Bioresource Technology 162 (2014) 200–206
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Investigation of fatty acid accumulation in the engineered Saccharomyces cerevisiae under nitrogen limited culture condition Xiaoling Tang, Wei Ning Chen ⇑ School of Chemical and Biomedical Engineering, College of Engineering, Nanyang Technological University, 62 Nanyang Drive, Singapore 637459, Singapore
h i g h l i g h t s Fatty acid level was compared in S. cerevisiae strains under different conditions. Citrate was accumulated in wild type and engineered strains in reduced N2 condition. Fatty acids were increased only in the engineered strain in reduced N2 condition.
a r t i c l e
i n f o
Article history: Received 28 January 2014 Received in revised form 10 March 2014 Accepted 13 March 2014 Available online 21 March 2014 Keywords: Engineered Saccharomyces cerevisiae Nitrogen limited culture condition Fatty acid accumulation
a b s t r a c t In this study, the Saccharomyces cerevisiae wild type strain and engineered strain with an overexpressed heterologous ATP-citrate lyase (acl) were cultured in medium with different carbon and nitrogen concentrations, and their fatty acid production levels were investigated. The results showed that when the S. cerevisiae engineered strain was cultivated under nitrogen limited culture condition, the yield of mono-unsaturated fatty acids showed higher than that under non-nitrogen limited condition; with the carbon concentration increased, the accumulation become more apparent, whereas in the wild type strain, no such correlation was found. Besides, the citrate level in the S. cerevisiae under nitrogen limited condition was found to be much higher than that under non-nitrogen limited condition, which indicated a relationship between the diminution of nitrogen and accumulation of citrate in the S. cerevisiae. The accumulated citrate could be further cleaved by acl to provide substrate for fatty acid synthesis. Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction Fatty acids are important biofuel precursors since they can be widely derived for biological production of bioaldehyde, bioalcohol and bioalkane (Steen et al., 2010; Dellomonaco et al., 2010; Takisawa et al., 2013). Most of fatty acids are stored as cellular lipid components such as triacylglycerols in yeast. In the oleaginous yeasts like Candida, Cryptococcus and Rhodotorula, the intracellular lipids can be accumulated to a much higher level, compared with the non-oleaginous yeasts like Saccharomyces cerevisiae (Beopoulos et al., 2011; Ratledge, 2002). However, based on the well known genome information and metabolic pathways, the S. cerevisiae serves as an excellent model in improving the understanding of lipid metabolism (Nielsen, 2009). With the development of modern metabolic and genetic technologies, the S. cerevisiae is regarded as a potential candidate for biofuel production since it can be easily metabolically modified to be an ⇑ Corresponding author. Tel.: +65 63162870; fax: +65 62259865. E-mail address: [email protected] (W.N. Chen). http://dx.doi.org/10.1016/j.biortech.2014.03.061 0960-8524/Ó 2014 Elsevier Ltd. All rights reserved.
engineered strain with good ability in anti-phage, organic solvent tolerance and high-concentration fermentation (Sanda et al., 2011; Chen et al., 2011; Nielsen et al., 2013). The culture conditions including temperature, pH, oxygen, carbon source and nitrogen source have significant effects on yeast’s fermentation capacity and productivity (Suutari et al., 1990; Aceituno et al., 2012; Sitepu et al., 2013). It has been well studied that the lipids productivity in the oleaginous yeasts has good response to the environmental changes, especially to different carbon and nitrogen concentrations. For the oleaginous yeasts, when exposed to culture medium with excess carbon source and limited nitrogen source, more intracellular lipids are accumulated in the cells (Morita et al., 2012; Beopoulos et al., 2009; Liu et al., 2013). A well-known lipid accumulation model has been provided to explain this phenomenon in the oleaginous yeasts (Wynn et al., 2001; Ratledge and Wynn, 2002): Under nitrogen limited condition, the activity of AMP deaminase increases to compensate for the lack of nitrogen feeding and this enzyme activation will cause the decrease of mitochondrial AMP, which serves as allosteric activator for NAD+-dependent isocitrate dehydrogenase (idh). The
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
Fig. 1. Schematic diagram of fatty acid accumulation mechanism in the oleaginous yeasts under nitrogen limited culture conditions. The red line indicated the main mechanism of the accumulation process. The upward and downward arrows represented activation or inhibition of the enzymes and increase or decrease in the intermediates level. idh: NAD+-dependent isocitrate dehydrogenase; acl: ATP citrate lyase. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
diminution of AMP could depress the idh activity. More citrate will be accumulated during the citric acid cycle and transported out to cytosol by citrate transport proteins (Anoop et al., 2003). The enhanced intracellular citrate will then be cleaved by ATP-citrate lyase (acl) to acetyl-CoA for the fatty acid biosynthesis (Fig. 1). The depression of mitochondrial NAD+-dependent isocitrate dehydragenase activity is correlated with the onset of lipid accumulation and the ATP-citrate lyase is a key enzyme to provide substrate for fatty acid biosynthesis (Liu et al., 2013; Ratledge, 2002). In the S. cerevisiae, the idh existed in mitochondria is covered by two distinct subunits (idh1 and idh2) and responsible for oxidative decarboxylation of isocitrate to alpha-ketoglutarate (Wang et al., 2010). However, there is no original acl function during fatty acid synthesis process. The acetyl-CoA for fatty acid synthesis in the S. cerevisiae is mainly generated from the pyruvate–acetaldehyde–acetate pathway in cytosol (Hynes and Murray, 2010), but not from excess citrate cleavage pathway. The previous studies have indicated that if the non-oleaginous yeast, such as S. cerevisiae, was cultivated under the same nitrogen limited culture conditions as the oleaginous yeast, the cells would stop to proliferate, or they would accumulate polysaccharides such as glycogen, but no more lipids would be accumulated like in the oleaginous yeast (Beopoulos et al., 2009). Herein, a heterologous ATP-citrate lyase was cloned and expressed in the S. cerevisiae to construct a second acetyl-CoA production pathway. The culture conditions with different carbon and nitrogen concentrations were performed on both the S. cerevisiae wild type strain and engineered strain. The study was carried out to investigate the fatty acid accumulation situation in the S. cerevisiae engineered strain and by optimizing the culture condition, the engineered strain was expected to improve fatty acids production in quantity and quality, which could better serve the biofuel production. 2. Methods 2.1. Strains The S. cerevisiae wild type BY4741 (DMAT, his3D, leu2D, met15D, ura3D) was obtained from American Tissue Culture Collection (ATCC) and transferred with the pVTU260 empty vector to construct the control strain (‘‘we’’) in this study. A heterologous acl fragments from mus musculus (accession BC056378.1) hanged with 50 NheI and 30 BamHI restriction enzyme (RE) sites was obtained by the PCR procedure. The designed primers were:
201
50 (CGGCTAGC)ATGTCAGCCAAGGCAATTTCAGAGC30 for the forward strand and 50 (CGGGATCC)TTACATGCTCATGTGTTCTGGAAGA30 for the reverse strand. The PCR program was carried out as following: 95 °C for 30 s, 55 °C for 45 s, 72 °C for 3 min for one cycle, total of 30 cycles were performed. The PCR product was then purified, digested by NheI and BamHI restriction enzymes. The digested fragment was inserted into the pVTU260 vector at the same RE sites and transferred into the S. cerevisiae wild type BY4741 to construct the wt-acl engineered strain (‘‘wa’’). The expression of acl in the S. cerevisiae was determined by Western blot analysis. The anti-acl specific antibody was used as the first monoclonal antibody, to detect the expression fragment. The wild type strain with empty pVTU260 plasmid was taken as control and the protein expression levels in the ‘‘wa’’ strain under all the culture conditions were examined. The protein size detected by the Western blot from the ‘‘wa’’ strain was about 120 kDa; while no protein band from the ‘‘we’’ strain was observed (data not shown). In addition, the expression level of acl in the S. cerevisiae was found to show no obvious difference under different culture conditions (data not shown). 2.2. Cultivations Single colony of both the wild type strain and engineered strain was selected and inoculated into 50 ml conical centrifuge tubes with 5 ml minimal glucose (YNB-URA) medium: 1.7 g/l yeast nitrogen base without amino acids but with ammonium sulfate, 2% dextrose (wt/vol), 0.77 g/l URA dropout amino acid mixture, and incubated overnight on a rotary shaker at 250 rpm and 30 °C. When the cells reached stationary phase, about 2 107 of cells were injected into 250 ml flasks containing 50 ml fermentation medium: 1.7 g/l yeast nitrogen base without amino acids and ammonium sulfate, 0.77 g/l URA dropout amino acid mixture and different concentrations of dextrose and ammonium sulfate were added to detect the effects of carbon and nitrogen source on lipid production. All of the cultures were kept at 30 °C with shaking at 250 rpm. The dextrose concentration was fixed at 20, 40, 60 g/l, respectively, and the ammonium (NH+4) concentration was adjusted to 2 mM in the nitrogen-limited (NL) medium and 40 mM in the non-nitrogen limited (NNL) medium (Table 1). The pH value was kept at the same value, about at 5.0 in all of the culture mediums. The cell concentration was measured according to the value of OD600 by collecting the broth at the stationary phase and the samples were diluted to the suitable OD value for detecting. 2.3. Determination of glucose concentration The glucose concentration was determined by the anthrone– sulfuric acid method (Brányiková et al., 2011). The medium supernatant was collected and 300 ll of it was reacted with 1.5 ml anthrone solution (0.2 g anthrone in 100 ml 98% sulfuric acid) in an ice-water bath. The reaction mixture was then placed into a 100 °C water bath for 10 min. After cooling to the room temperature, the UV/Visible spectrophotometer was used to detect the absorbance of the reaction mixture at 620 nm. The standard curve was obtained by detecting the reaction absorbance of different glucose concentration at 0, 10, 20, 30, 40 60, 80 and 100 lg/ml, respectively. The glucose concentration in the supernatant was calculated according to the standard curve. 2.4. Intracellular metabolites extraction The extraction of the intracellular metabolites was carried out by a modified procedure reported before (Mal et al., 2009). 2 ml of the wild type and engineered yeast cells from different culture
202
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
Table 1 Culture medium composition with different glucose and ammonium sulfate concentration. Culture condition
YNB w/o amino acids and ammonium sulfate (g/l)
Ura Do supplement (g/ l)
Glucose concentration (g/ l)
Ammonium (NH+4) concentration (mM)
NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
1.7
0.77
20
1.7
0.77
40
1.7
0.77
60
2 40 2 40 2 40
Notes: NL, nitrogen limited condition; NNL, non-nitrogen limited condition; C20, 20 g/l glucose; C40, 40 g/l glucose; C60, 60 g/l glucose.
