / Anaerobe 30 (2014) 1e10

Table 5 Degradation of cholesterol and nitrite by Lactobacillus strains (n ¼ 3, mean ± SD). Strains

Cholesterol assimilation (%)

CICC 20296 CICC 23174 CICC 6233 CGMCC 1.557 CGMCC 1.2625 CGMCC 1.2161 CGMCC 1.1854 CGMCC 1.1878 LGG

74 65 35 58 33 42 38 31 39

± ± ± ± ± ± ± ± ±

3.2A 1.5AB 2.7C 1.8B 1.6C 2.4C 1.2C 2.4C 2.1C

Depletion of nitrite (%) 84 88 83 93 93 91 88 91 87

± ± ± ± ± ± ± ± ±

3.8 2.2 3.0 2.7 2.4 3.2 3.1 2.3 2.1

Table 7 Antioxidative ability of Lactobacillus strains (n ¼ 3, mean ± SD). Strains

Hydroxyl radical (%)

CICC 20296 CICC 23174 CICC 6233 CGMCC 1.557 CGMCC 1.2625 CGMCC 1.2161 CGMCC 1.1854 CGMCC 1.1878 LGG

10.37 73.19 39.88 94.26 56.71 40.41 48.33 33.91 51.21

± ± ± ± ± ± ± ± ±

0.12G 0.62B 1.14E 0.82A 0.77C 1.21E 0.68D 0.92F 1.53D

Superoxide anion (%) 51.43 62.86 57.14 74.29 40.00 65.71 51.43 51.43 54.29

± ± ± ± ± ± ± ± ±

0.11F 0.08B 0.04D 0.15A 0.11G 0.08B 0.02F 0.06F 0.13E

AeC: Data bearing different uppercase superscript letters were significantly different (P < 0.05).

Average values within the same column followed by different uppercase superscript letters are significantly different (P < 0.05).

all of the tested strains had the ability to reduce the nitrite concentration. The highest sodium nitrite depletion rates were exhibited by the strains CGMCC 1.557 (93%), CGMCC 1.2625 (93%), CGMCC 1.2161 (91%), and CGMCC 1.1878 (91%), followed by CICC 23174 (88%), CGMCC 1.1854 (88%), and LGG (87%). Although the lowest degradation rates were observed for CICC 6233 and CICC 20296, they still reached 83% and 84% depletion, respectively. These results show that all tested strains are very effective in depleting sodium nitrite.

3.9. Antibiotic resistance All the strains were kanamycin and vancomycin (except for CICC 23174) resistant, and were susceptible to tetracycline, clindamycin, streptomycin, ampicillin, gentamicin, chloramphenicol, erythromycin (except for CGMCC 1.2625) and penicillin (except for CGMCC 1.2625). (data not shown).

3.10. Antioxidative activity 3.8. Hydrogen peroxide production and antibacterial activity The strain CICC 6233, CGMCC 1.557, and CGMCC 1.2625 were strong producers of hydrogen peroxide, the strain CICC 23174, CGMCC 1.2161, and CGMCC 1.1854 were moderate, and the remaining strains were weak (data not shown). The antibacterial abilities of the nine Lactobacillus strains against bacterial pathogens were shown in Table 6. Each of the fresh overnight cultures was able to inhibit all the tested pathogens, while the resuspended cell cultures did not. The overnight cultures strongly inhibited more pathogens than the supernatant and the resuspended cultures. Most of the neutralized supernatant and resuspended cultures of lactobacilli lost inhibitory activity against E. coli, B. cereus, and S. aureus, while still maintained inhibitory activity against K. pneumoniae and S. typhimurium.

The antioxidative activities of whole cells of the tested Lactobacillus are shown in Table 7. All Lactobacillus strains exhibited antioxidative activity. The scavenging rates for hydroxyl radicals ranged from 10.37% to 94.26% and those for superoxide anion radicals ranged from 40.00% to 74.29%. The strain CGMCC 1.557 showed the highest capacity to scavenge hydroxyl radicals (94.26%) and highest capacity to scavenge superoxide anion radicals (74.29%). The CICC 23174 strain showed the second highest capacity to scavenge hydroxyl radicals (73.19%) and superoxide anion radicals (62.86%) compared with the standard probiotic strain LGG (51.21% and 54.29%, respectively). The strains CGMCC 1.1854 and CGMCC 1.1878 showed the least scavenging activity. These results demonstrated that CGMCC 1.557 and CICC 23174 expressed a remarkable antioxidative activity.

