Vol. 173, No. 13
JOURNAL OF BACTERIOLOGY, JUlY 1991, p. 40004006
0021-9193/91/134000-07$02.00/0
Copyright X 1991, American Society for Microbiology
Interesting Sequence Differences between the Pilin Gene Inversion Regions of Moraxella lacunata ATCC 17956 and Moraxella bovis Epp63 FRANK W. ROZSAt AND CARL F. MARRS* Department of Epidemiology, University of Michigan, Ann Arbor, Michigan 48109 Received 7 December 1990/Accepted 22 April 1991 The bacterium Moraxella lacunata is a causative agent of human conjunctivitis and keratitis. We have previously reported construction of plasmid pMxLl, which includes a 5.9-kb fragment on which the pilin gene inversion region of M. lacunata resides. The inversion region of pMxLl was shown to invert when pMxLl was in an Escherichia coli host cell. In this report, we present Western immunoblot analysis using Moraxelia bovis Epp63 anti-I and anti-Q pilin sera which demonstrate that pMxLl makes pilin only when in orientation 1. The sequence of the pMxLl plasmid containing the invertible region contains a perfect tandem repeat of 19 bp in the orientation 1 nonexpressed pilin gene at the middle of the recombination junction site. This 19-bp insert causes a frameshift and disrupts the pilin gene. The predicted amino acid sequence of this nonfunctional pilin gene (with the 19-bp repeat subtracted) bears closest resemblance to M. bovis Epp63 Q pilin sequence, although the other (functional) M. lacunata pilin encoded by pMxLl shows slightly higher homology to Q pilin. Comparison of the pMxLl sequence with that of the M. bovis Epp63 sequence shows two other particularly interesting differences. One is a 15-bp sequence addition found in pMxLl at the 60-bp region previously reported as a possible M. bovis recombinational enhancer. The second is an AT deletion in pMxLl compared with Epp63 within an open reading frame (tfpB) which results in the pMxLl tfpB open reading frame being one-third shorter than in Epp63. The DNA sequences in these three altered regions from the M. lacunata strain from which pMxLl was derived were amplified by polymerase chain reaction and sequenced. The parent strain was found to contain the differences seen in pMxLl. Comparison of the M. bovis and M. lacunata pilin gene amino acid sequences is also presented.
Moraxella pilin gene inversion systems and those of the Hin family of bacterial DNA invertible elements (5, 6, 12, 13). In this report, we present the DNA sequence of the pilin gene inversion region of M. lacunata ATCC 17956 as cloned onto pMxLl and compare it with the previously reported DNA sequence of M. bovis Epp63 (5). We present polymerase chain reaction (PCR) analysis using the parental M. lacunata ATCC 17956 in three regions that differ between pMxLl and Epp63. We also compare the predicted amino acid sequences of the M. lacunata pilins with three M. bovis pilin amino acid sequences.
The type 4 (MePhe) class of bacterial pili is found on a wide variety of gram-negative bacteria (4), including Moraxella bovis (14) and Moraxella lacunata (12). The type 4 piliated (P+) bacteria of the family Neisseriaceae (including Moraxella, Branhamella, Neisseria, and other genera) display several phenotypic differences from the equivalent nonpiliated (P-) bacteria. These phenotypes include colony morphology, pitting of agar, autoagglutination, pellicle formation, hemagglutination, twitching motility, and increased competence for natural DNA transformation (for a review, see reference 10). We have been studying the type 4 pilin gene regions of M. bovis and M. lacunata. These organisms are very closely related, as determined by both DNA-DNA hybridization analysis (20) and transformation studies (2). M. bovis is the primary cause of bovine infectious keratoconjunctivitis (8), and M. lacunata is a pathogen which occasionally causes conjunctivitis in humans (3, 16, 19). A single strain of M. bovis is capable of producing one or the other of two pilin types, named Q (previously P) and I (previously x) for strain Epp63 (14, 17). The switch in expression between the tfpQ and tfpl pilin genes is due to an inversion of a 2.1-kb region of DNA (5, 13). When tfpQ is in the expression locus it is in orientation 1, while orientation 2 has tfpI in the expression locus. We have shown that a gene (piv) adjacent to the inversion region is required for inversions to occur (12). We have described both similarities and differences between the
*
MATERIALS AND METHODS Bacterial strains, plasmids, and media. M. bovis Epp63 was described previously (5, 13) and grown on GC agar base
(Difco Laboratories, Detroit, Mich.) with 1% IsoVitaleX (BBL Microbiology Systems, Cockeysville, Md.). Escherichia coli strains containing drug-resistant plasmids were grown on L agar containing the following concentrations (in micrograms per milliliter) of the appropriate antibiotic: carbenicillin, 100; streptomycin, 100; spectinomycin, 25; tetracycline, 15; kanamycin, 25; or chloramphenicol, 12.5 (Sigma Chemical Co., St. Louis, Mo.). E. coli DH5a [F- endAl hsdRJ7 supE44 thi-J recAl gyrA96 relAl A(argF-lacZYA)U169 (+80dlacZAM15)] (Bethesda Research Laboratories, Inc., Gaithersburg, Md.) was used for transformation of deletion derivatives and Ql interposon insertions of pMxLl. M. lacunata ATCC 17956 was grown on heart infusion agar at 35°C and was kindly provided by Elliot Juni, University of Michigan, Ann Arbor. Plasmids pMxLl, pMxL5, and pMxL6 were constructed as described previously (12).
