bs_bs_banner
International Journal of Urology (2014) 21, 601–607
doi: 10.1111/iju.12358
Original Article: Laboratory Investigation
Intravesical hyaluronidase causes chronic cystitis in a rat model: A potential model of bladder pain syndrome/interstitial cystitis Yi Song Lv,1,2 You Sheng Yao,1* Lu Rong,1 Ming En Lin,1,3 Bi Hua Deng,1 Yun Xie,1 Hai Huang,1 Tian Xin Lin,1 Ke Wei Xu1 and Jian Huang1* 1 Department of Urology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, 2Department of Urology, First Affiliated Hospital of Fujian Medical University, Fuzhou, and 3Department of Urology, First Affiliated Hospital of Shantou University Medical College, Shantou, China
Abbreviations & Acronyms BC = bladder capacity BP = base pressure BPS = bladder pain syndrome BW-A = bodyweight after instillation BW-B = bodyweight before instillation CMG = cystometry CYP = cyclophosphamide GAG = glycosaminoglycan GAPDH = glyceraldehydes-3phosphate dehydrogenase HA = hyaluronic acid HAase = hyaluronidase HHAase = high-dose hyaluronidase IC = interstitial cystitis ICAM-1 = intercellular adhesion molecule-1 ICI = intercontraction intervals IL = interleukin LHAase = low-dose hyaluronidase mRNA = messenger ribonucleic acid PP = peak pressure PS = protamine sulfate RNA = ribonucleic acid RT–PCR = reverse transcription polymerase chain reaction RV = residual volume TNF = tumor necrosis factor UPIII = uroplakin III Zo-1 = zonula occludens-1 Correspondence: You Sheng Yao M.D., Ph.D., Department of Urology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou 510120, China. Email: [email protected]
*These two authors contributed equally to this study. Received 20 June 2013; accepted 29 October 2013. Online publication 28 November 2013 © 2013 The Japanese Urological Association
Objectives: To determine whether a potential rat model of bladder pain syndrome could be developed through long-term intermittent intravesical hyaluronidase. Methods: A total of 64 female Sprague–Dawley rats were divided into a control group, a low-dose hyaluronidase (1 mg/mL) group, a high-dose hyaluronidase (4 mg/mL) group and a hyaluronic acid-treated group. Hyaluronidase was given intravesically three times a week for 1 month. Hyaluronic acid (0.5 mL, 0.8 mg/mL) was introduced intravesically to hyaluronidasetreated rats’ bladders. Histological changes, cystometry, nociceptive behaviors, and messenger ribonucleic acid levels of inflammatory factors were evaluated and compared between groups. Results: All hyaluronidase-treated rats showed chronic inflammation and fibrosis, increased and activated mast cells, thinned bladder epithelium with abnormal expressions of uroplakin III and zonula occluden-1, and increased levels of interleukin-6 and intercellular adhesion molecule-1 messenger ribonucleic acid. However, the inflammatory score and levels of interleukin-6 and intercellular adhesion molecule-1 were more significant in the high-dose hyaluronidase group than in the low-dose hyaluronidase group (P < 0.01). Furthermore, hyaluronidase-treated rats showed markedly decreased intercontraction intervals, bladder capacity and increased sensitivity to pain compared with controls (P < 0.01). Hyaluronic acid treatment significantly decreased the inflammatory level, number of mast cells, sensitivity to pain, levels of interleukin-6 and intercellular adhesion molecule-1, and increased intercontraction intervals and bladder capacity (P < 0.01). Conclusions: Long-term intermittent intravesical hyaluronidase could develop a severe chronic cystitis with diffused fibrosis accompanied by altered histology and bladder function. This chronic cystitis rat model can resemble the clinical and histopathological features of human bladder pain syndrome, and might be a potential valuable model for investigation of this troublesome disease.
Key words: animal model, bladder pain syndrome, cystitis, hyaluronidase, rat.
Introduction BPS/IC is a chronic inflammatory disease defined as “chronic pelvic pain, pressure or discomfort perceived to be related to the urinary bladder, with at least one other urinary symptom, such as persistent urge to void or urinary frequency”. The European Society for the Study of Interstitial Cystitis believed that the name BPS better complied with present knowledge than the term IC or PBS.1 BPS occurs mostly in women, and the estimated ratio of men to women affected by this disorder is 1:5.2 The etiology of BPS is still unknown, making the treatment quite challenging. Therefore, an effective translational model of BPS would be very useful for testing potential therapies. Existing BPS models, including chemicals intravesical instillation, intraperitoneal injection of CYP, autoimmune cystitis, neurogenic inflammation and so on often only emulate part of conditions rather than the complete clinical process of BPS.3 An autoimmune cystitis model has been applied in the study of chronic cystitis, but lacks variables in pain.4 In addition, many features of the autoimmune cystitis model are non-specific, and it is not generally agreed that patients with BPS are predisposed to autoimmune disease.3 The CYP-induced cystitis is used extensively to study the pain reaction, but the main change of the bladder is acute inflammation (e.g. infiltration of leukocyte, congestion, edema).5 The animal model of PS-induced cystitis was 601
YS LV ET AL.
extensively used for studies on inflammation and the frequency of BPS.6–8 However, PS was given just one to two times in these models. Therefore, the histological changes showed that acute inflammation and degree of inflammation was not severe. Many hypotheses had been proposed to interpret the pathogenesis of BPS, such as increased permeability of urothelium, infection, autoimmunity, mast cell activation, neural inflammation and so on,9 of which, increased urothelial permeability has been drawing growing interest, including the representative theories of deficient GAG and increased APF.10,11 Parsons found that the GAG layer decreased substantially in patients with BPS, resulting in the loss of the normal permeability barrier.10 Subsequent animal experiments showed that urine could cause bladder inflammation and hyperactivity through destruction of the GAG layer.7,8,12 Although deficient GAG and the consequent leaky urothelium might not be the root cause, it is generally considered as one of the most important factors in the development of BPS and possibly progression into the chronic phase.13 Some investigators believed that a defect in the GAG layer might be the first step in the development of chronic inflammatory diseases of the bladder.14 The GAG layer, composed of hyaluronic acid, heparin sulfate, dermatan sulfate, chondrointin sulfate and keratan sulfate,15 covers the bladder epithelium and forms a biofilm functioning essentially as an impermeable barrier to solutes. HAase is a type of endoglycosidase, which can hydrolyze extracellular matrix including hyaluronic acid, heparin sulfate and chondrointin sulfate.16 Meuwese et al. established an atherosclerosis model by administering HAase continuously through the jugular vein.17 HAase could degrade GAG on the endothelial cell surface and effectively increase microvascular permeability, allowing entry of substances in blood into the vascular subendothelial layer. According to this theory, we hypothesized that HAase could also degrade the GAG layer of the bladder epithelium. As HA, based on GAG replacement theory, was effective in the treatment of BPS,18 we conversely put forward a new animal model of chronic cystitis by destroying the GAG layer with HAase, which could be a potential model for BPS studies. Chronic disease in organs might ultimately cause changes to the central nervous system, leading to a collection of symptoms, which means only a model of long-term chronic inflammation and pain can best mimic actual BPS. In the present study, we established a new rat model by long-term intermittent intravesical HAase, and found that symptoms and histopathological changes of this model bear a strong resemblance to those of human BPS.