Table 6 Antimicrobial activity of Lactobacillus strains against various pathogens. Treatmentsa

Overnight

Resuspended

Supernatant

Indicator strains

E. coli B. cereus K. pneumoniae S. typhimurium S. aureus E. coli B. cereus K. pneumoniae S. typhimurium S. aureus E. coli B. cereus K. pneumoniae S. typhimurium S. aureus

Inhibition of growth by 20296b

23174

6233

1.557

1.2625

1.2161

1.1854

1.1878

LGG

þþþ þþþ þþ þþþ þþþ e e þ þþ e e e þ e e

þþþ þþþ þþþ þþþ þþþ e e þþ þþ þ e e þþ þþþ þ

þ þ þþ þþþ þ e e e þ e e e þ þþþ e

þþþ þþþ þþþ þþþ þþþ þ þ þþ þþ þ e þþ þþ þþþ e

þþþ þþþ þþþ þþþ þþþ e e e þþ þ e e þþþ þþþ e

þþþ þþþ þþ þþþ þþþ e e þþ þ e e e þþþ e e

þþþ þþþ þþþ þþþ þþþ e e þþ þ e e þþ þ e þþ

þþþ þþþ þþþ þþþ þþþ e e þ þ e e e þþ þþþ e

þþþ þþþ þþþ þþþ þþþ e e e þ e e e þþ þ e

Symbols refer to size of inhibition zone diameter observed with growing cells: e, no inhibition; þ, 1.0 mme3.0 mm (weak); þþ, 3.1 mme6.0 mm (good); þþþ, >6.0 mm (strong). a Overnight, the overnight culture broth containing lactobacilli and supernatant; Resuspended, resuspended lactobacilli in fresh MRS broth; Supernatant, supernatant adjusted to pH 6.5. b The number represent lactobacilli strains.

D. Ren et al. / Anaerobe 30 (2014) 1e10

3.11. TLR-2, TLR-4, and TLR-9 mRNA expression in Caco-2 cells The TLR gene expression in Caco-2 cells at the RNA level is shown in Table 8. Not all Lactobacillus strains stimulated the expression of TLR-2, TLR-4, and TLR-9 in Caco-2 cells. Among the tested strains, CICC 23174 (P < 0.001) and CGMCC 1.557 (P < 0.05) significantly increased the TLR-2 mRNA levels compared with the reference strain LGG. The strains CICC 23174, CICC 20296 significantly increased the TLR-4 mRNA levels (P < 0.001). The TLR-4 levels induced by CGMCC 1.557 were relatively higher than that induced by LGG, although no statistically significant differences were detected. Only CGMCC 1.1878 significantly increased the TLR9 mRNA levels (P < 0.001). The strains CICC 23174 and CGMCC 1.557 significantly modulated the expression of TLRs. 4. Discussion Screening for potential probiotics is the focus of the current research. Many efforts have been undertaken to select lactic acid bacteria (LAB) derived from the human intestinal tract and traditionally fermented foods because of their physiologic functions [22]. During the identification of new LAB strains, effective selection markers that could be used to forecast the beneficial biological effects of LAB were not yet clearly established. However, certain screening criteria for the selection of new probiotics are now being considered necessary. These screening criteria include the potential to survive and colonize the GI tract, and the functional and health promoting properties [1]. In the present study, nine Lactobacillus strains, including the reference strain LGG, were evaluated for their probiotic potential based on various previously described tests. 4.1. Survival potential in the GI tract To survive the passage through the human GI tract and exert their physiologic activity, probiotics should be able to withstand the harsh environment of gastric juices and bile salts. Acid resistance and bile tolerance are now considered the basic criteria for screening potential probiotic strains. Acid tolerance is also a prerequisite for the use of probiotics as dietary adjuncts. LAB strains survive longer in high acid carrier foods without large reductions in viable bacterial counts [23]. The capacity of lactobacilli to survive at low pH remains controversial. Charteris et al. reported that a L. delbrueckii subsp. bulgaricus strain has very poor survival rates when exposed to low pH [24]. Furthermore, Dunne et al. reported similar findings for bifidobacteria strains [25]. However, Vinderola et al. [26] reported that both L. delbrueckii subsp. bulgaricus and bifidobacteria strains survive better at pH 2. These studies showed that the capacity of LAB to survive at low pH were variable, even within the same species. In this study, all strains exhibited good