Corresponding author.
t Present address: Department of Microbiology, Biozentrum, University of Basel, CH-4056, Basel, Switzerland. 4000
M. LACUNATA PILIN GENES
VOL. 173, 1991
DNA isolation and manipulation. Phage and plasmid DNAs were isolated as described previously (1, 14). Restriction enzymes were purchased from New England BioLabs, Inc., Beverly, Mass.; Bethesda Research Laboratories; Boehringer Mannheim Biochemicals, Indianapolis, Ind.; or Promega Biotec, Madison, Wis. Restriction endonuclease digestions and agarose gel electrophoresis were carried out as previously described (12, 14). Restriction enzyme-generated DNA fragments were isolated from ethidium bromidestained gels by using long-wave UV light to localize the fragments; then the bands were excised from the gel, and the agarose was removed by using Geneclean (Bio 101, Inc., La Jolla, Calif.). Deletion derivatives of pMxLl were obtained by using exonuclease III digestion of double-cut DNA and the Erase-a-Base system (Promega Biotec) as described previously (12). Insertion of the fl interposon at the HinclI site in piv to generate phase-locked constructs pMxL5 and pMxL6 was described previously (12). Synthetic oligonucleotide primers. Synthetic oligonucleotide primers for DNA sequencing and PCR were purchased from Genosys Biotechnologies, Inc. (Woodlands, Tex.) and included L3 (5'-GCAGTTTTACCAGCAGCTAG-3'), L4 (5'GTTATTCGCCAAAATCGCCC-3'), L5 (5'-CAGGCTCA GAGCGAACGGTT-3'), L6 (5'-CCGCCACTCAAAGAAC CGTT-3'), L8 (5'-GCATTGTCTGTGCCAAC-3'), L9 (5'GATACCGACGAGGCGAC-3'), L10 (5'-CCGTCTGATG GGATGAG-3'), Lii (5'-GCAGTGCCACTGATACCG-3'), and L18 (5'-GATGTTCTCACCCAAGA-3'); their positions are shown in Fig. 3. DNA sequencing. Deletion derivatives of pMxLl were sequenced by the dideoxy-chain termination method of Sanger et al. (18) as previously described (5, 12), using T7 polymerase (Sequenase) from United States Biochemical and the synthetic oligonucleotide primers L3, L4, L5, L6, L8, L9, L10, and Lii described above. Double-stranded PCR products were sequenced directly after purification on 3% NuSieve-1% agarose (FMC Bioproducts, Rockland, Maine) and cutting out the band of interest. The band was removed from the gel matrix by using Geneclean (Bio 101) and sequenced as described above with the addition of 0.05% Tween 20 (J. T. Baker Chemical Co., Phillipsburg, N.J.) and 0.05% Nonidet P-40 (Sigma) throughout the annealing, labeling, and termination steps, using the MN buffer in the Sequenase kit (United States Biochemical) for sequencing short molecules. Primers used for sequencing PCR products were L4 for the tandem repeat region, L5 for the recombinational enhancer region, and L18 for the AT deletion in tfpB. PCR to amplify genomic DNA. Synthetic oligonucleotide primers L3, L4, L5, L6, L10, and L18 were made to match completely conserved sequence regions so they could be used for amplification of both pMxLl and M. bovis genomic DNA in the regions of interest. PCR was carried out in an Eppendorf MicroCycler according to the manufacturer's instructions except that 55°C was used for the annealing temperature. DNA sequence analysis. DNA sequence analysis was performed by DNAstar (Madison, Wis.) or the Eugene Program (Baylor College of Medicine, Houston, Tex.). DNA sequences were compared with those in the GenBank data base (IntelliGenetics, Inc., Mountain View, Calif.), and translated open reading frames (ORFs) were compared with sequences in the PIR data base (Georgetown University,