Methods Animal model Adult Sprague–Dawley female rats (n = 64) were used (weight 250–300 g). All experimental protocols and procedures were approved by the Sun Yet-sen University Institutional Animal Care and Use Committee. All rats were randomized into the low-dose HAase (1 mg/mL, 400–1000U/mg; Sigma-Aldrich, St. Louis, MO, USA; LHAase) group, high-dose HAase (4 mg/mL, 400–1000U/mg; Sigma-Aldrich; HHAase) group, HA-treated group and control group, with 16 rats in each 602
group. Rats were anesthetized with isoflurane/oxygen (5% induction/2% maintenance). In the HAase-treated groups, a PE-50 catheter (Clay Adams, Parsippany, NJ, USA) was inserted into the bladder through the urethra to empty the bladder, and then 0.5 mL HAase (1 mg/mL or 4 mg/mL) was infused intravesically for 30 min. In the HA-treated group, 6 h after HAase (1 mg/mL) instillation, the rats were intravesically instilled with 0.5 mL of HA (0.8 mg/mL, Bioniche, Belleville, Ontario, Canada) at each time.12,19 In the control group, 0.5 mL saline was infused following the same procedure. All the rats were treated three times a week for 1 month and killed by carbon dioxide asphyxia within 72 h after the last dose.
Nociceptive behavioral study Nociceptive behavioral study in rats was carried out as described previously.5,20 Each rat (n = 16 in each group) was placed on a raised wire-mesh floor under a transparent plastic box, and acclimated to the experimental environment for 1 h. Mechanical stimulation was applied to the skin region between the anus and external urethral orifice of rats, using five distinct von Frey filaments (Stoelting, Wood Dale, IL, USA) with ascending strength of 0.008, 0.07, 0.4, 1.0 and 4.0 g in turn. The mechanical stimulation with each filament was applied 10 times at intervals of 5–10 s. Scoring of nociceptive behavior was defined as follows: 0, no response; 1, licking or biting of the external urethral opening and/or the surrounding area, leaving the position, bending of the trunk, raising the upper half of the body, thrashing limbs and jumping. The data were expressed as the total score of responses to 10 challenges with each filament.
CMG CMG was carried out as described previously.19 The rats were (n = 8 in each group) prohibited from drinking water 12 h before CMG, and their bladders were emptied before cystometry. The rats were then anesthetized with urethane (1.2 g/kg, subcutaneously). Filling cystometry was carried out under anesthesia at a rate of 10 mL/h through a urethral PE 50 catheter. The urethral catheter was connected to a syringe pump and pressure transducer through a three-way stopcock. The following parameters were recorded: BP, PP, ICI, BC and RV. These rats were killed by carbon dioxide asphyxia immediately after CMG.
Histopathology Bladders (the remaining 8 rats of each group) were harvested and divided longitudinally into two sections. Half of the tissues were frozen at −80°C and used for real-time RT–PCR. The other half of the tissues were fixed (10% buffered formalin × 48h), embedded in paraffin, cut into 5-μm transverse sections, and stained with hematoxylin–eosin and toluidine blue. Bladder inflammation was assessed using a four-point scoring system (0, morphologically unremarkable with no or minimal inflammation or epithelial changes; 1, mild inflammatory infiltrate within the lamina propria, accompanied by mild chronic edema, hemorrhage or urothelial changes, fibrosis scattered in the lamina propria; 2, moderate inflammatory infiltrate in the lamina propria and focal extension of the inflammation into the muscularis propria, accompanied by moderate chronic edema, © 2013 The Japanese Urological Association
New potential rat model of BPS
Table 1
Primers used for real-time RT–PCR
Name
Forward primer (5'–3')
Reverse primer (5'–3')
Size (bp)
IL-1β IL-6 TNF-α ICAM-1 GAPDH
TCCTCTGTGACTCGTGGGAT AGAGACTTCCAGCCAGTTGC TCGTCTACTCCTCAGAGCCC AGACACAAGCAAGAGAAGAA TGCACCACCAACTGCTTAG
TCAGACAGCACGAGGCATTT AGCCTCCGACTTGTGAAGTG ACTTCAGCGTCTCGTGTGTT GAGAAGCCCAAACCCGTATG AGTGGATGCAGGGATGATGT
109 142 128 234 180
hemorrhage, urothelial changes, fibrosis diffused in the lamina propria; 3, severe inflammation in the lamina propria and muscularis propria in association with other significant findings, such as urothelial ulceration, severe chronic edema, hemorrhage, and diffused fibrosis through the bladder) and determined by a pathologist in a blinded fashion in the Department of Pathology at Sun Yat-sen Memorial Hospital. The sections stained with toluidine blue were used for mast cells counts.
Immunohistochemistry The EnVison two-step method was applied in immunohistochemistry using ChemMate Envision+ Detection Kit (DakoCytomation; Dako, Glostrup, Denmark) with 1:50 diluted UPIII polyclonal antibody (Santa Cruz, CA, USA) and Zo-1 polyclonal antibody (Santa Cruz). UPIII was scored as normal: found only on the luminal layer; and abnormal: weak on the luminal layer or distributed throughout the urothelium. Zo-1 was scored as normal: evenly distributed throughout the urothelium, mainly in the surface of the epithelial cells; and abnormal: uneven, decreased or absent, as well as distributed mainly in cytoplasm.
Real-time RT–PCR Total RNA was extracted from different tissues and reverse transcribed into cDNA using the Takara system (Takara, Ostu, Japan) according to the manufacturer’s manual. Real-time RT–PCR was carried out with a Real-Time PCR System (GeneAmp PCR System 9700; ABI, Foster City, CA, USA) in a 25-uL volume using SYBR Green PCR Master Mix (Fermentas, Ontario, Canada; Table 1).
Statistical analysis All data are represented as the mean ± standard deviation. Statistical significance was evaluated using Student’s t-test or oneway ANOVA with Bonferroni correction. P-values 0.05; Table 2). In CMG, ICI and BC significantly decreased in the HAase-induced rats compared with the controls (P < 0.01; Fig. 3, Table 2). In addition, sensitivity to pain increased significantly in the HAase-induced rats (P < 0.01; Fig. 4). However, there was no significant difference in urodynamic changes and sensitivity to pain between the LHAase group and the HHAase group (P > 0.05; Fig. 3b,c, Table 2). After administration of HA, compared with the LHAase group, the nociceptive score of the rats decreased significantly, whereas ICI and BC increased significantly (P < 0.01; Fig. 3,4, Table 2).
Expression of IL-1β, IL-6, TNF-α and ICAM-1 The levels of IL-6 and ICAM-1 mRNA increased gradually in the HAase-treated groups, with the HHAase group ranking the highest compared with the control group and the LHAase group (P < 0.01), whereas they decreased significantly after HA treatment compared with the LHAase group (P < 0.01). However, no statistically significant differences were observed in expression of IL-1β and TNF-α mRNAs among the four groups (P > 0.05; Fig. 5).
Discussion In the present study, we created a new chronic cystitis model in female rats by long-term intermittent intravesical HAase, which resembles clinical BPS with the following characteristics: (i) morphological changes: chronic inflammatory invasion of the full thickness of the bladder wall, thickened lamina propria, thinned or partially missing urothelium, increased number and active mast cells, hyperplasia of new-born small vessels, and diffused fibrosis; (ii) functional changes: increased micturition 603
YS LV ET AL.
Control
LHAase
(i)
HHAase
(J) 4
60 *#
3.5 3
* 50
2.5 2 1.5
*
*
#
No. mast cells
Inflammatory score
HA-treated
40 30 20
#
1 0.5 0
10 0
Fig. 1 Representative images of hematoxylin–eosin stained (magnification: ×100) and toluidine blue stained (magnification: ×200) bladders. (a,e) Control rats, (b,f) LHAase rats, (c,g) HHAase rats, (d,h) HA-treated rats, (i) inflammatory score and (J) number of mast cells. LHAase and HHAase rats showed chronic inflammatory and fibrosis signs: diffuse monocytes or lymphocytes infiltration, small vascular proliferation, fibrin deposition and localized urothelium thinning. Arrows indicate clustered inflammatory cells, even extension into the muscularis propria in HHAase rat. After HA treatment, the bladder epithelium repaired and inflammatory cells were scattered. The number of mast cells significantly increased in both of LHAase and HHAase groups, whereas they decreased after HA treatment. *P < 0.01 (vs the control group), #P < 0.01 (vs the LHAase group). , Control; , LHAase; , HHAase; , HA-treated.