Table 8 Levels of TLRs gene expression by Caco-2 cells cocultured with Lactobacillus strains for 24 h (n ¼ 3, mean ± SD). Strains

TLR-2

CICC 20296 CICC 23174 CICC 6233 CGMCC 1.557 CGMCC 1.2625 CGMCC 1.2161 CGMCC 1.1854 CGMCC 1.1878 LGG

2.9 7.4 1.6 5.5 0.6 0.7 1.2 1.9 4.0

± ± ± ± ± ± ± ± ±

TLR-4 0.3** 0.4** 0.2 0.6** 0.3 0.2 0.4 0.4 0.9**

31.8 95.0 3.9 14.9 0.8 1.2 3.0 2.2 2.5

± ± ± ± ± ± ± ± ±

TLR-9 5.7* 24.7** 1.1 2.2 0.4 0.5 1.3 1.0 1.1

0.5 2.8 0.6 2.6 1.3 0.1 1.7 6.1 2.3

± ± ± ± ± ± ± ± ±

0.2 0.9 0.3 0.3 0.4 0.1 1.2 1.9** 1.3

*, ** indicates significant different in comparison with negative control (P < 0.01 and P < 0.001, respectively).

7

tolerance to pH 2 without any significant losses in cell count at pH 3. The relevant physiologic concentrations of human bile ranges from 0.3% to 0.5% [25]. Assessing the bile tolerance of LAB strains is important during the selection of potential probiotics [25] because the most bile-tolerant strains are strongly conducive for relieving the symptoms of lactose intolerance. A significant variability in bile tolerance has been observed among different LAB species [26]. In the present study, all of the tested strains exhibited similar bile tolerance at concentrations from 0.3% to 0.5%. Even these strains had significant resistance to 1% bile salts, which was about three times the bile concentration in the human intestines. All of the tested strains showed great acid and bile tolerance, which suggests their application potential as probiotics. The EPS produced by probiotic strains is extracellularly secreted as microbial polysaccharides present on the surface of many probiotics. These polysaccharides play an important role in fermented foods and confer significant physiologic activity [27]. The capsular structure of EPS has been shown to protect probiotic strains from unfavorable environment. For example, EPS serves as a protective agent against antibacterial ingredients, bacteriophage attack, and phagocytosis. They could also be involved in cell surface attachment. In addition, Sabir et al. suggested that probiotic strains with high EPS-producing ability exhibited high acid and bile tolerance [22]. In this study, the best EPS-producing strains were LGG (287 mg/L) and CICC 23174 (282 mg/L), followed by CGMCC 1.2625 (259 mg/L) and CGMCC 1.557 (259 mg/L), which exhibited great acid and bile tolerance. However, the poor EPS-producing strains CICC 6233 (52 mg/L) and CICC 20296 (63 mg/L) also exhibited good acid and bile tolerance, which did not correlate with the findings of Firat et al. that the quantity of EPS produced by the strains is significantly correlation with their bile tolerance. From a food microbiological point of view, the four aforementioned EPSproducing strains have potential for the production of fermented dairy products. 4.2. Colonization potential in the GI tract The capacity of lactobacilli to adhere to the epithelial cells of the host intestinal tract is suggested to play an important role in establishing prior colonization and it is involved in the exclusion of intestinal pathogens [28]. In the present study, adhesion and colonization characteristics, which could enable probiotics to exert maximum effects on the host over the long term, were measured by assessing the adhesion ability and cell surface traits of Lactobacillus. The Caco-2 cell line is commonly used as a model for assessing the ability of probiotics to adhere to human intestinal epithelial cells [29]. The ability of Lactobacillus to adhere to the epithelial cells of the host was suggested to be beneficial for probiotics because this transient intimate association is administered to exchange mediators between the bacterium and the host immune system [9] and the bacterium competes with enteric pathogens for binding sites [28]. In the present study, not all of the strains were adherent compared with the reference strain LGG, which is considered a good adherent strain [30]. However, the strains CGMCC 1.557, CICC 23174, and CICC 20296 exhibited stronger adhesion abilities than the strain LGG. Although the in vitro tests could not be directly extrapolated to in vivo situations, previous studies have shown a positive correlation between adhesion ability and transient colonization of the intestinal tract [18]. Thus, the three strains could be considered as good adherent strains. Other auxiliary experiments, such as hydrophobicity and autoaggregation, were performed because these cell surface traits are considered necessary for adhesion. These cell surface traits facilitate temporary colonization as well as protection of the host