conditions under the same stationary phase (after 48 h) were collected, quenched by cold methanol and centrifuged at 12,000g for 5 min to remove the supernatant. The cell pellets were then washed twice with ddH2O and re-dissolved in 800 ll pure methanol. 8 ll heptadecanoic acid (C17H34O2) (2 mg/ml) were added as internal control to correct the lipid loss effects during the extraction operation. The mixes were performed in ultrasonic processor with the procedure of amplitude 50%; 0.3 s for a cycle and total of 60 cycles were carried out on each sample. After that, the samples were kept in liquid nitrogen for 5 min and went through a second running of sonication, to make sure the complete breakage of yeast cells. 300 ll chloroform and 500 ll ddH2O were then added into the samples to form a two-phase mix and vibrated for 2 h. After the chloroform phase was collected, another 300 ll chloroform was added into the remaining mix for a second time of lipid extraction. Both of the chloroform phase containing the lipid and the water phase containing the citrate were collected and evaporated to complete dryness for the GC–MS analysis.
2.5. Fatty acid derivatization The derivatization of both the free fatty acids and TAG included in lipid was carried out by the BF3/MeOH method (Sheppard and Lverson, 1975). It was started by adding 500 ll boron trifluoride solution with 14% methanol into the dried lipid-contained tubes. The reaction was carried out at 95 °C for 1 h, followed by adding 50 ll sodium chloride immediately. By this step, the TAG was cleaved to fatty acids and all the fatty acids were esterified to fatty acid methyl esters (F.A.M.E.). After cooling to room temperature, 300 ll hexane was added into the reaction tubes and vortex for half an hour to extract the F.A.M.E. The hexane phase was then transferred to GC–MS vials for analysis.
2.6. Citrate derivatization The derivatization of citrate was carried out as following (Mal et al., 2009): 50 ll methoxyamine hydrochloride (2 mg/ml in pyridine) was added into the dried samples at the first step and kept at 37 °C. After incubated for 1 h, 100 ll N-methyl-N-(trimethylsily) trifluoroacetamide with 1% of chlorotrimethylsilane were then added into the sample tubes and kept at 70 °C for another 1 h. After the reaction, the samples were taken out to room temperature and shaken for 2 h, and finally transferred to GC–MS vials for analysis. All of the derivative samples should be run by GC–MS within 24 h. Different volumes (10, 20, 40, 60, 80, 100 ll) of citrate standard (1 mg/ml) were taken into tubes and evaporated to dryness. The dried standards were performed derivative reaction according to above described method and run by GC–MS to generate standard curve. The citrate concentration in the yeast samples were calculated according to the citrate standard curve.
2.7. GC–MS analysis The prepared samples were analyzed using an Agilent 7890A and 5975C GC–MS system equipped with a DB-5 capillary column (30 m, 250 lm i.d. and 0.25 lm thickness, Agilent J&W Scientific, Folsom, CA, USA). Each 1 ll of the derivative samples were injected into the GC–MS system and separated by the DB-5 capillary column. The helium was used as carrier gas and its flow rate was kept at 1.1 ml/min. The injection temperature and the ion source temperature were set at 280 °C and 200 °C, respectively. The oven temperature process was conducted according to the following parameters: 100 °C for 4 min and then increased with a ramp of 8 °C/min to 280 °C, where with a 3 min of solvent cutoff time. The MS detection was performed in an electron ionization mode. The mass spectrum was recorded from 35 to 300 m/z, with a 0.3 s of scan time. The acquisition of chromatogram and identification of mass spectra were performed by the GC–MS solution software (Enhanced Chemstation, Agilent). The noise reduction and baseline correction were carried out prior to the peak area integration. Each peak area of added internal control standard was used to adjust and normalize the target components peak area. The F.A.M.E. standard mix (C8–C24, Sigma) was used as a reference for identification and quantification of the fatty acid derivative components from yeast cells. Different concentrations of F.A.M.E. were analyzed by GC–MS according to above procedure and the standard curves of F.A.M.E. with different length of carbon chain were obtained. The calculation of F.A.M.E. from the yeast samples were performed according to the standard curves and the final fatty acid concentration of different yeast samples were obtained depending on the F.A.M.E. concentrations. Three biological replicates were used to perform the data analysis. The mean value and standard deviation were calculated from the three experimental results. The Student’s t-test was applied to perform the statistical significance. The p-value was calculated under the model of Paired Two Sample for Means and a threshold of p < 0.05 was used to reflect the significant difference all this study. 3. Results and discussion 3.1. Effect of culture conditions with different carbon and nitrogen concentration on biomass The carbon and nitrogen source were the most important culture elements for yeast. Their metabolism provided essential energy, redox balance and intermediates for cell proliferation, fermentation activities and protein and nucleic synthesis. The cultures with different carbon and nitrogen concentrations have been studied in terms of their effects on biomass of the S. cerevisiae wild type strain and engineered strain. The glucose was selected as carbon source and fixed at 20, 40, 60 g/l respectively, while the ammonium was taken as nitrogen source and kept at 2 mM to form
203
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
3.2. Investigation of intracellular citrate level in the S. cerevisiae ‘‘we’’ and ‘‘wa’’ strains In the oleaginous yeasts, the citrate could be accumulated under nitrogen limited culture condition and this phenomenon has been demonstrated to be linked to the inactivation of mitochondrial idh, due to the decrease of cellular AMP concentration (Yang et al., 2012). However, in the non-oleaginous yeast, the idh has been predicted to have no such absolute dependency on mitochondrial AMP concentration (Wynn et al., 2001; Ratledge, 2002). In this study, the intracellular citrate level in the S. cerevisiae ‘‘we’’ strain and ‘‘wa’’ strain was investigated. It was found that the citrate level in both the ‘‘we’’ strain and ‘‘wa’’ strain showed much higher under NL culture condition than that under NNL con-
12
we-NL
we-NNL
wa-NL
NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
45
Citrate concentration ( g/ml)
the nitrogen limited (NL) condition and 40 mM to form the nonnitrogen limited (NNL) condition. The optical density value at wavelength of 600 nm (OD600) of the yeast culture samples obtained from stationary phase was taken to characterize the biomass. It was found that under culture conditions with same glucose concentration, but different nitrogen concentration, there was no difference of the biomass in the ‘‘we’’ strain and the ‘‘wa’’ strain, respectively. However, with the increase of glucose concentration in culture medium, the biomass of the two strains showed a slight increase accordingly. Meanwhile, there was no considerable biomass difference between the ‘‘we’’ strain and the ‘‘wa’’ strain under same culture conditions (Fig. 2). The residual glucose contents were detected from different culture broth of the ‘‘we’’ strain and the ‘‘wa’’ strain, and no difference was observed. Almost all of the initial add-in glucose in the medium was finally taken in by the yeast strains (Table 2). The above results reflected that the nitrogen limited culture condition did not affect the biomass of the S. cerevisiae wild type strain and the engineered strain so much, but the increased glucose concentration was somehow beneficial for the cell growth.
40 35 30 25 20 15 10 5 0
we
Strain type
wa
Fig. 3. Intracellular citrate production levels between the S. cerevisiae wild type strain with empty pVTU260 vector (‘‘we’’) and engineered strain expressing acl (‘‘wa’’) under different culture conditions. The standard deviation was calculated from three independent experimental results.
dition (Fig. 3). When exposed to NNL condition, the citrate amount was about 10–15 lg/ml in the ‘‘we’’ strain and 8–10 lg/ml in the ‘‘wa’’ strain. However, it increased to 30–40 lg/ml in the ‘‘we’’ strain and 20–30 lg/ml in the ‘‘wa’’ strain respectively under NL condition. Although the activity of idh in the S. cerevisiae was demonstrated to be non-regulated by the cellular AMP concentration, the results herein reflected that there should be some relationship between the nitrogen depletion and citrate accumulation. Besides, the phenomenon that the citrate production level was much lower in the ‘‘wa’’ strain than that in the ‘‘we’’ strain demonstrated the activity of acl, by which the accumulated citrate was consumed partially in the ‘‘wa’’ strain. 3.3. Investigation of fatty acids production levels in the S. cerevisiae wild type strain with pVTU-260 vector (‘‘we’’) under different culture conditions
wa-NNL
11
OD600
10 9 8 7 6
20
30 40 50 Glucose concentration (g/l)
60
Fig. 2. Biomass of the S. cerevisiae wild type strain and engineered strain under culture conditions with different carbon and nitrogen concentrations. The value of OD600 was taken to characterize the cell mass and yeast culture samples were selected from the stationary phase.