Fig. 2 Representative immunohistochemical images of (a–d) UPIII and (e–h) Zo-1 (magnification ×400). (a,e) Control rats, (b,f) LHAase rats, (c,g) HHAase rats and (d,h) HA-treated rats. UPIII and Zo-1 were abnormal in the LHAase and HHAase rats, but they were almost normal in the HA-treated rats.
604
© 2013 The Japanese Urological Association
New potential rat model of BPS
Table 2
Comparison of CMG parameters among controls, LHAase-, HHAase- and HA-treated groups
Groups
ICI (s)
BC (mL)
RV (mL)
BP (mmHg)
PP (mmHg)
BW-B (g)
BW-A (g)
Control LHAase HHAase HA-treated
467.4 ± 17.2 119.0 ± 22.1* 113.1 ± 17.1* 328.3 ± 36.5**
1.31 ± 0.05 0.34 ± 0.06* 0.32 ± 0.05* 0.87 ± 0.09**
0.23 ± 0.03 0.25 ± 0.03 0.27 ± 0.05 0.26 ± 0.08
5.13 ± 1.25 5.50 ± 0.93 5.38 ± 1.19 5.09 ± 1.33
27.63 ± 0.92 31.00 ± 1.85* 29.75 ± 1.28* 31.75 ± 1.79*
273.4 ± 10.3 277.3 ± 11.2 281.4 ± 11.4 275.4 ± 11.3
287.3 ± 22.5# 280.1 ± 15.6 276.4 ± 15.7 275.8 ± 17.8
*P < 0.01 vs the control group; **P < 0.01 vs the LHAase group; #P < 0.01 BW-B vs BW-A.
12 40 mmHg
(a)
*
10
*
1 min
40 mmHg
(b)
Nociceptive score
* #
8 #
*
6 4 *
0 1 min (c)
# #
2 # 0.008
0.07
0.4
1
4
40 mmHg
Stimulus intensity (g)
1 min
40 mmHg
(d)
1 min Fig. 3 Representative cystometry. (a) Control rats, (b) LHAase rats, (c) HHAase rats and (d) HA-treated rats. The CMG showed that rats urinated more frequently after HAase treatment, but the urinary frequency was comparable between the LHAase group and HHAase group. HA treatment decreased the frequency.
frequency, decreased volume per micturition, increased bladder hyperactivity and sensitivity to pain; (iii) changes of inflammatory factors: levels of IL-6 and ICAM-1 increased, but levels of IL-1β and TNF-α showed no change. BPS is a chronic pelvic pain syndrome related to the bladder with high prevalence. The pathogenesis of BPS is still unclear. Among those controversial hypotheses of BPS etiology, the absence of the GAG layer and increased permeability of the urothelium are generally considered as the key points of the BPS process.10,13 Whatever the initiating factors of BPS are, the continuous absence of the GAG layer might eventually lead to pathological changes and clinical manifestations. In 1990, © 2013 The Japanese Urological Association
Fig. 4 Scoring of nociceptive behavior. In each stimulus intensity, rats of the LHAase group and HHAase group presented significantly higher scores compared with the controls, though there was not a significant difference between the LHAase group and HHAase group. After HA treatment, the nociceptive score decreased in each stimulus intensity. *P < 0.01 (vs the control group), #P < 0.01 , Control; , LHAase; , HHAase; , (vs the LHAase group). HA-treated.
the San Diego group first found that PS could destroy the GAG layer by neutralizing the component of heparin.6 The PS-induced cystitis animal model was widely used to mimic histological and functional features of clinical BPS in many studies.7,8,12 Different from the single substrate of PS, HAase can hydrolyze most of the components of the GAG layer including hyaluronic acid, heparin sulfate, chondroitin sulfate and so on,16 and hence destroy the GAG layer, increase permeability of bladder epithelium, allow entry of harmful substances of urine into bladder wall and trigger inflammation process.8 The hypothesis was confirmed in our trial by abnormal expression of UPIII and Zo-1, and locally thinned or missing epithelium, which mean increased permeability of the bladder epithelium. UPIII and Zo-1 were effective variables for evaluating the permeability of the bladder epithelium, and their levels were abnormal in BPS patients.21,22 The persistent absence of GAG layer is the motivating factor of the inflammation process in our new model. ICAM-1, an important inflammatory factor, increases and plays a great role in the development of BPS, which can be suppressed by HA through blockage of ICAM-1 receptor as well as inhabitation of adherence, and immigration of immune complex and polymorphonuclear cells.12,23,24 In our trial, the 605
YS LV ET AL.
0.8
Relative gene expression
0.7 0.6
*#
0.5 *
0.4
*# #
0.3
*
0.2
# 0.1 0 IL-1β
IL-6
TNF-α
ICAM-1
Fig. 5 RT–PCR of inflammatory factors mRNA in the bladder. Relative quantities of IL-1β, IL-6, TNF-α and ICAM-1 mRNAs were normalized by GAPDH mRNA. *P < 0.01 (vs the control group), #P < 0.01 (vs the LHAase group). , Control; , LHAase; , HHAase; , HA-treated.
level of ICAM-1 increased along with the severity of inflammation, which suggested that ICAM-1 might be a contributing factor in the inflammation. When the effect of HAase was counteracted by HA, the level of ICAM-1 decreased. Because HA can block the receptor of ICAM-1, after hydrolysis of HA, the pro-inflammatory effect of ICAM-1 was amplified. Therefore, HAase might exacerbate the inflammatory process of this model through twofold effects: first of all, HAase can destroy the GAG layer and active the inflammatory process; secondly, HAase can amplify the pro-inflammatory effect of ICAM-1 by hydrolysis of HA, and further promote the inflammatory process of this model. The second mechanism is also the reason why HHAase induced more severe inflammation than LHAase. In contrast, a different dose of HAase can cause inflammation to a different degree, which makes it a potentially more effective model for the study of the inflammatory mechanism and therapies of cystitis. During past research on BPS, IL-1β, IL-6 and TNF-α have been the most studied factors that are linked to inflammation.25 In the present study, levels of IL-1β and TNF-α, which are usually increased in acute inflammation, did not change; whereas the level of IL-6 increased along with the severity of inflammation. The present results were similar to those of some experimental or clinical trials in BPS.12,19,26 IL-6, as an important factor in acute and chronic inflammation, has a strong relationship with bladder fibrosis and detrusor overactivity,27,28 and can be used as an objective indicator for the inflammatory process of the BPS model and an effective assessment for therapeutic impact.19 In the present study, intermittent intravesically administered HAase acted as a long-term, but mild inflammatory stimulus, and the instillation of HAase did no harm the rats’ health. Thereafter, the weight of the rats maintained a relatively stable platform after HAase instillation. We referred to the dose of HAase in the study Meuwese et al., and HAase-treated rats were divided into LHAase and HHAase groups.17 There was s significant difference in inflammatory degree between them. 606
However, there were no changes in CMG, with the possible reasons as follows: (i) this rat model is of chronic cystitis instead of an acute cystitis, and long-term intermittent intravesical HAase, even at a different dose, causes severe changes of cystometric parameters, which have reached similar peaks at that time, and it is difficult to detect the differences; (ii) the results of CMG could be affected by many factors including inflammatory degree and the changes of central threshold and so on. Long-term chronic cystitis might cause similar changes in the central nerve system, which results in similar changes of CMG even when the triggering dose is different. Bladder-related pain or discomfort is an important feature of BPS, but measurements of visceral pain in animal models are scarce. Vera-Portocarrero LP et al. used von Frey filaments to stimulate the abdominal area by measuring the change of pain in a rat model of pancreatitis.20 Miki et al. stimulated the skin region between the anus and urethral opening of mice to assess the change of the referred hyperalgesia in a CYP-induced cystitis model.5 Inspired by these reports, we stimulated the skin region between the anus and urethral opening of rat. Because of the long-term inflammatory stimulation, the peripheral and central pain sensitivity might have been increased, which led to the chronic pain. As we had conjectured, the referred hyperalgesia of HAase-induced rats increased. However, the result of von Frey filaments could be affected easily by environmental changes. Therefore, this method is not suitable for minor lesions, whereas it can be used in the severe chronic inflammatory pain of the present study. In the future, perhaps the in vivo patch-clamp technique could be used to measure the change of pain more precisely. The present study showed that long-term intermittent intravesical HAase could develop a severe chronic cystitis with diffused fibrosis accompanied by altered histology and bladder function. This novel chronic cystitis rat model can closely resemble the clinical and histopathological features of human BPS, and might be a potentially valuable model for investigation of this troublesome disease.