8

D. Ren et al. / Anaerobe 30 (2014) 1e10

system because of the biofilm formation over the host tissue. Some studies showed that hydrophobicity and autoaggregation are important for promoting the colonization of probiotics in ecological niches such as the intestinal tract or the urogenital tract [18]. Kotzamanidis et al. suggested that probiotics that possess low levels of cell surface hydrophobicity, as well as low levels of autoaggregation and adhesion [9]. Kaushik et al. [10] also suggested that hydrophobicity is a very important criterion that enables probiotics to bind and reside in the host intestines for a long time. In agreement with the previous studies, our observations showed that the strains CICC 23174 and CGMCC 1.557 have relatively higher hydrophobicity (59% and 43%, respectively), along with relatively higher autoaggregation and adhesion ability, which suggest their potential immunomodulatory activity in the GI tract.

Pseudomonas aeruginosa [33]. The antibacterial effect of LAB is a result of competition for nutrients and the production of some antibacterial metabolites such as organic acids, hydrogen peroxide, and bacteriocins. In the present study, we observed that the overnight cultures strongly inhibited more pathogens than the neutralized supernatant and the resuspended cultures, indicating that the lactobacilli strains inhibited pathogens mainly by production of lactic acid. Most of neutralized supernatant and resuspended cultures of lactobacilli lost inhibitory activity against E. coli, B. cereus, and S. aureus, while still maintained inhibitory activity against K. pneumoniae and S. typhimurium, indicating that the lactobacilli strains could produce a bacteriocin like substance. Although most of the lactobacilli strains produced H2O2, no correlation was found between H2O2 production and antimicrobial activity, which was in agreement with previous studies [34].

4.3. Functional and health promoting properties 4.3.1. Cholesterol assimilation property High serum cholesterol levels are generally believed to be an important factor in cardiovascular and cerebrovascular diseases. People are looking for a safe and more effective alternative for reducing serum cholesterol because the use of drugs to lower cholesterol could cause certain side effects. Previous studies have confirmed that the consumption of fermented foods that contain Lactobacillus or Bifidobacterium spp. could help reduce the blood cholesterol concentrations in humans [31], although the exact mechanisms remained controversial. It has been reported that there was a significant relationship between the ability of lactobacilli to assimilate cholesterol in vitro and their hypocholesterolemic effect in vivo [11]. A strain with cholesterol assimilation ability in vitro also had good effect on serum cholesterol in vivo. In the present study, the strains CICC 20296, CICC 23174, and CGMCC 1.557 exhibited the highest cholesterol removal rates in the media that contained 100 mg/mL of cholesterol, reaching 74%, 65%, and 58%, respectively, which suggests their good potential for reducing cholesterol levels. Further studies will be required to determine the cholesterol-lowering ability in vivo. 4.3.2. Nitrite-depleting property Nitrite is naturally present in various foods and it has been widely used as a common additive in the food industry. Nitrite is an important N-nitrosamines precursor, which has potential to cause methemoglobinemia and carcinogenesis when nitrite-containing foods are habitually ingested. Therefore, controlling their concentration is important from the food safety standpoint. LAB have been found to deplete nitrite in many fermented foods [13,14]. Oh et al. identified four LAB species that could deplete more than 90% of sodium nitrite in foods [13]. Yan et al. also screened six LAB strains, which depleted more than 97% of the initial nitrite present in the MRS broth [14]. Although the reasons behind these observations were not clearly elucidated, Dodds et al. suggested that chemical and enzymatic depletion might be involved in the nitrite depletion [32]. The present study indicated that all tested strains, except for CICC 20296, depleted more than 85% of the initial nitrite present in the MRS broth. Therefore, these strains could be selected as candidates for inhibiting the conversion of nitrite to nitrosamines; hence, they could be used as starter cultures in fermented foods, also further studies will be needed to test the ability in real food media. 4.3.3. Antibacterial property Several studies have shown that LAB could be used as biopreservatives because of their inhibitory activity against common pathogens such as Salmonella paratyphi A, Shigella sonnei, and