The fatty acid started to be bio-synthesized in yeast cells when they entered into stationary phase and mainly existed in the form of TAG included in lipid. Herein, the S. cerevisiae wild type strain with empty pVTU260 vector (‘‘we’’) were cultured under different concentrations of carbon source and nitrogen source and the fatty acids production levels were investigated. The mainly detected fatty acids were palmitoleic acid (C16:1), palmitic acid (C16:0), oleic acid (C18:1) and stearic acid (C18:0). When the ‘‘we’’ strain was exposed to culture medium with same carbon concentration but different nitrogen concentrations, neither the saturated nor the unsaturated fatty acids showed obvious differences in fatty acid production levels (Fig. 4). As the glucose concentration increased, the increase in fatty acids production was observed under both NL and NNL conditions. Under the culture condition with 20 g/l glucose, the unsaturated fatty acid palmitoleic acid yield was about 20 lg/ml and the oleic acid yield was about
Table 2 Residual glucose content in different culture medium of ‘‘we’’ and ‘‘wa’’ strains. Culture condition ‘‘we’’ ‘‘wa’’
Residual glucose (g/l)
NL-C20
NNL-C20
NL-C40
NNL-C40
NL-C60
NNL-C60
0.497 0.379
0.468 0.331
0.492 0.535
0.489 0.576
0.777 0.985
0.621 0.668
Notes: The residual glucose content was detected from the culture broth of the stationary phase; the collect time was consistent with that of the biomass detection time.
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
50
A
------ we ------
NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
Concentration ( g/ml)
45 40 35 30 25 20 15
50
------ wa ------
35 30
NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
** **
40
**
25 20
*
15
10
10
5
5
0
***
*
0
C16:1
Fatty acid type NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
B 50 45 40
C16:1
C18:1
------ we -----50
Fatty acid type NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
B
45
C18:1
------ wa ------
40
35
Concentration ( g/ml)
Concentration ( g/ml)
A
45
Concentration ( g/ml)
204
30 25 20 15 10
35 30 25 20 15 10
5
5
0 C16:0
Fatty acid type
C18:0
Fig. 4. Fatty acids production levels in the S. cerevisiae wild type strain with empty pVTU260 vector (‘‘we’’) under culture conditions with different carbon and nitrogen concentrations. The production levels of mono-unsaturated fatty acids (C16:1, C18:1) (A) and saturated fatty acids (C16:0, C18:0) (B) in cells were reflected. The standard deviation was calculated from three independent experimental results.
6 lg/ml. When the glucose increased to 60 g/l, a 35% higher yield in palmitoleic acid and a 70% higher yield in oleic acid were observed (Fig. 4A). For the saturated fatty acid palmitic acid and stearic acid, the production was about 20–30% higher under 60 g/l than that under 20 g/l (Fig. 4B). In the oleaginous yeasts, the accumulated citrate could be cleaved by acl into oxaloacetate and acetyl-CoA, to provide the starting material for fatty acid synthesis. However, in the S. cerevisiae ‘‘we’’ strain, there was no original ATP-citrate lyase activity and the accumulated citrate could not be converted to acetylCoA. Thus, the observation that no more lipids accumulated under nitrogen limited condition was reasonable.
3.4. Investigation of fatty acids production levels in the S. cerevisiae engineered strain expressing acl (‘‘wa’’) under different culture conditions In this study, the ATP-citrate lyase was cloned and expressed in the S. cerevisiae. The engineered strain (‘‘wa’’) was cultured under different concentrations of carbon source and nitrogen source and the fatty acids production levels were investigated.
0 C16:0
Fatty acid type
C18:0
Fig. 5. Fatty acids production levels in the S. cerevisiae engineered strain expressing acl (‘‘wa’’) under culture conditions with different carbon and nitrogen concentrations. The production levels of mono-unsaturated fatty acids (C16:1, C18:1) (A) and saturated fatty acids (C16:0, C18:0) (B) in cells were reflected. The standard deviation was calculated from three independent experimental results. The ‘‘asterisk’’ indicated the statistical significance of the fatty acid changes between NL and NNL condition: ⁄p < 0.05; ⁄⁄p < 0.01; ⁄⁄⁄p < 0.001.
When the ‘‘wa’’ strain was exposed to culture medium with the same carbon concentration, more fatty acids were accumulated under NL conditions. Interestingly, the mainly accumulated fatty acids were mono-unsaturated ones (C16:1 and C18:1). Compared with that under NNL condition, the observed differences was significant (p < 0.05) (Fig. 5A). The amount of palmitoleic acid under NL was at about 1.4 times to that under NNL conditions. The amount of oleic acid under NL condition was about 1.2–1.6 times to that under NNL conditions. However, the production of saturated fatty acids (C16:0 and C18:0) showed no such significant differences (p > 0.05) (Fig. 5B). Similar to the ‘‘we’’ strain, the production levels of fatty acids in the ‘‘wa’’ strain enhanced with the increase of glucose concentration, both under NL condition and NNL culture conditions. The yield of palmitoleic acid in the ‘‘wa’’ cells was about 28 lg/ml under NL condition and 20 lg/ml under NNL condition respectively when the glucose was fixed at 20 g/l. The accumulation of palmitoleic acid reached up to 36 lg/ml under NL condition and 25 lg/ml under NNL condition when the glucose concentration increased to 40 g/l. The amount further increased to 41 lg/ml under NL
205
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206 Table 3 Fold changes of specific fatty acid composition between the ‘‘we’’ strain and ‘‘wa’’ strain. Culture condition NL-C20 NNL-C20 NL- C40 NNL-C40 NL-C60 NNL-C60
Palmitoleic acid *
1.38 ± 0.171 1.04 ± 0.012 1.39 ± 0.060** 1.07 ± 0.016 1.48 ± 0.131** 1.02 ± 0.027
Palmitic acid 1.15 ± 0.041 1.13 ± 0.018 1.06 ± 0.020 1.18 ± 0.011 1.03 ± 0.012 1.12 ± 0.009*
Oleic acid
Stearic acid *
1.40 ± 0.025 1.13 ± 0.045 1.42 ± 0.121** 1.11 ± 0.090 1.62 ± 0.211*** 1.03 ± 0.068
1.08 ± 0.013 1.04 ± 0.032 1.05 ± 0.025 1.17 ± 0.018* 1.07 ± 0.009 1.08 ± 0.024
Notes: The fatty acid production levels of the ‘‘we’’ strain were taken as controls (100%), and the production levels in the ‘‘wa’’ strain were being ratio to that in the ‘‘we’’ strain. The standard deviation was calculated from three independent experiments. The ‘‘asterisk’’ indicated the statistical significance of the fatty acid changes between the ‘‘we’’ strain and ‘‘wa’’ strain: p < 0.05. ** The ‘‘asterisk’’ indicated the statistical significance of the fatty acid changes between the ‘‘we’’ strain and ‘‘wa’’ strain: p < 0.01. *** The ‘‘asterisk’’ indicated the statistical significance of the fatty acid changes between the ‘‘we’’ strain and ‘‘wa’’ strain: p < 0.001. *
condition and 28 lg/ml under NNL condition when the glucose concentration increased to 60 g/l. Similarly, the production level of oleic acid was about 9 lg/ml under NL condition and 7 lg/ml under NNL condition when the glucose was fixed at 20 g/l, and the value increased to 14, 19 lg/ml under NL condition and 10, 12 lg/ml under NNL condition respectively when the glucose concentration later increased to 40 and 60 g/l. The saturated fatty acids production levels also increased when the glucose concentration increased, however, compared with the unsaturated fatty acid, their increase did not exhibited so obviously. The study herein showed that the expression of ATP-citrate lyase made the S. cerevisiae accumulate more mono-unsaturated fatty acids under NL culture condition. With the increase of carbon concentration, the enhancement of fatty acids showed more obviously. From the above results, the intracellular citrate in the S. cerevisiae was accumulated more under high carbon concentration, and the increased fatty acids yield in the engineered strain could be benefited from this acetyl-CoA donor. The fatty acid composition in yeasts could be modified by environmental adjustment and changes of nutrition (Easterling et al., 2009; James et al., 2011; Rismani-Yazdi et al., 2012). The mono-unsaturated fatty acid accumulated in yeast could be regarded as an important role in physiological functions, such as to keep the membrane integrity and increase the resistance of yeast to elevated ethanol concentrations (Martin et al., 2007; You et al., 2003). 