Acknowledgments This work was supported by grants from the Science and Technology Project of Guangdong Province (No. 2009B030801148) and the Youth Project of the National Natural Science Foundation of China (No. 81101947).
Conflict of interest None declared.
References 1 van de Merwe JP, Nordling J, Bouchelouche P et al. Diagnostic criteria, classification, and nomenclature for painful bladder syndrome/interstitial cystitis: an ESSIC proposal. Eur. Urol. 2008; 53: 60–7. 2 Wein AJ, Hanno PM. Targets for therapy of the painful bladder. Urology 2002; 59: 68–73. 3 Westropp JL, Buffington CA. In vivo models of interstitial cystitis. J. Urol. 2002; 167: 694–702. 4 Altuntas CZ, Daneshgari F, Sakalar C et al. Autoimmunity to uroplakin II causes cystitis in mice: a novel model of interstitial cystitis. Eur. Urol. 2012; 61: 193–200. © 2013 The Japanese Urological Association
New potential rat model of BPS
5 Miki T, Matsunami M, Nakamura S, Okada H, Matsuya H, Kawabata A. ONO-8130, a selective prostanoid EP1 receptor antagonist, relieves bladder pain in mice with cyclophosphamide-induced cystitis. Pain 2011; 152: 1373–81. 6 Parsons CL, Boychuk D, Jones S, Hurst R, Callahan H. Bladder surface glycosaminoglycans: an epithelial permeability barrier. J. Urol. 1990; 143: 139–42. 7 Chuang YC, Chancellor MB, Seki S et al. Intravesical protamine sulfate and potassium chloride as a model for bladder hyperactivity. Urology 2003; 61: 664–70. 8 Soler R, Bruschini H, Freire MP, Alves MT, Srougi M, Ortiz V. Urine is necessary to provoke bladder inflammation in protamine sulfate induced urothelial injury. J. Urol. 2008; 180: 1527–31. 9 Grover S, Srivastava A, Lee R, Tewari AK, Te AE. Role of inflammation in bladder function and interstitial cystitis. Ther. Adv. Urol. 2011; 3: 19–33. 10 Parsons CL. The role of a leaky epithelium and potassium in the generation of bladder symptoms in interstitial cystitis/overactive bladder, urethral syndrome, prostatitis and gynaecological chronic pelvic pain. BJU Int. 2011; 107: 370–5. 11 Keay SK, Szekely Z, Conrads TP et al. An antiproliferative factor from interstitial cystitis patients is a frizzled 8 protein-related sialoglycopeptide. Proc. Natl. Acad. Sci. U.S.A. 2004; 101: 11803–8. 12 Shao Y, Lu GL, Shen ZJ, He HC. Reduction of intercellular adhesion molecule 1 may play a role in anti-inflammatory effect of hyaluronic acid in a rat model of severe non-bacterial cystitis. World J. Urol. 2013; 31: 535–40. 13 Hanno P, Lin AT, Nordling J et al. Hypothesis of etiologic cascade of bladder pain syndrome. In: Abrams P, Cardozo L, Khoury S, Wein A (eds). Incontinene. Health Publication Ltd., Paris, 2009; 1459–518. 14 Bassi PF, Costantini E, Foley S et al. Glycosaminoglycan therapy for bladder diseases: emerging new treatments. Eur. Urol. Suppl. 2011; 10: 451–9. 15 Teichman JM, Moldwin R. The role of the bladder surface in interstitial cystitis/painful bladder syndrome. Can. J. Urol. 2007; 14: 3599–607. 16 Girish KS, Kemparaju K. The magic glue hyaluronan and its eraser hyaluronidase: a biological overview. Life Sci. 2007; 80: 1921–43. 17 Meuwese MC, Broekhuizen LN, Kuikhoven M et al. Endothelial surface layer degradation by chronic hyaluronidase infusion induces proteinuria in apolipoprotein E-deficient mice. PLoS One 2010; 5: e14262.
© 2013 The Japanese Urological Association
18 Lv YS, Zhou HL, Mao HP, Gao R, Wang YD, Xue XY. Intravesical hyaluronic acid and alkalinized lidocaine for the treatment of severe painful bl adder syndrome/interstitial cystitis. Int. Urogynecol. J. 2012; 23: 1715–20. 19 Lv YS, Yao YS, Lin ME et al. Interleukin-6 levels in female rats with protamine sulfate-induced chronic cystitis treated with hyaluronic acid. Int. J. Urol. 2013; 20: 1017–22. 20 Vera-Portocarrero LP, Xie JY, Kowal J, Ossipov MH, King T, Porreca F. Descending facilitation from the rostral ventromedial medulla maintains visceral pain in rats with experimental pancreatitis. Gastroenterology 2006; 130: 2155–64. 21 Slobodov G, Feloney M, Gran C, Kyker KD, Hurst RE, Culkin DJ. Abnormal expression of molecular markers for bladder impermeability and differentiation in the urothelium of patients with interstitial cystitis. J. Urol. 2004; 171: 1554–8. 22 Keay SK, Leitzell S, Ochrzcin A, Clements G, Zhan M, Johnson D. A mouse model for interstitial cystitis/painful bladder syndrome based on APF inhibition of bladder epithelial repair: a pilot study. BMC Urol. 2012; 12: 17. 23 Leppilahti M, Hellström P, Tammela TL. Effect of diagnostic hydrodistension and four intravesical hyaluronic acid instillations on bladder ICAM-1 intensity and association of ICAM-1 intensity with clinical response in patients with interstitial cystitis. Urology 2002; 60: 46–51. 24 Green M, Filippou A, Sant G, Theoharides TC. Expression of intercellular adhesion molecules in the bladder of patients with interstitial cystitis. Urology 2004; 63: 688–93. 25 Bouchelouche K, Andresen L, Alvarez S, Nordling J, Nielsen OH, Bouchelouche P. Interleukin-4 and 13 induce the expression and release of monocyte chemoattractant protein 1, interleukin-6 and stem cell factor from human detrusor smooth muscle cells: synergy with interleukin-1beta and tumor necrosis factor-alpha. J. Urol. 2006; 175: 760–5. 26 Erickson DR, Xie SX, Bhavanandan VP et al. A comparison of multiple urine markers for interstitial cystitis. J. Urol. 2002; 167: 2461–9. 27 Han JH, Lee MY, Myung SC. The effect of endothelin-1 on the production of interleukin-6 in cultured human detrusor smooth muscle cells, and the effect of interleukin-6 on the contractile response of bladder smooth muscle strips from rats. BJU Int. 2009; 104: 707–12. 28 Gabay C. Interleukin-6 and chronic inflammation. Arthritis Res. Ther. 2006; 8 (Suppl 2): S3.