4.3.4. Antibiotic resistance The transmission of antibiotic resistance genes (transmissible resistance) from probiotic strains to potentially pathogenic bacteria is a serious safety issue. Some studies reported that lactobacilli had high levels of resistance to kanamycin and vancomycin [18]. Similar results were confirmed by our study. Almost all lactobacilli strains were kanamycin and vancomycin resistant, and were susceptible to tetracycline, clindamycin, streptomycin, ampicillin, gentamicin, chloramphenicol, erythromycin and penicillin. Further studies would be required to evaluate the antibiotic resistance on the genetic basis of the examined strains. 4.3.5. Antioxidative property Antioxidant status is considered almost exclusively in the context of blood and other body tissues. The host microflora needs to tolerate endogenous and exogenous oxidative stress. The antioxidative activity of LAB protects the host microflora from attack from free radicals when LAB colonize and propagate in the GI tract. On the other hand, microorganisms that produce antioxidative factors reportedly play a key role in the prevention of diverse diseases such as cardiovascular diseases, diabetes, and ulcers of GI tract [10]. Currently, a large number of LAB strains have been investigated for their antioxidative properties. Mikelsaar et al. [35] found a new strain, L. fermentum ME-3, which possesses the desired hydroxyl radical scavenging efficiency. The consumption of L. fermentum ME-3 by healthy volunteers, has been shown to confer good antioxidative activity [36]. Lin reported the antioxidative activity of Bifidobacterium longum ATCC 15708 and L. acidophilus ATCC 4356 by scavenging free radicals [37]. In the present study, two radical systems, the hydroxyl and the superoxide anion radical systems, were used to evaluate the antioxidant effect of LAB. Our results showed that the strains CGMCC 1.557 and CICC 23174 scored higher than the reference strain LGG with respect to antioxidative activity, which suggests that these two strains have the potential to serve as an antioxidant in scavenging free radicals. 4.3.6. Immunomodulatory properties TLRs are pattern recognition receptors that recognize microbial components and initiate an innate immune response. TLR-2 mainly recognizes peptidoglycans and lipoteichoic acid, which are the main cell wall components of LAB. TLR-4 mainly recognizes the lipopolysaccharides of Gram-negative bacteria [38]. Moreover, TLR9 is involved in the recognition of CpG DNA sequences and is important for the anti-inflammatory activity of probiotic strains [39]. Currently, the studies on the expression and function of TLRs in enterocytes remained controversial [40]. Not all TLRs are expressed by all cells and the different TLR expression levels may lead to different responses to microorganisms. In the present study, the