3.5. Comparison of fatty acids production levels between ‘‘we’’ and ‘‘wa’’ strains Compared with the ‘‘we’’ strain, the production levels of monounsaturated fatty acids in the ‘‘wa’’ strain showed about 40–60% higher under NL culture conditions and this observation was statistical significant (p < 0.05). However, under NNL culture condition, no such kind of increase was observed. Besides, the yield of saturated fatty acids production between the ‘‘wa’’ strain and the ‘‘we’’ strain also showed no significant differences. The saturated fatty acids amount in the ‘‘wa’’ strain was about 10–20% higher than that in the ‘‘we’’ strain both under NL and NNL culture conditions (Table 3). The results of the whole study reflected that the nitrogen concentration in the culture medium had no significant effect on the fatty acid production levels in the ‘‘we’’ strain since no original ATP-citrate lyase existed in the wild type strain and the intracellular citrate concentration did not affect the precursor provision for fatty acid synthesis. However, it significantly influenced that in the ‘‘wa’’ strain. A higher yield of mono-unsaturated fatty acids in the ‘‘wa’’ strain was obtained under nitrogen limited condition. The biodiesel fuels with higher ratio of mono-unsaturated fatty acid methyl esters derived from mono-unsaturated fatty acids exhibited advantages of lower viscosity, lower pour points and cloud points, which could improve the biodiesel qualities with
excellent cold flow property (Knothe, 2005). Thus, the engineered S. cerevisiae strain with capacity in enhancement of mono-unsaturated fatty acids could be an important potential candidate for biofuel production, to realize the feasibility of biodiesel production in quantity and quality. 4. Conclusions In conclusion, the results obtained in this study demonstrated that the fatty acid could be accumulated under nitrogen limited condition in the S. cerevisiae engineered strain expressing a heterologous ATP-citrate lyase. By modifying the metabolic pathway and optimizing the culture medium, the production of fatty acids, especially the long chain mono-unsaturated fatty acids in the S. cerevisiae were found significantly enhanced and this could better serve the biofuel production. Acknowledgement The authors acknowledge the funding support from the National Research Foundation of Singapore. References Aceituno, F.F., Orellana, M., Torres, J., Mendoza, S., Slater, A.W., Melo, F., Agosin, E., 2012. Oxygen response of wine yeast Saccharomyces cerevisiae EC1118 grown under carbon-sufficient, nitrogen-limited enological conditions. Appl. Environ. Microbiol. 78, 8340–8352. Anoop, V.M., Basu, U., McCammon, M.T., McAlister-Henn, L., Taylor, G.J., 2003. Modulation of citrate metabolism alters aluminum tolerance in yeast and transgenic canola overexpressing a mitochondrial citrate synthase. Plant Physiol. 132, 2205–2217. Beopoulos, A., Chardot, T., Nicaud, J.M., 2009. Yarrowia lipolytica: a model and a tool to understand the mechanisms implicated in lipid accumulation. Biochimie 91, 696-696. Beopoulos, A., Nicaud, J.M., Gaillardin, C., 2011. An overview of lipid metabolism in yeasts and its impact on biotechnological processes. Appl. Microbiol. Biotechnol. 90, 1193–1206. Brányiková, I., Maršálková, B., Doucha, J., Brányik, T., Bišová, K., Zachleder, V., Vítová, M., 2011. Microalgae—novel highly efficient starch producers. Biotechnol. Bioeng. 108, 766–776. Chen, X., Nielsen, K.F., Borodina, I., Kielland-Brandt, M.C., Karhumaa, K., 2011. Increased isobutanol production in Saccharomyces cerevisiae by overexpression of genes in valine metabolism. Biotechnol. Biofuels 4, 21–33. Dellomonaco, C., Rivera, C., Campbell, P., Gonzalez, R., 2010. Engineered respirefermentative metabolism for the production of biofuels and biochemicals from fatty acid-rich feedstocks. Appl. Environ. Microbiol. 76, 5067–5078. Easterling, E.R., French, W.T., Hernandez, R., Licha, M., 2009. The effect of glycerol as a sole and secondary substrate on the growth and fatty acid composition of Rhodotorula glutinis. Bioresour. Technol. 100, 356–361. Hynes, M.J., Murray, S.L., 2010. ATP-citrate lyase is required for production of cytosolic acetyl coenzyme A and development in Aspergillus nidulans. Eukaryot. Cell 9, 1039–1048. James, G.O., Hocart, C.H., Hillier, W., Chen, H., Kordbacheh, F., Price, G.D., Djordjevic, M.A., 2011. Fatty acid profiling of Chlamydomonas reinhardtii under nitrogen deprivation. Bioresour. Technol. 102, 3343–3351. Knothe, G., 2005. Dependence of biodiesel fuel properties on the structure of fatty acid alkyl esters. Fuel Process. Technol. 86, 1059–1070.
206
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
Liu, Z., Gao, Y., Chen, J., Imanaka, T., Bao, J., Hua, Q., 2013. Analysis of metabolic fluxes for better understanding of mechanisms related to lipid accumulation in oleaginous yeast Trichosporon cutaneum. Bioresour. Technol. 130, 144–151. Mal, M., Koh, P.K., Cheah, P.Y., Chan, E.C., 2009. Development and validation of a gas chromathography/mass spectrometry method for the metabolic profiling of human colon tissue. Rapid Commun. Mass Spectrom. 23, 487–494. Martin, C.E., Oh, C.S., Jiang, Y., 2007. Regulation of long chain unsaturated fatty acid synthesis in yeast. Biochim. Biophys. Acta 1771, 271–285. Morita, T., Fukuoka, T., Imura, T., Kitamoto, D., 2012. Accumulation of cellobiose lipids under nitrogen-limiting conditions by two ustilaginomycetous yeast, Pseudozyma aphidis and Pseudozyma hubeiensis. FEMS Yeast Res. 13, 44–49. Nielsen, J., 2009. Systems biology of lipid metabolism: from yeast to human. FEBS Lett. 583, 3905–3913. Nielsen, J., Larsson, C., van Maris, A., Pronk, J., 2013. Metabolic engineering of yeast for production of fuels and chemicals. Curr. Opin. Biotechnol. 24, 398–404. Ratledge, C., 2002. Regulation of lipid accumulation in oleaginous micro-organisms. Biochem. Soc. Trans. 30, 1047–1050. Ratledge, C., Wynn, J.P., 2002. The biochemistry and molecular biology of lipid accumulation in oleaginous microorganisms. Adv. Appl. Microbiol. 51, 1–51. Rismani-Yazdi, H., Haznedaroglu, B.Z., Hsin, C., Peccia, J., 2012. Transcriptomic analysis of the oleaginous microalga Neochloris oleoabundans reveals metabolic insights into triacylglyceride accumulation. Biotechnol. Biofuels 5, 74. Sanda, T., Hasunuma, T., Matsuda, F., Kondo, A., 2011. Repeated-batch fermentation of lignocellulosic hydrolysate to ethanol using a hybrid Saccharomyces cerevisiae strain metabolically engineered for tolerance to acetic and formic acids. Bioresour. Technol. 102, 7917–7924.
Sheppard, A.J., Lverson, J.L., 1975. Esterification of fatty acids for gas–liquid chromatographic analysis. J. Chromatogr. Sci. 13, 448–452. Sitepu, I.R., Sestric, R., Ignatia, L., Levin, D., German, J.B., Gillies, L.A., Almada, L.A., Boundy-Mills, K.L., 2013. Manipulation of culture conditions alters lipid content and fatty acid profiles of a wide variety of known and new oleaginous yeast species. Bioresour. Technol. 144, 360–369. Steen, E.J., Kang, Y., Bokinsky, G., Hu, Z., Schirmer, A., McClure, A., Del Cardayre, S.B., Keasling, J.D., 2010. Microbial production of fatty-acid-derived fuels and chemicals from plant biomass. Nature 463, 559–563. Suutari, M., Liukkonen, K., Laakso, S., 1990. Temperature adaptation in yeasts: the role of fatty acids. J. Gen. Microbiol. 136, 1469–1474. Takisawa, K., Kanemoto, K., Kartikawati, M., Kitamura, Y., 2013. Simultaneous hydrolysis-esterification of wet microalgal lipid using acid. Bioresour. Technol. 149, 16–21. Yang, F., Zhang, S., Zhou, Y.J., Zhu, Z., Lin, X., Zhao, Z.K., 2012. Characterization of the mitochondrial NAD+-dependent isocitrate dehydrogenase of the oleaginous yeast Rhodosporidium toruloides. Appl. Microbiol. Biotechnol. 94, 1095–1105. You, K.M., Rosenfield, C.L., Knipple, D.C., 2003. Ethanol tolerance in the yeast Saccharomyces cerevisiae is dependent on cellular oleic acid content. Appl. Environ. Microbiol. 69, 1499–1503. Wang, J., Jiang, J.C., Jazwinski, S.M., 2010. Gene regulatory changes in yeast during life extension by nutrient limitation. Exp. Gerontol. 45, 621–631. Wynn, J.P., Hamid, A.A., Li, Y., Ratledge, C., 2001. Biochemical events leading to the diversion of carbon into storage lipids in the oleaginous fungi Mucor circinelloides and Mortierella alpina. Microbiology 147, 2857–2864.