607
International Journal of Urology (2014) 21, 601–607
doi: 10.1111/iju.12358
Original Article: Laboratory Investigation
Intravesical hyaluronidase causes chronic cystitis in a rat model: A potential model of bladder pain syndrome/interstitial cystitis Yi Song Lv,1,2 You Sheng Yao,1* Lu Rong,1 Ming En Lin,1,3 Bi Hua Deng,1 Yun Xie,1 Hai Huang,1 Tian Xin Lin,1 Ke Wei Xu1 and Jian Huang1* 1 Department of Urology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, 2Department of Urology, First Affiliated Hospital of Fujian Medical University, Fuzhou, and 3Department of Urology, First Affiliated Hospital of Shantou University Medical College, Shantou, China
Abbreviations & Acronyms BC = bladder capacity BP = base pressure BPS = bladder pain syndrome BW-A = bodyweight after instillation BW-B = bodyweight before instillation CMG = cystometry CYP = cyclophosphamide GAG = glycosaminoglycan GAPDH = glyceraldehydes-3phosphate dehydrogenase HA = hyaluronic acid HAase = hyaluronidase HHAase = high-dose hyaluronidase IC = interstitial cystitis ICAM-1 = intercellular adhesion molecule-1 ICI = intercontraction intervals IL = interleukin LHAase = low-dose hyaluronidase mRNA = messenger ribonucleic acid PP = peak pressure PS = protamine sulfate RNA = ribonucleic acid RT–PCR = reverse transcription polymerase chain reaction RV = residual volume TNF = tumor necrosis factor UPIII = uroplakin III Zo-1 = zonula occludens-1 Correspondence: You Sheng Yao M.D., Ph.D., Department of Urology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou 510120, China. Email: [email protected]
*These two authors contributed equally to this study. Received 20 June 2013; accepted 29 October 2013. Online publication 28 November 2013 © 2013 The Japanese Urological Association
Objectives: To determine whether a potential rat model of bladder pain syndrome could be developed through long-term intermittent intravesical hyaluronidase. Methods: A total of 64 female Sprague–Dawley rats were divided into a control group, a low-dose hyaluronidase (1 mg/mL) group, a high-dose hyaluronidase (4 mg/mL) group and a hyaluronic acid-treated group. Hyaluronidase was given intravesically three times a week for 1 month. Hyaluronic acid (0.5 mL, 0.8 mg/mL) was introduced intravesically to hyaluronidasetreated rats’ bladders. Histological changes, cystometry, nociceptive behaviors, and messenger ribonucleic acid levels of inflammatory factors were evaluated and compared between groups. Results: All hyaluronidase-treated rats showed chronic inflammation and fibrosis, increased and activated mast cells, thinned bladder epithelium with abnormal expressions of uroplakin III and zonula occluden-1, and increased levels of interleukin-6 and intercellular adhesion molecule-1 messenger ribonucleic acid. However, the inflammatory score and levels of interleukin-6 and intercellular adhesion molecule-1 were more significant in the high-dose hyaluronidase group than in the low-dose hyaluronidase group (P < 0.01). Furthermore, hyaluronidase-treated rats showed markedly decreased intercontraction intervals, bladder capacity and increased sensitivity to pain compared with controls (P < 0.01). Hyaluronic acid treatment significantly decreased the inflammatory level, number of mast cells, sensitivity to pain, levels of interleukin-6 and intercellular adhesion molecule-1, and increased intercontraction intervals and bladder capacity (P < 0.01). Conclusions: Long-term intermittent intravesical hyaluronidase could develop a severe chronic cystitis with diffused fibrosis accompanied by altered histology and bladder function. This chronic cystitis rat model can resemble the clinical and histopathological features of human bladder pain syndrome, and might be a potential valuable model for investigation of this troublesome disease.
Key words: animal model, bladder pain syndrome, cystitis, hyaluronidase, rat.
Introduction BPS/IC is a chronic inflammatory disease defined as “chronic pelvic pain, pressure or discomfort perceived to be related to the urinary bladder, with at least one other urinary symptom, such as persistent urge to void or urinary frequency”. The European Society for the Study of Interstitial Cystitis believed that the name BPS better complied with present knowledge than the term IC or PBS.1 BPS occurs mostly in women, and the estimated ratio of men to women affected by this disorder is 1:5.2 The etiology of BPS is still unknown, making the treatment quite challenging. Therefore, an effective translational model of BPS would be very useful for testing potential therapies. Existing BPS models, including chemicals intravesical instillation, intraperitoneal injection of CYP, autoimmune cystitis, neurogenic inflammation and so on often only emulate part of conditions rather than the complete clinical process of BPS.3 An autoimmune cystitis model has been applied in the study of chronic cystitis, but lacks variables in pain.4 In addition, many features of the autoimmune cystitis model are non-specific, and it is not generally agreed that patients with BPS are predisposed to autoimmune disease.3 The CYP-induced cystitis is used extensively to study the pain reaction, but the main change of the bladder is acute inflammation (e.g. infiltration of leukocyte, congestion, edema).5 The animal model of PS-induced cystitis was 601
YS LV ET AL.
extensively used for studies on inflammation and the frequency of BPS.6–8 However, PS was given just one to two times in these models. Therefore, the histological changes showed that acute inflammation and degree of inflammation was not severe. Many hypotheses had been proposed to interpret the pathogenesis of BPS, such as increased permeability of urothelium, infection, autoimmunity, mast cell activation, neural inflammation and so on,9 of which, increased urothelial permeability has been drawing growing interest, including the representative theories of deficient GAG and increased APF.10,11 Parsons found that the GAG layer decreased substantially in patients with BPS, resulting in the loss of the normal permeability barrier.10 Subsequent animal experiments showed that urine could cause bladder inflammation and hyperactivity through destruction of the GAG layer.7,8,12 Although deficient GAG and the consequent leaky urothelium might not be the root cause, it is generally considered as one of the most important factors in the development of BPS and possibly progression into the chronic phase.13 Some investigators believed that a defect in the GAG layer might be the first step in the development of chronic inflammatory diseases of the bladder.14 The GAG layer, composed of hyaluronic acid, heparin sulfate, dermatan sulfate, chondrointin sulfate and keratan sulfate,15 covers the bladder epithelium and forms a biofilm functioning essentially as an impermeable barrier to solutes. HAase is a type of endoglycosidase, which can hydrolyze extracellular matrix including hyaluronic acid, heparin sulfate and chondrointin sulfate.16 Meuwese et al. established an atherosclerosis model by administering HAase continuously through the jugular vein.17 HAase could degrade GAG on the endothelial cell surface and effectively increase microvascular permeability, allowing entry of substances in blood into the vascular subendothelial layer. According to this theory, we hypothesized that HAase could also degrade the GAG layer of the bladder epithelium. As HA, based on GAG replacement theory, was effective in the treatment of BPS,18 we conversely put forward a new animal model of chronic cystitis by destroying the GAG layer with HAase, which could be a potential model for BPS studies. Chronic disease in organs might ultimately cause changes to the central nervous system, leading to a collection of symptoms, which means only a model of long-term chronic inflammation and pain can best mimic actual BPS. In the present study, we established a new rat model by long-term intermittent intravesical HAase, and found that symptoms and histopathological changes of this model bear a strong resemblance to those of human BPS.