Washington, D.C.). Western immunoblots. Whole cells were denatured by boiling in 2% sodium dodecyl sulfate-I% 2-mercaptoetha-
1
2
3
4
5
6
7
8
9 10
4001
11
FIG. 1. Western transfer analysis of whole-cell lysates of M. bovis Epp63, M. lacunata ATCC 17956, and the cloned M. lacunata pilin gene in pMxLl in E. coli DHSa. Samples were electrophoresed on a 13% sodium dodecyl sulfate-polyacrylamide gel and electrophoretically transferred to nitrocellulose paper. The resulting filter was incubated with M. bovis Epp63 Q pilin antiserum (1:1,500) as described in the text. Lanes: 1, M. bovis Epp63 Q P-; 2, M. bovis Epp63 Q P+; 3, M. bovis Epp63 I P-; 4, M. bovis I P+; 5, M. lacunata ATCC 17956 P-; 6, M. lacunata ATCC 17956 P+; 7, pMxLl in E. coli DH5ot; 8, pMxL5 (phase locked in orientation 1) in E. coli DH5a; 9, pMxL6 (phase locked in orientation 2) in E. coli DH5a; 10, E. coli DH5a; 11, pMxLldRl3 (parent plasmid of pMxL5 and pMxL6) in E. coli DH5ot. P- indicates pilus negative but can be either pilin negative as in lane 1 or pilin positive as in lane 3. The closely positioned multiple bands of immunoreactivity in lanes 6, 7, 8, and 11 are an artifact of the electrophoretic conditions and are not always observed. We believe that these bands represent the same pilin molecules.
nol-50 mM Tris, pH 7.5. Preparations were separated on a 13% polyacrylamide gels, using the system of Laemmli (9). Gels were stained with Coomassie blue to confirm the relative amounts of total protein present in each lane. Gels were immunoblotted as follows. Proteins were electrophoretically transferred to nitrocellulose paper by the method of Towbin et al. (21). Filters were treated with 5% nonfat dry milk in PBS (0.1 M phosphate-buffered saline, pH 7.5) with 0.05% (vol/vol) Tween 20 for 1 h, incubated with rabbit anti-M. bovis I pilin antiserum (1:1,650) for 4 to 10 h, washed with PBS-0.05% Tween 20, incubated with goat anti-rabbit antibody conjugate (1:3,000) for 2 h, washed in PBS, and developed by using 0.5 mg of 3,3'-diaminobenzidine (Sigma) per ml in PBS with 0.01% (vol/vol) 30% hydrogen peroxide; the reaction was stopped by a wash in water. Nucleotide sequence accession numbers. The GenBank numbers for the reported M. lacunata and M. bovis DNA sequences are M59711 and M59712, respectively.
RESULTS Plasmid pMxLl produces pilin in Western blots. As described previously (12), we observed different hybridization patterns between piliated and nonpiliated M. lacunata ATCC 17956 DNA when probed with labeled, cloned M. bovis tfpQ DNA. These patterns were similar to those observed when M. bovis Epp63 undergoes phase variation, the switching of tfpQ to tfpI in the expression locus. We obtained a XZAP library of M. lacunata DNA and cloned the pilin gene region of M. lacunata. One of the plasmid clones (pMxLl) was isolated for further study. Plasmid pMxLl, which contained a putative invertase gene (piv), also contains a 2-kb invertible region which in M. bovis contains the pilin genes (12). To determine whether the M. lacunata pilin could be expressed in E. coli, Western blots were performed. From Western blot results (Fig. 1), it was apparent that pMxLl in E. coli produced a pilin protein the same size as that of the parent strain M. lacunata ATCC 17956, although in reduced quantity and slightly larger in size than the M. bovis Q pilin. Furthermore, when pMxLl was phase locked by insertion of the Ql fragment (a streptomycinspectinomycin resistance gene flanked by transcriptional and