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Investigation of fatty acid accumulation in the engineered Saccharomyces cerevisiae under nitrogen limited culture condition Xiaoling Tang, Wei Ning Chen ⇑ School of Chemical and Biomedical Engineering, College of Engineering, Nanyang Technological University, 62 Nanyang Drive, Singapore 637459, Singapore
h i g h l i g h t s Fatty acid level was compared in S. cerevisiae strains under different conditions. Citrate was accumulated in wild type and engineered strains in reduced N2 condition. Fatty acids were increased only in the engineered strain in reduced N2 condition.
a r t i c l e
i n f o
Article history: Received 28 January 2014 Received in revised form 10 March 2014 Accepted 13 March 2014 Available online 21 March 2014 Keywords: Engineered Saccharomyces cerevisiae Nitrogen limited culture condition Fatty acid accumulation
a b s t r a c t In this study, the Saccharomyces cerevisiae wild type strain and engineered strain with an overexpressed heterologous ATP-citrate lyase (acl) were cultured in medium with different carbon and nitrogen concentrations, and their fatty acid production levels were investigated. The results showed that when the S. cerevisiae engineered strain was cultivated under nitrogen limited culture condition, the yield of mono-unsaturated fatty acids showed higher than that under non-nitrogen limited condition; with the carbon concentration increased, the accumulation become more apparent, whereas in the wild type strain, no such correlation was found. Besides, the citrate level in the S. cerevisiae under nitrogen limited condition was found to be much higher than that under non-nitrogen limited condition, which indicated a relationship between the diminution of nitrogen and accumulation of citrate in the S. cerevisiae. The accumulated citrate could be further cleaved by acl to provide substrate for fatty acid synthesis. Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction Fatty acids are important biofuel precursors since they can be widely derived for biological production of bioaldehyde, bioalcohol and bioalkane (Steen et al., 2010; Dellomonaco et al., 2010; Takisawa et al., 2013). Most of fatty acids are stored as cellular lipid components such as triacylglycerols in yeast. In the oleaginous yeasts like Candida, Cryptococcus and Rhodotorula, the intracellular lipids can be accumulated to a much higher level, compared with the non-oleaginous yeasts like Saccharomyces cerevisiae (Beopoulos et al., 2011; Ratledge, 2002). However, based on the well known genome information and metabolic pathways, the S. cerevisiae serves as an excellent model in improving the understanding of lipid metabolism (Nielsen, 2009). With the development of modern metabolic and genetic technologies, the S. cerevisiae is regarded as a potential candidate for biofuel production since it can be easily metabolically modified to be an ⇑ Corresponding author. Tel.: +65 63162870; fax: +65 62259865. E-mail address: [email protected] (W.N. Chen). http://dx.doi.org/10.1016/j.biortech.2014.03.061 0960-8524/Ó 2014 Elsevier Ltd. All rights reserved.
engineered strain with good ability in anti-phage, organic solvent tolerance and high-concentration fermentation (Sanda et al., 2011; Chen et al., 2011; Nielsen et al., 2013). The culture conditions including temperature, pH, oxygen, carbon source and nitrogen source have significant effects on yeast’s fermentation capacity and productivity (Suutari et al., 1990; Aceituno et al., 2012; Sitepu et al., 2013). It has been well studied that the lipids productivity in the oleaginous yeasts has good response to the environmental changes, especially to different carbon and nitrogen concentrations. For the oleaginous yeasts, when exposed to culture medium with excess carbon source and limited nitrogen source, more intracellular lipids are accumulated in the cells (Morita et al., 2012; Beopoulos et al., 2009; Liu et al., 2013). A well-known lipid accumulation model has been provided to explain this phenomenon in the oleaginous yeasts (Wynn et al., 2001; Ratledge and Wynn, 2002): Under nitrogen limited condition, the activity of AMP deaminase increases to compensate for the lack of nitrogen feeding and this enzyme activation will cause the decrease of mitochondrial AMP, which serves as allosteric activator for NAD+-dependent isocitrate dehydrogenase (idh). The
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
Fig. 1. Schematic diagram of fatty acid accumulation mechanism in the oleaginous yeasts under nitrogen limited culture conditions. The red line indicated the main mechanism of the accumulation process. The upward and downward arrows represented activation or inhibition of the enzymes and increase or decrease in the intermediates level. idh: NAD+-dependent isocitrate dehydrogenase; acl: ATP citrate lyase. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
diminution of AMP could depress the idh activity. More citrate will be accumulated during the citric acid cycle and transported out to cytosol by citrate transport proteins (Anoop et al., 2003). The enhanced intracellular citrate will then be cleaved by ATP-citrate lyase (acl) to acetyl-CoA for the fatty acid biosynthesis (Fig. 1). The depression of mitochondrial NAD+-dependent isocitrate dehydragenase activity is correlated with the onset of lipid accumulation and the ATP-citrate lyase is a key enzyme to provide substrate for fatty acid biosynthesis (Liu et al., 2013; Ratledge, 2002). In the S. cerevisiae, the idh existed in mitochondria is covered by two distinct subunits (idh1 and idh2) and responsible for oxidative decarboxylation of isocitrate to alpha-ketoglutarate (Wang et al., 2010). However, there is no original acl function during fatty acid synthesis process. The acetyl-CoA for fatty acid synthesis in the S. cerevisiae is mainly generated from the pyruvate–acetaldehyde–acetate pathway in cytosol (Hynes and Murray, 2010), but not from excess citrate cleavage pathway. The previous studies have indicated that if the non-oleaginous yeast, such as S. cerevisiae, was cultivated under the same nitrogen limited culture conditions as the oleaginous yeast, the cells would stop to proliferate, or they would accumulate polysaccharides such as glycogen, but no more lipids would be accumulated like in the oleaginous yeast (Beopoulos et al., 2009). Herein, a heterologous ATP-citrate lyase was cloned and expressed in the S. cerevisiae to construct a second acetyl-CoA production pathway. The culture conditions with different carbon and nitrogen concentrations were performed on both the S. cerevisiae wild type strain and engineered strain. The study was carried out to investigate the fatty acid accumulation situation in the S. cerevisiae engineered strain and by optimizing the culture condition, the engineered strain was expected to improve fatty acids production in quantity and quality, which could better serve the biofuel production. 2. Methods 2.1. Strains The S. cerevisiae wild type BY4741 (DMAT, his3D, leu2D, met15D, ura3D) was obtained from American Tissue Culture Collection (ATCC) and transferred with the pVTU260 empty vector to construct the control strain (‘‘we’’) in this study. A heterologous acl fragments from mus musculus (accession BC056378.1) hanged with 50 NheI and 30 BamHI restriction enzyme (RE) sites was obtained by the PCR procedure. The designed primers were:
201
50 (CGGCTAGC)ATGTCAGCCAAGGCAATTTCAGAGC30 for the forward strand and 50 (CGGGATCC)TTACATGCTCATGTGTTCTGGAAGA30 for the reverse strand. The PCR program was carried out as following: 95 °C for 30 s, 55 °C for 45 s, 72 °C for 3 min for one cycle, total of 30 cycles were performed. The PCR product was then purified, digested by NheI and BamHI restriction enzymes. The digested fragment was inserted into the pVTU260 vector at the same RE sites and transferred into the S. cerevisiae wild type BY4741 to construct the wt-acl engineered strain (‘‘wa’’). The expression of acl in the S. cerevisiae was determined by Western blot analysis. The anti-acl specific antibody was used as the first monoclonal antibody, to detect the expression fragment. The wild type strain with empty pVTU260 plasmid was taken as control and the protein expression levels in the ‘‘wa’’ strain under all the culture conditions were examined. The protein size detected by the Western blot from the ‘‘wa’’ strain was about 120 kDa; while no protein band from the ‘‘we’’ strain was observed (data not shown). In addition, the expression level of acl in the S. cerevisiae was found to show no obvious difference under different culture conditions (data not shown). 2.2. Cultivations Single colony of both the wild type strain and engineered strain was selected and inoculated into 50 ml conical centrifuge tubes with 5 ml minimal glucose (YNB-URA) medium: 1.7 g/l yeast nitrogen base without amino acids but with ammonium sulfate, 2% dextrose (wt/vol), 0.77 g/l URA dropout amino acid mixture, and incubated overnight on a rotary shaker at 250 rpm and 30 °C. When the cells reached stationary phase, about 2 107 of cells were injected into 250 ml flasks containing 50 ml fermentation medium: 1.7 g/l yeast nitrogen base without amino acids and ammonium sulfate, 0.77 g/l URA dropout amino acid mixture and different concentrations of dextrose and ammonium sulfate were added to detect the effects of carbon and nitrogen source on lipid production. All of the cultures were kept at 30 °C with shaking at 250 rpm. The dextrose concentration was fixed at 20, 40, 60 g/l, respectively, and the ammonium (NH+4) concentration was adjusted to 2 mM in the nitrogen-limited (NL) medium and 40 mM in the non-nitrogen limited (NNL) medium (Table 1). The pH value was kept at the same value, about at 5.0 in all of the culture mediums. The cell concentration was measured according to the value of OD600 by collecting the broth at the stationary phase and the samples were diluted to the suitable OD value for detecting. 2.3. Determination of glucose concentration The glucose concentration was determined by the anthrone– sulfuric acid method (Brányiková et al., 2011). The medium supernatant was collected and 300 ll of it was reacted with 1.5 ml anthrone solution (0.2 g anthrone in 100 ml 98% sulfuric acid) in an ice-water bath. The reaction mixture was then placed into a 100 °C water bath for 10 min. After cooling to the room temperature, the UV/Visible spectrophotometer was used to detect the absorbance of the reaction mixture at 620 nm. The standard curve was obtained by detecting the reaction absorbance of different glucose concentration at 0, 10, 20, 30, 40 60, 80 and 100 lg/ml, respectively. The glucose concentration in the supernatant was calculated according to the standard curve. 2.4. Intracellular metabolites extraction The extraction of the intracellular metabolites was carried out by a modified procedure reported before (Mal et al., 2009). 2 ml of the wild type and engineered yeast cells from different culture
202
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
Table 1 Culture medium composition with different glucose and ammonium sulfate concentration. Culture condition
YNB w/o amino acids and ammonium sulfate (g/l)
Ura Do supplement (g/ l)
Glucose concentration (g/ l)
Ammonium (NH+4) concentration (mM)
NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
1.7
0.77
20
1.7
0.77
40
1.7
0.77
60
2 40 2 40 2 40
Notes: NL, nitrogen limited condition; NNL, non-nitrogen limited condition; C20, 20 g/l glucose; C40, 40 g/l glucose; C60, 60 g/l glucose.