Methods Animal model Adult Sprague–Dawley female rats (n = 64) were used (weight 250–300 g). All experimental protocols and procedures were approved by the Sun Yet-sen University Institutional Animal Care and Use Committee. All rats were randomized into the low-dose HAase (1 mg/mL, 400–1000U/mg; Sigma-Aldrich, St. Louis, MO, USA; LHAase) group, high-dose HAase (4 mg/mL, 400–1000U/mg; Sigma-Aldrich; HHAase) group, HA-treated group and control group, with 16 rats in each 602
group. Rats were anesthetized with isoflurane/oxygen (5% induction/2% maintenance). In the HAase-treated groups, a PE-50 catheter (Clay Adams, Parsippany, NJ, USA) was inserted into the bladder through the urethra to empty the bladder, and then 0.5 mL HAase (1 mg/mL or 4 mg/mL) was infused intravesically for 30 min. In the HA-treated group, 6 h after HAase (1 mg/mL) instillation, the rats were intravesically instilled with 0.5 mL of HA (0.8 mg/mL, Bioniche, Belleville, Ontario, Canada) at each time.12,19 In the control group, 0.5 mL saline was infused following the same procedure. All the rats were treated three times a week for 1 month and killed by carbon dioxide asphyxia within 72 h after the last dose.
Nociceptive behavioral study Nociceptive behavioral study in rats was carried out as described previously.5,20 Each rat (n = 16 in each group) was placed on a raised wire-mesh floor under a transparent plastic box, and acclimated to the experimental environment for 1 h. Mechanical stimulation was applied to the skin region between the anus and external urethral orifice of rats, using five distinct von Frey filaments (Stoelting, Wood Dale, IL, USA) with ascending strength of 0.008, 0.07, 0.4, 1.0 and 4.0 g in turn. The mechanical stimulation with each filament was applied 10 times at intervals of 5–10 s. Scoring of nociceptive behavior was defined as follows: 0, no response; 1, licking or biting of the external urethral opening and/or the surrounding area, leaving the position, bending of the trunk, raising the upper half of the body, thrashing limbs and jumping. The data were expressed as the total score of responses to 10 challenges with each filament.
CMG CMG was carried out as described previously.19 The rats were (n = 8 in each group) prohibited from drinking water 12 h before CMG, and their bladders were emptied before cystometry. The rats were then anesthetized with urethane (1.2 g/kg, subcutaneously). Filling cystometry was carried out under anesthesia at a rate of 10 mL/h through a urethral PE 50 catheter. The urethral catheter was connected to a syringe pump and pressure transducer through a three-way stopcock. The following parameters were recorded: BP, PP, ICI, BC and RV. These rats were killed by carbon dioxide asphyxia immediately after CMG.
Histopathology Bladders (the remaining 8 rats of each group) were harvested and divided longitudinally into two sections. Half of the tissues were frozen at −80°C and used for real-time RT–PCR. The other half of the tissues were fixed (10% buffered formalin × 48h), embedded in paraffin, cut into 5-μm transverse sections, and stained with hematoxylin–eosin and toluidine blue. Bladder inflammation was assessed using a four-point scoring system (0, morphologically unremarkable with no or minimal inflammation or epithelial changes; 1, mild inflammatory infiltrate within the lamina propria, accompanied by mild chronic edema, hemorrhage or urothelial changes, fibrosis scattered in the lamina propria; 2, moderate inflammatory infiltrate in the lamina propria and focal extension of the inflammation into the muscularis propria, accompanied by moderate chronic edema, © 2013 The Japanese Urological Association
New potential rat model of BPS
Table 1
Primers used for real-time RT–PCR
Name
Forward primer (5'–3')
Reverse primer (5'–3')
Size (bp)
IL-1β IL-6 TNF-α ICAM-1 GAPDH
TCCTCTGTGACTCGTGGGAT AGAGACTTCCAGCCAGTTGC TCGTCTACTCCTCAGAGCCC AGACACAAGCAAGAGAAGAA TGCACCACCAACTGCTTAG
TCAGACAGCACGAGGCATTT AGCCTCCGACTTGTGAAGTG ACTTCAGCGTCTCGTGTGTT GAGAAGCCCAAACCCGTATG AGTGGATGCAGGGATGATGT
109 142 128 234 180
hemorrhage, urothelial changes, fibrosis diffused in the lamina propria; 3, severe inflammation in the lamina propria and muscularis propria in association with other significant findings, such as urothelial ulceration, severe chronic edema, hemorrhage, and diffused fibrosis through the bladder) and determined by a pathologist in a blinded fashion in the Department of Pathology at Sun Yat-sen Memorial Hospital. The sections stained with toluidine blue were used for mast cells counts.
Immunohistochemistry The EnVison two-step method was applied in immunohistochemistry using ChemMate Envision+ Detection Kit (DakoCytomation; Dako, Glostrup, Denmark) with 1:50 diluted UPIII polyclonal antibody (Santa Cruz, CA, USA) and Zo-1 polyclonal antibody (Santa Cruz). UPIII was scored as normal: found only on the luminal layer; and abnormal: weak on the luminal layer or distributed throughout the urothelium. Zo-1 was scored as normal: evenly distributed throughout the urothelium, mainly in the surface of the epithelial cells; and abnormal: uneven, decreased or absent, as well as distributed mainly in cytoplasm.
Real-time RT–PCR Total RNA was extracted from different tissues and reverse transcribed into cDNA using the Takara system (Takara, Ostu, Japan) according to the manufacturer’s manual. Real-time RT–PCR was carried out with a Real-Time PCR System (GeneAmp PCR System 9700; ABI, Foster City, CA, USA) in a 25-uL volume using SYBR Green PCR Master Mix (Fermentas, Ontario, Canada; Table 1).
Statistical analysis All data are represented as the mean ± standard deviation. Statistical significance was evaluated using Student’s t-test or oneway ANOVA with Bonferroni correction. P-values 0.05; Table 2). In CMG, ICI and BC significantly decreased in the HAase-induced rats compared with the controls (P < 0.01; Fig. 3, Table 2). In addition, sensitivity to pain increased significantly in the HAase-induced rats (P < 0.01; Fig. 4). However, there was no significant difference in urodynamic changes and sensitivity to pain between the LHAase group and the HHAase group (P > 0.05; Fig. 3b,c, Table 2). After administration of HA, compared with the LHAase group, the nociceptive score of the rats decreased significantly, whereas ICI and BC increased significantly (P < 0.01; Fig. 3,4, Table 2).
Expression of IL-1β, IL-6, TNF-α and ICAM-1 The levels of IL-6 and ICAM-1 mRNA increased gradually in the HAase-treated groups, with the HHAase group ranking the highest compared with the control group and the LHAase group (P < 0.01), whereas they decreased significantly after HA treatment compared with the LHAase group (P < 0.01). However, no statistically significant differences were observed in expression of IL-1β and TNF-α mRNAs among the four groups (P > 0.05; Fig. 5).
Discussion In the present study, we created a new chronic cystitis model in female rats by long-term intermittent intravesical HAase, which resembles clinical BPS with the following characteristics: (i) morphological changes: chronic inflammatory invasion of the full thickness of the bladder wall, thickened lamina propria, thinned or partially missing urothelium, increased number and active mast cells, hyperplasia of new-born small vessels, and diffused fibrosis; (ii) functional changes: increased micturition 603
YS LV ET AL.
Control
LHAase
(i)
HHAase
(J) 4
60 *#
3.5 3
* 50
2.5 2 1.5
*
*
#
No. mast cells
Inflammatory score
HA-treated
40 30 20
#
1 0.5 0
10 0
Fig. 1 Representative images of hematoxylin–eosin stained (magnification: ×100) and toluidine blue stained (magnification: ×200) bladders. (a,e) Control rats, (b,f) LHAase rats, (c,g) HHAase rats, (d,h) HA-treated rats, (i) inflammatory score and (J) number of mast cells. LHAase and HHAase rats showed chronic inflammatory and fibrosis signs: diffuse monocytes or lymphocytes infiltration, small vascular proliferation, fibrin deposition and localized urothelium thinning. Arrows indicate clustered inflammatory cells, even extension into the muscularis propria in HHAase rat. After HA treatment, the bladder epithelium repaired and inflammatory cells were scattered. The number of mast cells significantly increased in both of LHAase and HHAase groups, whereas they decreased after HA treatment. *P < 0.01 (vs the control group), #P < 0.01 (vs the LHAase group). , Control; , LHAase; , HHAase; , HA-treated.