D. Ren et al. / Anaerobe 30 (2014) 1e10

TLR-2 transcriptional level was significantly upregulated (P < 0.001) after the Caco-2 cells were coincubated with four strains (CICC 23174, CGMCC 1.557, CICC 20296, and LGG). The TLR-2 upregulation implicated that the probiotic strains in our study have the potential to keep the host in a state of alert for pathogen supervision [41]. A significant increase in TLR-4 induced by CICC 23174 and CICC 23174. This observation differed from the study by Pinto et al. [21] in which TLR-4 was not influenced by lactobacilli. This discrepancy may arise from the cell wall structures. These two strains may present cell wall structures that partially resemble ligands that bind TLR-4 [38]. Given that colonization of the GI tract with lactobacilli inhibits the adhesion of pathogens to epithelial cells, the induction of TLR4-signaling might result in health benefits by competing with Gram-negative pathogens for adhesion sites [38]. Furthermore, continual exposure to molecular patterns that contact with TLR-2 and TLR-4 stimulate cell surface and intracellular negative regulators, respectively, which reduce the production of inflammatory cytokines [42]. These cellular mechanisms are crucial to intestinal host defense and the prevention of chronic disease in the GI tract. Only one strain, CGMCC 1.1878, significantly increased the TLR-9 mRNA levels under the same experimental conditions. However, the strains CICC 23174 and CGMCC 1.557 had similar levels with the reference strain LGG. Our findings demonstrated that the strains CICC 23174 and CGMCC 1.557 have potential an immunoregulatory effect on gut homeostasis through the synergy of TLR2/4/9. In summary, all examined lactobacilli strains exhibited distinct benefits. The strains CICC 23174 and CGMCC 1.557 were the most adhesive strains producing the highest quantity of EPS. The strains CICC 20296 and CICC 23174 were the most active strains to decrease cholesterol. The strains CICC 23174 and CGMCC 1.557 were the most active strains to stimulate TLR-2 and TLR-4 expression. All the lactobacilli strains were very effective in depleting sodium nitrite. All overnight lactobacilli cultures were able to strongly inhibit the examined pathogens except for CICC 6233. Among the selected strains, CICC 23174 and CGMCC 1.557 showed the best probiotic potential and safety characteristics, and therefore could be used as potential probiotics in the production of microbial ecological agents and functional foods. Further studies would be required to evaluate the safety, immunomodulatory, and health-promoting effects of the selected strains in vivo. These studies are currently in progress in our laboratory.

Acknowledgments This work was supported by grants from the National 973 Project of China (Grant No. 2011CB512110); the National Natural Science Foundation of China (Grant No. 81001342) and and the Jilin Provincial Sci-Tech Development Project of China (20130522175JH). We thank Dr. Li P, Ren J, and Liu H for excellent technical assistance. We also thank Prof. Li C for critical reading of this manuscript and his valuable advice. Ren D and Qin Y contributed equally to this work.

References [1] Zhang J, Zhang X, Zhang L, Zhao Y, Niu C, Yang Z, et al. Potential probiotic characterization of Lactobacillus plantarum strains isolated from inner Mongolia “Hurood” cheese. J Microbiol Biotechnol 2014;24(2):225e35. [2] Konstantinov SR, Smidt H, De Vos WM, Bruijns SCM, Singh SK, Valence F, et al. S layer protein A of Lactobacillus acidophilus NCFM regulates immature dendritic cell and T cell functions. Proc Natl Acad Sci U S A 2008;105(49): 19474e9. [3] Xu H, Jeong H, Lee H, Ahn J. Assessment of cell surface properties and adhesion potential of selected probiotic strains. Lett Appl Microbiol 2009;49(4): 434e42.