conditions under the same stationary phase (after 48 h) were collected, quenched by cold methanol and centrifuged at 12,000g for 5 min to remove the supernatant. The cell pellets were then washed twice with ddH2O and re-dissolved in 800 ll pure methanol. 8 ll heptadecanoic acid (C17H34O2) (2 mg/ml) were added as internal control to correct the lipid loss effects during the extraction operation. The mixes were performed in ultrasonic processor with the procedure of amplitude 50%; 0.3 s for a cycle and total of 60 cycles were carried out on each sample. After that, the samples were kept in liquid nitrogen for 5 min and went through a second running of sonication, to make sure the complete breakage of yeast cells. 300 ll chloroform and 500 ll ddH2O were then added into the samples to form a two-phase mix and vibrated for 2 h. After the chloroform phase was collected, another 300 ll chloroform was added into the remaining mix for a second time of lipid extraction. Both of the chloroform phase containing the lipid and the water phase containing the citrate were collected and evaporated to complete dryness for the GC–MS analysis.
2.5. Fatty acid derivatization The derivatization of both the free fatty acids and TAG included in lipid was carried out by the BF3/MeOH method (Sheppard and Lverson, 1975). It was started by adding 500 ll boron trifluoride solution with 14% methanol into the dried lipid-contained tubes. The reaction was carried out at 95 °C for 1 h, followed by adding 50 ll sodium chloride immediately. By this step, the TAG was cleaved to fatty acids and all the fatty acids were esterified to fatty acid methyl esters (F.A.M.E.). After cooling to room temperature, 300 ll hexane was added into the reaction tubes and vortex for half an hour to extract the F.A.M.E. The hexane phase was then transferred to GC–MS vials for analysis.
2.6. Citrate derivatization The derivatization of citrate was carried out as following (Mal et al., 2009): 50 ll methoxyamine hydrochloride (2 mg/ml in pyridine) was added into the dried samples at the first step and kept at 37 °C. After incubated for 1 h, 100 ll N-methyl-N-(trimethylsily) trifluoroacetamide with 1% of chlorotrimethylsilane were then added into the sample tubes and kept at 70 °C for another 1 h. After the reaction, the samples were taken out to room temperature and shaken for 2 h, and finally transferred to GC–MS vials for analysis. All of the derivative samples should be run by GC–MS within 24 h. Different volumes (10, 20, 40, 60, 80, 100 ll) of citrate standard (1 mg/ml) were taken into tubes and evaporated to dryness. The dried standards were performed derivative reaction according to above described method and run by GC–MS to generate standard curve. The citrate concentration in the yeast samples were calculated according to the citrate standard curve.
2.7. GC–MS analysis The prepared samples were analyzed using an Agilent 7890A and 5975C GC–MS system equipped with a DB-5 capillary column (30 m, 250 lm i.d. and 0.25 lm thickness, Agilent J&W Scientific, Folsom, CA, USA). Each 1 ll of the derivative samples were injected into the GC–MS system and separated by the DB-5 capillary column. The helium was used as carrier gas and its flow rate was kept at 1.1 ml/min. The injection temperature and the ion source temperature were set at 280 °C and 200 °C, respectively. The oven temperature process was conducted according to the following parameters: 100 °C for 4 min and then increased with a ramp of 8 °C/min to 280 °C, where with a 3 min of solvent cutoff time. The MS detection was performed in an electron ionization mode. The mass spectrum was recorded from 35 to 300 m/z, with a 0.3 s of scan time. The acquisition of chromatogram and identification of mass spectra were performed by the GC–MS solution software (Enhanced Chemstation, Agilent). The noise reduction and baseline correction were carried out prior to the peak area integration. Each peak area of added internal control standard was used to adjust and normalize the target components peak area. The F.A.M.E. standard mix (C8–C24, Sigma) was used as a reference for identification and quantification of the fatty acid derivative components from yeast cells. Different concentrations of F.A.M.E. were analyzed by GC–MS according to above procedure and the standard curves of F.A.M.E. with different length of carbon chain were obtained. The calculation of F.A.M.E. from the yeast samples were performed according to the standard curves and the final fatty acid concentration of different yeast samples were obtained depending on the F.A.M.E. concentrations. Three biological replicates were used to perform the data analysis. The mean value and standard deviation were calculated from the three experimental results. The Student’s t-test was applied to perform the statistical significance. The p-value was calculated under the model of Paired Two Sample for Means and a threshold of p < 0.05 was used to reflect the significant difference all this study. 3. Results and discussion 3.1. Effect of culture conditions with different carbon and nitrogen concentration on biomass The carbon and nitrogen source were the most important culture elements for yeast. Their metabolism provided essential energy, redox balance and intermediates for cell proliferation, fermentation activities and protein and nucleic synthesis. The cultures with different carbon and nitrogen concentrations have been studied in terms of their effects on biomass of the S. cerevisiae wild type strain and engineered strain. The glucose was selected as carbon source and fixed at 20, 40, 60 g/l respectively, while the ammonium was taken as nitrogen source and kept at 2 mM to form
203
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
3.2. Investigation of intracellular citrate level in the S. cerevisiae ‘‘we’’ and ‘‘wa’’ strains In the oleaginous yeasts, the citrate could be accumulated under nitrogen limited culture condition and this phenomenon has been demonstrated to be linked to the inactivation of mitochondrial idh, due to the decrease of cellular AMP concentration (Yang et al., 2012). However, in the non-oleaginous yeast, the idh has been predicted to have no such absolute dependency on mitochondrial AMP concentration (Wynn et al., 2001; Ratledge, 2002). In this study, the intracellular citrate level in the S. cerevisiae ‘‘we’’ strain and ‘‘wa’’ strain was investigated. It was found that the citrate level in both the ‘‘we’’ strain and ‘‘wa’’ strain showed much higher under NL culture condition than that under NNL con-
12
we-NL
we-NNL
wa-NL
NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
45
Citrate concentration ( g/ml)
the nitrogen limited (NL) condition and 40 mM to form the nonnitrogen limited (NNL) condition. The optical density value at wavelength of 600 nm (OD600) of the yeast culture samples obtained from stationary phase was taken to characterize the biomass. It was found that under culture conditions with same glucose concentration, but different nitrogen concentration, there was no difference of the biomass in the ‘‘we’’ strain and the ‘‘wa’’ strain, respectively. However, with the increase of glucose concentration in culture medium, the biomass of the two strains showed a slight increase accordingly. Meanwhile, there was no considerable biomass difference between the ‘‘we’’ strain and the ‘‘wa’’ strain under same culture conditions (Fig. 2). The residual glucose contents were detected from different culture broth of the ‘‘we’’ strain and the ‘‘wa’’ strain, and no difference was observed. Almost all of the initial add-in glucose in the medium was finally taken in by the yeast strains (Table 2). The above results reflected that the nitrogen limited culture condition did not affect the biomass of the S. cerevisiae wild type strain and the engineered strain so much, but the increased glucose concentration was somehow beneficial for the cell growth.
40 35 30 25 20 15 10 5 0
we
Strain type
wa
Fig. 3. Intracellular citrate production levels between the S. cerevisiae wild type strain with empty pVTU260 vector (‘‘we’’) and engineered strain expressing acl (‘‘wa’’) under different culture conditions. The standard deviation was calculated from three independent experimental results.
dition (Fig. 3). When exposed to NNL condition, the citrate amount was about 10–15 lg/ml in the ‘‘we’’ strain and 8–10 lg/ml in the ‘‘wa’’ strain. However, it increased to 30–40 lg/ml in the ‘‘we’’ strain and 20–30 lg/ml in the ‘‘wa’’ strain respectively under NL condition. Although the activity of idh in the S. cerevisiae was demonstrated to be non-regulated by the cellular AMP concentration, the results herein reflected that there should be some relationship between the nitrogen depletion and citrate accumulation. Besides, the phenomenon that the citrate production level was much lower in the ‘‘wa’’ strain than that in the ‘‘we’’ strain demonstrated the activity of acl, by which the accumulated citrate was consumed partially in the ‘‘wa’’ strain. 3.3. Investigation of fatty acids production levels in the S. cerevisiae wild type strain with pVTU-260 vector (‘‘we’’) under different culture conditions
wa-NNL
11
OD600
10 9 8 7 6
20
30 40 50 Glucose concentration (g/l)
60
Fig. 2. Biomass of the S. cerevisiae wild type strain and engineered strain under culture conditions with different carbon and nitrogen concentrations. The value of OD600 was taken to characterize the cell mass and yeast culture samples were selected from the stationary phase.