Fig. 2 Representative immunohistochemical images of (a–d) UPIII and (e–h) Zo-1 (magnification ×400). (a,e) Control rats, (b,f) LHAase rats, (c,g) HHAase rats and (d,h) HA-treated rats. UPIII and Zo-1 were abnormal in the LHAase and HHAase rats, but they were almost normal in the HA-treated rats.
604
© 2013 The Japanese Urological Association
New potential rat model of BPS
Table 2
Comparison of CMG parameters among controls, LHAase-, HHAase- and HA-treated groups
Groups
ICI (s)
BC (mL)
RV (mL)
BP (mmHg)
PP (mmHg)
BW-B (g)
BW-A (g)
Control LHAase HHAase HA-treated
467.4 ± 17.2 119.0 ± 22.1* 113.1 ± 17.1* 328.3 ± 36.5**
1.31 ± 0.05 0.34 ± 0.06* 0.32 ± 0.05* 0.87 ± 0.09**
0.23 ± 0.03 0.25 ± 0.03 0.27 ± 0.05 0.26 ± 0.08
5.13 ± 1.25 5.50 ± 0.93 5.38 ± 1.19 5.09 ± 1.33
27.63 ± 0.92 31.00 ± 1.85* 29.75 ± 1.28* 31.75 ± 1.79*
273.4 ± 10.3 277.3 ± 11.2 281.4 ± 11.4 275.4 ± 11.3
287.3 ± 22.5# 280.1 ± 15.6 276.4 ± 15.7 275.8 ± 17.8
*P < 0.01 vs the control group; **P < 0.01 vs the LHAase group; #P < 0.01 BW-B vs BW-A.
12 40 mmHg
(a)
*
10
*
1 min
40 mmHg
(b)
Nociceptive score
* #
8 #
*
6 4 *
0 1 min (c)
# #
2 # 0.008
0.07
0.4
1
4
40 mmHg
Stimulus intensity (g)
1 min
40 mmHg
(d)
1 min Fig. 3 Representative cystometry. (a) Control rats, (b) LHAase rats, (c) HHAase rats and (d) HA-treated rats. The CMG showed that rats urinated more frequently after HAase treatment, but the urinary frequency was comparable between the LHAase group and HHAase group. HA treatment decreased the frequency.
frequency, decreased volume per micturition, increased bladder hyperactivity and sensitivity to pain; (iii) changes of inflammatory factors: levels of IL-6 and ICAM-1 increased, but levels of IL-1β and TNF-α showed no change. BPS is a chronic pelvic pain syndrome related to the bladder with high prevalence. The pathogenesis of BPS is still unclear. Among those controversial hypotheses of BPS etiology, the absence of the GAG layer and increased permeability of the urothelium are generally considered as the key points of the BPS process.10,13 Whatever the initiating factors of BPS are, the continuous absence of the GAG layer might eventually lead to pathological changes and clinical manifestations. In 1990, © 2013 The Japanese Urological Association
Fig. 4 Scoring of nociceptive behavior. In each stimulus intensity, rats of the LHAase group and HHAase group presented significantly higher scores compared with the controls, though there was not a significant difference between the LHAase group and HHAase group. After HA treatment, the nociceptive score decreased in each stimulus intensity. *P < 0.01 (vs the control group), #P < 0.01 , Control; , LHAase; , HHAase; , (vs the LHAase group). HA-treated.
the San Diego group first found that PS could destroy the GAG layer by neutralizing the component of heparin.6 The PS-induced cystitis animal model was widely used to mimic histological and functional features of clinical BPS in many studies.7,8,12 Different from the single substrate of PS, HAase can hydrolyze most of the components of the GAG layer including hyaluronic acid, heparin sulfate, chondroitin sulfate and so on,16 and hence destroy the GAG layer, increase permeability of bladder epithelium, allow entry of harmful substances of urine into bladder wall and trigger inflammation process.8 The hypothesis was confirmed in our trial by abnormal expression of UPIII and Zo-1, and locally thinned or missing epithelium, which mean increased permeability of the bladder epithelium. UPIII and Zo-1 were effective variables for evaluating the permeability of the bladder epithelium, and their levels were abnormal in BPS patients.21,22 The persistent absence of GAG layer is the motivating factor of the inflammation process in our new model. ICAM-1, an important inflammatory factor, increases and plays a great role in the development of BPS, which can be suppressed by HA through blockage of ICAM-1 receptor as well as inhabitation of adherence, and immigration of immune complex and polymorphonuclear cells.12,23,24 In our trial, the 605
YS LV ET AL.
0.8
Relative gene expression
0.7 0.6
*#
0.5 *
0.4
*# #
0.3
*
0.2
# 0.1 0 IL-1β
IL-6
TNF-α
ICAM-1
Fig. 5 RT–PCR of inflammatory factors mRNA in the bladder. Relative quantities of IL-1β, IL-6, TNF-α and ICAM-1 mRNAs were normalized by GAPDH mRNA. *P < 0.01 (vs the control group), #P < 0.01 (vs the LHAase group). , Control; , LHAase; , HHAase; , HA-treated.
level of ICAM-1 increased along with the severity of inflammation, which suggested that ICAM-1 might be a contributing factor in the inflammation. When the effect of HAase was counteracted by HA, the level of ICAM-1 decreased. Because HA can block the receptor of ICAM-1, after hydrolysis of HA, the pro-inflammatory effect of ICAM-1 was amplified. Therefore, HAase might exacerbate the inflammatory process of this model through twofold effects: first of all, HAase can destroy the GAG layer and active the inflammatory process; secondly, HAase can amplify the pro-inflammatory effect of ICAM-1 by hydrolysis of HA, and further promote the inflammatory process of this model. The second mechanism is also the reason why HHAase induced more severe inflammation than LHAase. In contrast, a different dose of HAase can cause inflammation to a different degree, which makes it a potentially more effective model for the study of the inflammatory mechanism and therapies of cystitis. During past research on BPS, IL-1β, IL-6 and TNF-α have been the most studied factors that are linked to inflammation.25 In the present study, levels of IL-1β and TNF-α, which are usually increased in acute inflammation, did not change; whereas the level of IL-6 increased along with the severity of inflammation. The present results were similar to those of some experimental or clinical trials in BPS.12,19,26 IL-6, as an important factor in acute and chronic inflammation, has a strong relationship with bladder fibrosis and detrusor overactivity,27,28 and can be used as an objective indicator for the inflammatory process of the BPS model and an effective assessment for therapeutic impact.19 In the present study, intermittent intravesically administered HAase acted as a long-term, but mild inflammatory stimulus, and the instillation of HAase did no harm the rats’ health. Thereafter, the weight of the rats maintained a relatively stable platform after HAase instillation. We referred to the dose of HAase in the study Meuwese et al., and HAase-treated rats were divided into LHAase and HHAase groups.17 There was s significant difference in inflammatory degree between them. 606
However, there were no changes in CMG, with the possible reasons as follows: (i) this rat model is of chronic cystitis instead of an acute cystitis, and long-term intermittent intravesical HAase, even at a different dose, causes severe changes of cystometric parameters, which have reached similar peaks at that time, and it is difficult to detect the differences; (ii) the results of CMG could be affected by many factors including inflammatory degree and the changes of central threshold and so on. Long-term chronic cystitis might cause similar changes in the central nerve system, which results in similar changes of CMG even when the triggering dose is different. Bladder-related pain or discomfort is an important feature of BPS, but measurements of visceral pain in animal models are scarce. Vera-Portocarrero LP et al. used von Frey filaments to stimulate the abdominal area by measuring the change of pain in a rat model of pancreatitis.20 Miki et al. stimulated the skin region between the anus and urethral opening of mice to assess the change of the referred hyperalgesia in a CYP-induced cystitis model.5 Inspired by these reports, we stimulated the skin region between the anus and urethral opening of rat. Because of the long-term inflammatory stimulation, the peripheral and central pain sensitivity might have been increased, which led to the chronic pain. As we had conjectured, the referred hyperalgesia of HAase-induced rats increased. However, the result of von Frey filaments could be affected easily by environmental changes. Therefore, this method is not suitable for minor lesions, whereas it can be used in the severe chronic inflammatory pain of the present study. In the future, perhaps the in vivo patch-clamp technique could be used to measure the change of pain more precisely. The present study showed that long-term intermittent intravesical HAase could develop a severe chronic cystitis with diffused fibrosis accompanied by altered histology and bladder function. This novel chronic cystitis rat model can closely resemble the clinical and histopathological features of human BPS, and might be a potentially valuable model for investigation of this troublesome disease.