9

[4] Lo Curto A, Pitino I, Mandalari G, Dainty JR, Faulks RM, John Wickham MS. Survival of probiotic lactobacilli in the upper gastrointestinal tract using an in vitro gastric model of digestion. Food Microbiol 2011;28(7):1359e66. [5] Liu CF, Tseng KC, Chiang SS, Lee BH, Hsu WH, Pan TM. Immunomodulatory and antioxidant potential of Lactobacillus exopolysaccharides. J Sci Food Agric 2011;91(12):2284e91. [6] Tulumoglu S, Yuksekdag ZN, Beyatli Y, Simsek O, Cinar B, Yas¸ar E. Probiotic properties of lactobacilli species isolated from children's feces. Anaerobe 2013;24:36e42. pez P, Strahinic I, Su ndez-García M, et al. [7] Nikolic M, Lo arez A, Kojic M, Ferna Characterisation of the exopolysaccharide (EPS)-producing Lactobacillus paraplantarum BGCG11 and its non-EPS producing derivative strains as potential probiotics. Int J Food Microbiol 2012;158(2):155e62. [8] Sugimura Y, Hagi T, Hoshino T. Correlation between in vitro mucus adhesion and the in vivo colonization ability of lactic acid bacteria: screening of new candidate carp probiotics. Biosci Biotechnol Biochem 2011;75(3):511e5. [9] Kotzamanidis C, Kourelis A, Litopoulou-Tzanetaki E, Tzanetakis N, Yiangou M. Evaluation of adhesion capacity, cell surface traits and immunomodulatory activity of presumptive probiotic Lactobacillus strains. Int J Food Microbiol 2010;140(2):154e63. [10] Kaushik JK, Kumar A, Duary RK, Mohanty AK, Grover S, Batish VK. Functional and probiotic attributes of an indigenous isolate of Lactobacillus plantarum. PLoS One 2009;4(12):e8099. [11] Wang J, Zhang H, Chen X, Chen Y, Bao Q. Selection of potential probiotic lactobacilli for cholesterol-lowering properties and their effect on cholesterol metabolism in rats fed a high-lipid diet. J Dairy Sci 2012;95(4):1645e54. [12] Pan DD, Zeng XQ, Yan YT. Characterisation of Lactobacillus fermentum SM-7 isolated from koumiss, a potential probiotic bacterium with cholesterollowering effects. J Sci Food Agric 2011;91(3):512e8. [13] Wu YY, Liu FJ, Li LH, Yang XQ, Deng JC, Chen SJ. Isolation and identification of nitrite-degrading lactic acid bacteria from salted fish[J]. Adv Mater Res 2012;393:828e34. [14] Yan PM, Xue WT, Tan SS, Zhang H, Chang XH. Effect of inoculating lactic acid bacteria starter cultures on the nitrite concentration of fermenting Chinese paocai. Food Control 2008;19(1):50e5. [15] Maldonado NC, de Ruiz CS, Otero MC, Sesma F, Nader-Macías ME. Lactic acid bacteria isolated from young calveseCharacterization and potential as probiotics. Res Vet Sci 2012;92(2):342e9. [16] Sgouras D, Maragkoudakis P, Petraki K, Martinez-Gonzalez B, Eriotou E, Michopoulos S, et al. In vitro and in vivo inhibition of Helicobacter pylori by Lactobacillus casei strain Shirota. Appl Environ Microbiol 2004;70(1):518e26. [17] Pan X, Chen F, Wu T, Tang H, Zhao Z. The acid, bile tolerance and antimicrobial property of Lactobacillus acidophilus NIT[J]. Food Control 2009;20(6):598e602. [18] Wang CY, Lin PR, Ng CC, Shyu YT. Probiotic properties of Lactobacillus strains isolated from the feces of breast-fed infants and Taiwanese pickled cabbage. Anaerobe 2010;16(6):578e85. [19] Wang A, Yi X, Yu H, Dong B, Qiao S. Free radical scavenging activity of Lactobacillus fermentum in vitro and its antioxidative effect on growingefinishing pigs. J Appl Microbiol 2009;107(4):1140e8. [20] Li X. Improved pyrogallol autoxidation method: a reliable and cheap superoxide-scavenging assay suitable for all antioxidants. J Agric Food Chem 2012;60(25):6418e24.  mez M, Seifert S, Watzl B, Holzapfel WH, [21] Vizoso Pinto MG, Rodriguez Go Franz CMAP. Lactobacilli stimulate the innate immune response and modulate the TLR expression of HT29 intestinal epithelial cells in vitro. Int J Food Microbiol 2009;133(1):86e93. [22] Sabir F, Beyatli Y, Cokmus C, Onal-Darilmaz D. Assessment of potential probiotic properties of Lactobacillus spp., Lactococcus spp., and Pediococcus spp. strains isolated from kefir. J Food Sci 2010;75(9):M568e73. [23] Liu S, Han Y, Zhou Z. Lactic acid bacteria in traditional fermented Chinese foods. Food Res Int 2011;44(3):643e51. [24] Charteris W, Kelly P, Morelli L, Collins J. Development and application of an in vitro methodology to determine the transit tolerance of potentially probiotic Lactobacillus and Bifidobacterium species in the upper human gastrointestinal tract. J Appl Microbiol 1998;84(5):759e68. [25] Dunne C, Murphy L, Flynn S, O'Mahony L, O'Halloran S, Feeney M, et al. Probiotics: from myth to reality. Demonstration of functionality in animal models of disease and in human clinical trials. Ant Leeuw Int J G 1999;76(1):279e92. [26] Vinderola C, Reinheimer J. Lactic acid starter and probiotic bacteria: a comparative “in vitro” study of probiotic characteristics and biological barrier resistance. Food Res Int 2003;36(9):895e904. [27] Kang H, Choi HS, Kim J, Han N. Exopolysaccharide-overproducing Lactobacillus paracasei KB28 induces cytokines in mouse peritoneal macrophages via modulation of NF-kb and MAPKs. J Microbiol Biotechnol 2011;21(11):1174. rzewska MA, Cooley WA, Woodward MJ, La Ragione RM. [28] Mappley LJ, Tcho Lactobacilli antagonize the growth, motility, and adherence of Brachyspira pilosicoli: a potential intervention against avian intestinal spirochetosis. Appl Environ Microbiol 2011;77(15):5402e11. [29] Deepika G, Rastall R, Charalampopoulos D. Effect of food models and lowtemperature storage on the adhesion of Lactobacillus rhamnosus GG to Caco2 cells. J Agric Food Chem 2011;59(16):8661e6. [30] von Ossowski I, Satokari R, Reunanen J, Lebeer S, De Keersmaecker SCJ, Vanderleyden J, et al. Functional characterization of a mucus-specific LPXTG surface adhesin from probiotic Lactobacillus rhamnosus GG. Appl Environ Microbiol 2011;77(13):4465e72.