The fatty acid started to be bio-synthesized in yeast cells when they entered into stationary phase and mainly existed in the form of TAG included in lipid. Herein, the S. cerevisiae wild type strain with empty pVTU260 vector (‘‘we’’) were cultured under different concentrations of carbon source and nitrogen source and the fatty acids production levels were investigated. The mainly detected fatty acids were palmitoleic acid (C16:1), palmitic acid (C16:0), oleic acid (C18:1) and stearic acid (C18:0). When the ‘‘we’’ strain was exposed to culture medium with same carbon concentration but different nitrogen concentrations, neither the saturated nor the unsaturated fatty acids showed obvious differences in fatty acid production levels (Fig. 4). As the glucose concentration increased, the increase in fatty acids production was observed under both NL and NNL conditions. Under the culture condition with 20 g/l glucose, the unsaturated fatty acid palmitoleic acid yield was about 20 lg/ml and the oleic acid yield was about
Table 2 Residual glucose content in different culture medium of ‘‘we’’ and ‘‘wa’’ strains. Culture condition ‘‘we’’ ‘‘wa’’
Residual glucose (g/l)
NL-C20
NNL-C20
NL-C40
NNL-C40
NL-C60
NNL-C60
0.497 0.379
0.468 0.331
0.492 0.535
0.489 0.576
0.777 0.985
0.621 0.668
Notes: The residual glucose content was detected from the culture broth of the stationary phase; the collect time was consistent with that of the biomass detection time.
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
50
A
------ we ------
NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
Concentration ( g/ml)
45 40 35 30 25 20 15
50
------ wa ------
35 30
NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
** **
40
**
25 20
*
15
10
10
5
5
0
***
*
0
C16:1
Fatty acid type NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
B 50 45 40
C16:1
C18:1
------ we -----50
Fatty acid type NL-C20 NNL-C20 NL-C40 NNL-C40 NL-C60 NNL-C60
B
45
C18:1
------ wa ------
40
35
Concentration ( g/ml)
Concentration ( g/ml)
A
45
Concentration ( g/ml)
204
30 25 20 15 10
35 30 25 20 15 10
5
5
0 C16:0
Fatty acid type
C18:0
Fig. 4. Fatty acids production levels in the S. cerevisiae wild type strain with empty pVTU260 vector (‘‘we’’) under culture conditions with different carbon and nitrogen concentrations. The production levels of mono-unsaturated fatty acids (C16:1, C18:1) (A) and saturated fatty acids (C16:0, C18:0) (B) in cells were reflected. The standard deviation was calculated from three independent experimental results.
6 lg/ml. When the glucose increased to 60 g/l, a 35% higher yield in palmitoleic acid and a 70% higher yield in oleic acid were observed (Fig. 4A). For the saturated fatty acid palmitic acid and stearic acid, the production was about 20–30% higher under 60 g/l than that under 20 g/l (Fig. 4B). In the oleaginous yeasts, the accumulated citrate could be cleaved by acl into oxaloacetate and acetyl-CoA, to provide the starting material for fatty acid synthesis. However, in the S. cerevisiae ‘‘we’’ strain, there was no original ATP-citrate lyase activity and the accumulated citrate could not be converted to acetylCoA. Thus, the observation that no more lipids accumulated under nitrogen limited condition was reasonable.
3.4. Investigation of fatty acids production levels in the S. cerevisiae engineered strain expressing acl (‘‘wa’’) under different culture conditions In this study, the ATP-citrate lyase was cloned and expressed in the S. cerevisiae. The engineered strain (‘‘wa’’) was cultured under different concentrations of carbon source and nitrogen source and the fatty acids production levels were investigated.
0 C16:0
Fatty acid type
C18:0
Fig. 5. Fatty acids production levels in the S. cerevisiae engineered strain expressing acl (‘‘wa’’) under culture conditions with different carbon and nitrogen concentrations. The production levels of mono-unsaturated fatty acids (C16:1, C18:1) (A) and saturated fatty acids (C16:0, C18:0) (B) in cells were reflected. The standard deviation was calculated from three independent experimental results. The ‘‘asterisk’’ indicated the statistical significance of the fatty acid changes between NL and NNL condition: ⁄p < 0.05; ⁄⁄p < 0.01; ⁄⁄⁄p < 0.001.
When the ‘‘wa’’ strain was exposed to culture medium with the same carbon concentration, more fatty acids were accumulated under NL conditions. Interestingly, the mainly accumulated fatty acids were mono-unsaturated ones (C16:1 and C18:1). Compared with that under NNL condition, the observed differences was significant (p < 0.05) (Fig. 5A). The amount of palmitoleic acid under NL was at about 1.4 times to that under NNL conditions. The amount of oleic acid under NL condition was about 1.2–1.6 times to that under NNL conditions. However, the production of saturated fatty acids (C16:0 and C18:0) showed no such significant differences (p > 0.05) (Fig. 5B). Similar to the ‘‘we’’ strain, the production levels of fatty acids in the ‘‘wa’’ strain enhanced with the increase of glucose concentration, both under NL condition and NNL culture conditions. The yield of palmitoleic acid in the ‘‘wa’’ cells was about 28 lg/ml under NL condition and 20 lg/ml under NNL condition respectively when the glucose was fixed at 20 g/l. The accumulation of palmitoleic acid reached up to 36 lg/ml under NL condition and 25 lg/ml under NNL condition when the glucose concentration increased to 40 g/l. The amount further increased to 41 lg/ml under NL
205
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206 Table 3 Fold changes of specific fatty acid composition between the ‘‘we’’ strain and ‘‘wa’’ strain. Culture condition NL-C20 NNL-C20 NL- C40 NNL-C40 NL-C60 NNL-C60
Palmitoleic acid *
1.38 ± 0.171 1.04 ± 0.012 1.39 ± 0.060** 1.07 ± 0.016 1.48 ± 0.131** 1.02 ± 0.027
Palmitic acid 1.15 ± 0.041 1.13 ± 0.018 1.06 ± 0.020 1.18 ± 0.011 1.03 ± 0.012 1.12 ± 0.009*
Oleic acid
Stearic acid *
1.40 ± 0.025 1.13 ± 0.045 1.42 ± 0.121** 1.11 ± 0.090 1.62 ± 0.211*** 1.03 ± 0.068
1.08 ± 0.013 1.04 ± 0.032 1.05 ± 0.025 1.17 ± 0.018* 1.07 ± 0.009 1.08 ± 0.024
Notes: The fatty acid production levels of the ‘‘we’’ strain were taken as controls (100%), and the production levels in the ‘‘wa’’ strain were being ratio to that in the ‘‘we’’ strain. The standard deviation was calculated from three independent experiments. The ‘‘asterisk’’ indicated the statistical significance of the fatty acid changes between the ‘‘we’’ strain and ‘‘wa’’ strain: p < 0.05. ** The ‘‘asterisk’’ indicated the statistical significance of the fatty acid changes between the ‘‘we’’ strain and ‘‘wa’’ strain: p < 0.01. *** The ‘‘asterisk’’ indicated the statistical significance of the fatty acid changes between the ‘‘we’’ strain and ‘‘wa’’ strain: p < 0.001. *
condition and 28 lg/ml under NNL condition when the glucose concentration increased to 60 g/l. Similarly, the production level of oleic acid was about 9 lg/ml under NL condition and 7 lg/ml under NNL condition when the glucose was fixed at 20 g/l, and the value increased to 14, 19 lg/ml under NL condition and 10, 12 lg/ml under NNL condition respectively when the glucose concentration later increased to 40 and 60 g/l. The saturated fatty acids production levels also increased when the glucose concentration increased, however, compared with the unsaturated fatty acid, their increase did not exhibited so obviously. The study herein showed that the expression of ATP-citrate lyase made the S. cerevisiae accumulate more mono-unsaturated fatty acids under NL culture condition. With the increase of carbon concentration, the enhancement of fatty acids showed more obviously. From the above results, the intracellular citrate in the S. cerevisiae was accumulated more under high carbon concentration, and the increased fatty acids yield in the engineered strain could be benefited from this acetyl-CoA donor. The fatty acid composition in yeasts could be modified by environmental adjustment and changes of nutrition (Easterling et al., 2009; James et al., 2011; Rismani-Yazdi et al., 2012). The mono-unsaturated fatty acid accumulated in yeast could be regarded as an important role in physiological functions, such as to keep the membrane integrity and increase the resistance of yeast to elevated ethanol concentrations (Martin et al., 2007; You et al., 2003). 