Acknowledgments This work was supported by grants from the Science and Technology Project of Guangdong Province (No. 2009B030801148) and the Youth Project of the National Natural Science Foundation of China (No. 81101947).
Conflict of interest None declared.
References 1 van de Merwe JP, Nordling J, Bouchelouche P et al. Diagnostic criteria, classification, and nomenclature for painful bladder syndrome/interstitial cystitis: an ESSIC proposal. Eur. Urol. 2008; 53: 60–7. 2 Wein AJ, Hanno PM. Targets for therapy of the painful bladder. Urology 2002; 59: 68–73. 3 Westropp JL, Buffington CA. In vivo models of interstitial cystitis. J. Urol. 2002; 167: 694–702. 4 Altuntas CZ, Daneshgari F, Sakalar C et al. Autoimmunity to uroplakin II causes cystitis in mice: a novel model of interstitial cystitis. Eur. Urol. 2012; 61: 193–200. © 2013 The Japanese Urological Association
New potential rat model of BPS
5 Miki T, Matsunami M, Nakamura S, Okada H, Matsuya H, Kawabata A. ONO-8130, a selective prostanoid EP1 receptor antagonist, relieves bladder pain in mice with cyclophosphamide-induced cystitis. Pain 2011; 152: 1373–81. 6 Parsons CL, Boychuk D, Jones S, Hurst R, Callahan H. Bladder surface glycosaminoglycans: an epithelial permeability barrier. J. Urol. 1990; 143: 139–42. 7 Chuang YC, Chancellor MB, Seki S et al. Intravesical protamine sulfate and potassium chloride as a model for bladder hyperactivity. Urology 2003; 61: 664–70. 8 Soler R, Bruschini H, Freire MP, Alves MT, Srougi M, Ortiz V. Urine is necessary to provoke bladder inflammation in protamine sulfate induced urothelial injury. J. Urol. 2008; 180: 1527–31. 9 Grover S, Srivastava A, Lee R, Tewari AK, Te AE. Role of inflammation in bladder function and interstitial cystitis. Ther. Adv. Urol. 2011; 3: 19–33. 10 Parsons CL. The role of a leaky epithelium and potassium in the generation of bladder symptoms in interstitial cystitis/overactive bladder, urethral syndrome, prostatitis and gynaecological chronic pelvic pain. BJU Int. 2011; 107: 370–5. 11 Keay SK, Szekely Z, Conrads TP et al. An antiproliferative factor from interstitial cystitis patients is a frizzled 8 protein-related sialoglycopeptide. Proc. Natl. Acad. Sci. U.S.A. 2004; 101: 11803–8. 12 Shao Y, Lu GL, Shen ZJ, He HC. Reduction of intercellular adhesion molecule 1 may play a role in anti-inflammatory effect of hyaluronic acid in a rat model of severe non-bacterial cystitis. World J. Urol. 2013; 31: 535–40. 13 Hanno P, Lin AT, Nordling J et al. Hypothesis of etiologic cascade of bladder pain syndrome. In: Abrams P, Cardozo L, Khoury S, Wein A (eds). Incontinene. Health Publication Ltd., Paris, 2009; 1459–518. 14 Bassi PF, Costantini E, Foley S et al. Glycosaminoglycan therapy for bladder diseases: emerging new treatments. Eur. Urol. Suppl. 2011; 10: 451–9. 15 Teichman JM, Moldwin R. The role of the bladder surface in interstitial cystitis/painful bladder syndrome. Can. J. Urol. 2007; 14: 3599–607. 16 Girish KS, Kemparaju K. The magic glue hyaluronan and its eraser hyaluronidase: a biological overview. Life Sci. 2007; 80: 1921–43. 17 Meuwese MC, Broekhuizen LN, Kuikhoven M et al. Endothelial surface layer degradation by chronic hyaluronidase infusion induces proteinuria in apolipoprotein E-deficient mice. PLoS One 2010; 5: e14262.
© 2013 The Japanese Urological Association
18 Lv YS, Zhou HL, Mao HP, Gao R, Wang YD, Xue XY. Intravesical hyaluronic acid and alkalinized lidocaine for the treatment of severe painful bl adder syndrome/interstitial cystitis. Int. Urogynecol. J. 2012; 23: 1715–20. 19 Lv YS, Yao YS, Lin ME et al. Interleukin-6 levels in female rats with protamine sulfate-induced chronic cystitis treated with hyaluronic acid. Int. J. Urol. 2013; 20: 1017–22. 20 Vera-Portocarrero LP, Xie JY, Kowal J, Ossipov MH, King T, Porreca F. Descending facilitation from the rostral ventromedial medulla maintains visceral pain in rats with experimental pancreatitis. Gastroenterology 2006; 130: 2155–64. 21 Slobodov G, Feloney M, Gran C, Kyker KD, Hurst RE, Culkin DJ. Abnormal expression of molecular markers for bladder impermeability and differentiation in the urothelium of patients with interstitial cystitis. J. Urol. 2004; 171: 1554–8. 22 Keay SK, Leitzell S, Ochrzcin A, Clements G, Zhan M, Johnson D. A mouse model for interstitial cystitis/painful bladder syndrome based on APF inhibition of bladder epithelial repair: a pilot study. BMC Urol. 2012; 12: 17. 23 Leppilahti M, Hellström P, Tammela TL. Effect of diagnostic hydrodistension and four intravesical hyaluronic acid instillations on bladder ICAM-1 intensity and association of ICAM-1 intensity with clinical response in patients with interstitial cystitis. Urology 2002; 60: 46–51. 24 Green M, Filippou A, Sant G, Theoharides TC. Expression of intercellular adhesion molecules in the bladder of patients with interstitial cystitis. Urology 2004; 63: 688–93. 25 Bouchelouche K, Andresen L, Alvarez S, Nordling J, Nielsen OH, Bouchelouche P. Interleukin-4 and 13 induce the expression and release of monocyte chemoattractant protein 1, interleukin-6 and stem cell factor from human detrusor smooth muscle cells: synergy with interleukin-1beta and tumor necrosis factor-alpha. J. Urol. 2006; 175: 760–5. 26 Erickson DR, Xie SX, Bhavanandan VP et al. A comparison of multiple urine markers for interstitial cystitis. J. Urol. 2002; 167: 2461–9. 27 Han JH, Lee MY, Myung SC. The effect of endothelin-1 on the production of interleukin-6 in cultured human detrusor smooth muscle cells, and the effect of interleukin-6 on the contractile response of bladder smooth muscle strips from rats. BJU Int. 2009; 104: 707–12. 28 Gabay C. Interleukin-6 and chronic inflammation. Arthritis Res. Ther. 2006; 8 (Suppl 2): S3.
607