10

D. Ren et al. / Anaerobe 30 (2014) 1e10

[31] Klaver F, Van der Meer R. The assumed assimilation of cholesterol by Lactobacilli and Bifidobacterium bifidum is due to their bile salt-deconjugating activity. Appl Environ Microbiol 1993;59(4):1120e4. [32] Dodds K, Collins-Thompson D. Incidence of nitrite-depleting lactic acid bacteria in cured meats and in meat starter cultures. J Food Prot 1984;47:7e10. [33] Varma P, Dinesh KR, Menon KK, Biswas R. Lactobacillus fermentum isolated from human colonic mucosal biopsy inhibits the growth and adhesion of enteric and foodborne pathogens. J Food Sci 2010;75(9):M546e51. [34] Annuk H, Shchepetova J, Kullisaar T, Songisepp E, Zilmer M, Mikelsaar M. Characterization of intestinal lactobacilli as putative probiotic candidates. J Appl Microbiol 2003;94(3):403e12. [35] Mikelsaar M, Zilmer M. Lactobacillus fermentum ME-3-an antimicrobial and antioxidative probiotic. Microb Ecol Health Dis 2009;21(1):1e27. [36] Kullisaar T, Songisepp E, Mikelsaar M, Zilmer K, Vihalemm T, Zilmer M. Antioxidative probiotic fermented goats' milk decreases oxidative stressmediated atherogenicity in human subjects. Br J Nutr 2003;90(02):449e56. [37] Lin MY, Chang FJ. Antioxidative effect of intestinal bacteria Bifidobacterium longum ATCC 15708 and Lactobacillus acidophilus ATCC 4356. Dig Dis Sci 2000;45(8):1617e22.

mez-Llorente C, Munoz S, Gil A. Role of toll-like receptors in the develop[38] Go ment of immunotolerance mediated by probiotics. Proc Nutr Soc 2010;69(3): 381e9. [39] Zhong Y, Huang J, Tang W, Chen B, Cai W. Effects of probiotics, probiotic DNA and the CpG oligodeoxynucleotides on ovalbumin-sensitized brown-Norway rats via TLR9/NF-kB pathway. FEMS Immunol Med Microbiol 2012;66(1): 71e82. [40] Furrie E, Macfarlane S, Thomson G, Macfarlane GT. Toll-like receptors-2,-3 and-4 expression patterns on human colon and their regulation by mucosalassociated bacteria. Immunology 2005;115(4):565e74. [41] Miettinen M, Veckman V, Latvala S, Sareneva T, Matikainen S, Julkunen I. Live Lactobacillus rhamnosus and Streptococcus pyogenes differentially regulate Toll-like receptor (TLR) gene expression in human primary macrophages. J Leukoc Biol 2008;84(4):1092e100. [42] Abreu MT. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol 2010;10(2): 131e44.