3.5. Comparison of fatty acids production levels between ‘‘we’’ and ‘‘wa’’ strains Compared with the ‘‘we’’ strain, the production levels of monounsaturated fatty acids in the ‘‘wa’’ strain showed about 40–60% higher under NL culture conditions and this observation was statistical significant (p < 0.05). However, under NNL culture condition, no such kind of increase was observed. Besides, the yield of saturated fatty acids production between the ‘‘wa’’ strain and the ‘‘we’’ strain also showed no significant differences. The saturated fatty acids amount in the ‘‘wa’’ strain was about 10–20% higher than that in the ‘‘we’’ strain both under NL and NNL culture conditions (Table 3). The results of the whole study reflected that the nitrogen concentration in the culture medium had no significant effect on the fatty acid production levels in the ‘‘we’’ strain since no original ATP-citrate lyase existed in the wild type strain and the intracellular citrate concentration did not affect the precursor provision for fatty acid synthesis. However, it significantly influenced that in the ‘‘wa’’ strain. A higher yield of mono-unsaturated fatty acids in the ‘‘wa’’ strain was obtained under nitrogen limited condition. The biodiesel fuels with higher ratio of mono-unsaturated fatty acid methyl esters derived from mono-unsaturated fatty acids exhibited advantages of lower viscosity, lower pour points and cloud points, which could improve the biodiesel qualities with
excellent cold flow property (Knothe, 2005). Thus, the engineered S. cerevisiae strain with capacity in enhancement of mono-unsaturated fatty acids could be an important potential candidate for biofuel production, to realize the feasibility of biodiesel production in quantity and quality. 4. Conclusions In conclusion, the results obtained in this study demonstrated that the fatty acid could be accumulated under nitrogen limited condition in the S. cerevisiae engineered strain expressing a heterologous ATP-citrate lyase. By modifying the metabolic pathway and optimizing the culture medium, the production of fatty acids, especially the long chain mono-unsaturated fatty acids in the S. cerevisiae were found significantly enhanced and this could better serve the biofuel production. Acknowledgement The authors acknowledge the funding support from the National Research Foundation of Singapore. References Aceituno, F.F., Orellana, M., Torres, J., Mendoza, S., Slater, A.W., Melo, F., Agosin, E., 2012. Oxygen response of wine yeast Saccharomyces cerevisiae EC1118 grown under carbon-sufficient, nitrogen-limited enological conditions. Appl. Environ. Microbiol. 78, 8340–8352. Anoop, V.M., Basu, U., McCammon, M.T., McAlister-Henn, L., Taylor, G.J., 2003. Modulation of citrate metabolism alters aluminum tolerance in yeast and transgenic canola overexpressing a mitochondrial citrate synthase. Plant Physiol. 132, 2205–2217. Beopoulos, A., Chardot, T., Nicaud, J.M., 2009. Yarrowia lipolytica: a model and a tool to understand the mechanisms implicated in lipid accumulation. Biochimie 91, 696-696. Beopoulos, A., Nicaud, J.M., Gaillardin, C., 2011. An overview of lipid metabolism in yeasts and its impact on biotechnological processes. Appl. Microbiol. Biotechnol. 90, 1193–1206. Brányiková, I., Maršálková, B., Doucha, J., Brányik, T., Bišová, K., Zachleder, V., Vítová, M., 2011. Microalgae—novel highly efficient starch producers. Biotechnol. Bioeng. 108, 766–776. Chen, X., Nielsen, K.F., Borodina, I., Kielland-Brandt, M.C., Karhumaa, K., 2011. Increased isobutanol production in Saccharomyces cerevisiae by overexpression of genes in valine metabolism. Biotechnol. Biofuels 4, 21–33. Dellomonaco, C., Rivera, C., Campbell, P., Gonzalez, R., 2010. Engineered respirefermentative metabolism for the production of biofuels and biochemicals from fatty acid-rich feedstocks. Appl. Environ. Microbiol. 76, 5067–5078. Easterling, E.R., French, W.T., Hernandez, R., Licha, M., 2009. The effect of glycerol as a sole and secondary substrate on the growth and fatty acid composition of Rhodotorula glutinis. Bioresour. Technol. 100, 356–361. Hynes, M.J., Murray, S.L., 2010. ATP-citrate lyase is required for production of cytosolic acetyl coenzyme A and development in Aspergillus nidulans. Eukaryot. Cell 9, 1039–1048. James, G.O., Hocart, C.H., Hillier, W., Chen, H., Kordbacheh, F., Price, G.D., Djordjevic, M.A., 2011. Fatty acid profiling of Chlamydomonas reinhardtii under nitrogen deprivation. Bioresour. Technol. 102, 3343–3351. Knothe, G., 2005. Dependence of biodiesel fuel properties on the structure of fatty acid alkyl esters. Fuel Process. Technol. 86, 1059–1070.
206
X. Tang, W.N. Chen / Bioresource Technology 162 (2014) 200–206
Liu, Z., Gao, Y., Chen, J., Imanaka, T., Bao, J., Hua, Q., 2013. Analysis of metabolic fluxes for better understanding of mechanisms related to lipid accumulation in oleaginous yeast Trichosporon cutaneum. Bioresour. Technol. 130, 144–151. Mal, M., Koh, P.K., Cheah, P.Y., Chan, E.C., 2009. Development and validation of a gas chromathography/mass spectrometry method for the metabolic profiling of human colon tissue. Rapid Commun. Mass Spectrom. 23, 487–494. Martin, C.E., Oh, C.S., Jiang, Y., 2007. Regulation of long chain unsaturated fatty acid synthesis in yeast. Biochim. Biophys. Acta 1771, 271–285. Morita, T., Fukuoka, T., Imura, T., Kitamoto, D., 2012. Accumulation of cellobiose lipids under nitrogen-limiting conditions by two ustilaginomycetous yeast, Pseudozyma aphidis and Pseudozyma hubeiensis. FEMS Yeast Res. 13, 44–49. Nielsen, J., 2009. Systems biology of lipid metabolism: from yeast to human. FEBS Lett. 583, 3905–3913. Nielsen, J., Larsson, C., van Maris, A., Pronk, J., 2013. Metabolic engineering of yeast for production of fuels and chemicals. Curr. Opin. Biotechnol. 24, 398–404. Ratledge, C., 2002. Regulation of lipid accumulation in oleaginous micro-organisms. Biochem. Soc. Trans. 30, 1047–1050. Ratledge, C., Wynn, J.P., 2002. The biochemistry and molecular biology of lipid accumulation in oleaginous microorganisms. Adv. Appl. Microbiol. 51, 1–51. Rismani-Yazdi, H., Haznedaroglu, B.Z., Hsin, C., Peccia, J., 2012. Transcriptomic analysis of the oleaginous microalga Neochloris oleoabundans reveals metabolic insights into triacylglyceride accumulation. Biotechnol. Biofuels 5, 74. Sanda, T., Hasunuma, T., Matsuda, F., Kondo, A., 2011. Repeated-batch fermentation of lignocellulosic hydrolysate to ethanol using a hybrid Saccharomyces cerevisiae strain metabolically engineered for tolerance to acetic and formic acids. Bioresour. Technol. 102, 7917–7924.
Sheppard, A.J., Lverson, J.L., 1975. Esterification of fatty acids for gas–liquid chromatographic analysis. J. Chromatogr. Sci. 13, 448–452. Sitepu, I.R., Sestric, R., Ignatia, L., Levin, D., German, J.B., Gillies, L.A., Almada, L.A., Boundy-Mills, K.L., 2013. Manipulation of culture conditions alters lipid content and fatty acid profiles of a wide variety of known and new oleaginous yeast species. Bioresour. Technol. 144, 360–369. Steen, E.J., Kang, Y., Bokinsky, G., Hu, Z., Schirmer, A., McClure, A., Del Cardayre, S.B., Keasling, J.D., 2010. Microbial production of fatty-acid-derived fuels and chemicals from plant biomass. Nature 463, 559–563. Suutari, M., Liukkonen, K., Laakso, S., 1990. Temperature adaptation in yeasts: the role of fatty acids. J. Gen. Microbiol. 136, 1469–1474. Takisawa, K., Kanemoto, K., Kartikawati, M., Kitamura, Y., 2013. Simultaneous hydrolysis-esterification of wet microalgal lipid using acid. Bioresour. Technol. 149, 16–21. Yang, F., Zhang, S., Zhou, Y.J., Zhu, Z., Lin, X., Zhao, Z.K., 2012. Characterization of the mitochondrial NAD+-dependent isocitrate dehydrogenase of the oleaginous yeast Rhodosporidium toruloides. Appl. Microbiol. Biotechnol. 94, 1095–1105. You, K.M., Rosenfield, C.L., Knipple, D.C., 2003. Ethanol tolerance in the yeast Saccharomyces cerevisiae is dependent on cellular oleic acid content. Appl. Environ. Microbiol. 69, 1499–1503. Wang, J., Jiang, J.C., Jazwinski, S.M., 2010. Gene regulatory changes in yeast during life extension by nutrient limitation. Exp. Gerontol. 45, 621–631. Wynn, J.P., Hamid, A.A., Li, Y., Ratledge, C., 2001. Biochemical events leading to the diversion of carbon into storage lipids in the oleaginous fungi Mucor circinelloides and Mortierella alpina. Microbiology 147, 2857–2864.