4002
J. BACTERIOL.
ROZSA AND MARRS 80
TTACTAATAQTACTTCCTTTGGAGTGCTTTTATGAAAAAATTAATCCTAACCACGCTTGTCGCTGCCCTTGCTTTGACA 160 GCGTGTAGCAAAGAGACCAGCGATAAGGCTGCCGAGACGGTCAGTCTGCCGCCACTGACACCGCCAATAACGCCAAAGCC 240 GCTGCTGACACTGTGGCCGCCGAGCGAAGCTGCAGCCAATGCGACCGCTGAAGGTGTCTCTAATGTCGCTCATGACGTGG 319
CAAATAATGGCGTAGAAAATGCCAAAATACCGCCGAAACCGCCGCACG-GTGGTCTCTOATGCCGCCACCGCCACCGCC 399
GATGCCGTGACAGGGGCTGCCAGCAGTGCCACTGATACCGTAACAGGCAACACCGCCACCGCCGAACAGCQAGCCCCCGA 479
GACACAAAAGTACTAATCCACCATCACCAAAGCCCCGAACATGTTC:GGCTTTTTTGATAAAAATGAATTTACAGCCAG 558
CGAATCTGATGTTCGCCATGGATCTGTGATGTTCACCCATTTCACATCATCTTATGCCGTTTATCAACATTGACAAAA638
TCGTCACACTGACAQTTAATGCCATGTCAGTGTCCATTTGTGTCAAAAATTGGCTAATATGACAAATTTTGGCAACAA 718
TTTTTGATAGGTAAAAATTTTGTCCATGTCAAAATTGGCATCCCCAAAATGTCGCCCACCTGCCAAATGTC 798
AAlAAATCCAAkAACTGACAAAAATTGTCACCCAAAATTACCTGCCAGACATCAAATTTTAAAAATTTTTAAAAATTTTT
G****************************************C***************************-----------
878
TrGGTAAAAAAGAAAAATTTGTACATATCTTAATCAATTAAAAATGGCAAAATCTGCTTATTTTTTAGACAAAA ******************
**** *
*T**** ************* **A*********A***C****** ** ****
957
TTTTTAAAATTTTCTCAATTTTGCCTATTTTTCCCAAAA-CAGTCCAAATCCGCCAAAGTTGGCACGACAATGCAAC 1037
AGTATGAGTGTAAGGTTAGCAAATATGTTTAAAGTTGCTAATCACTTAACTTAAACAAACTGG-CAATATCGCCCCTATO 1117 _ tfpQ AACTAAGGAGTTCATTATGAACOCTCAAAAGGTTTCACCCTTATCOAACTAATGATTGTAATCGCCATTATTGGTATCC 1197
TAGCTGCAATCGCTCTACCTGCTTACCAAGACTACATCTCTAAGTCTCAAACTACTCGTGTAOTGGCGAACTAGCTGCT 1277 OOTAARA
GTACTGTTTTTTGAAGGTAAAGAGC
**************G*****************G******AC**CAAC*A*G
CAQCCGCAACCTCTAAGAO **TvA**AC**T---****
1356
AGATATTGGCTZJACTTCCACCOGTGCAAGOCTCGCTCTAATCTACTAAAGAAACTOTTAT ***C**C***C*T**CA*T**T**C**T*CC*****T*****CT*OA*G --------- T*A*T***AALTA*A*0***Tg 1431 -TCTCTGCCACTAGTTCAOCTGGTACTATZACTOGT&CCTTGGTAACCGTOCCAATAAAGACATCAGTGGTGCT ---T***AL*** --- T*****C***C*aAGJA*C***S***************************GC******* 1511
OTTCAA
aTcATcaccTcAAACGTGCTATGAcGGTOTaTGGacTqGTCACOTACAGCAAOGCACTGCTACCGGTTGGAAGGATAA *****T******TC!r****A*OCG**A***********C**CQC*aA*TJ*
*C***C*JL********ATC***
1591
ATTTATTCCAcACAOTTOCACAAATACTOCACCATAATTTTAATTATTGAATATATTTTAGTTATGCGAAATCACCTCTT v**CG*aJ**T**T*****T*A*G*O--------- ***Q*CATGAT*C**ATC*CAAC*ACCCA*TCOC---------
1671
ATTGGAGGTGATTTTTGTTTGTGAGAGAAATTCTTTACAATAAATATACAAAAATAAGAAAACAcTTGTCTATTTT
-******TrG*TG****-**AACATA*AG*CAL*A**A********************************************
translational stop signals and restriction site linkers; 15) into the Hincll site of piv, pilin was made only when pMxLl was in orientation 1 (pMxL5). No pilin was observed when pMxLl was phase locked in orientation 2 (pMxL6) by either deletions or insertions in the invertase gene. Sequencing the M. lacunata inversion region found on pMxLl. After determination of the DNA sequence of the inversion region on pMxLl (see Materials and Methods for details), the sequence was compared with our previously published (5) sequence of the M. bovis pilin gene inversion
region (Fig. 2). Figure 3 shows a map of the pilin gene inversion region and three interesting differences that were found in the DNA sequence between pMxLl and M. bovis Epp63. These include a 19-bp perfect tandem repeat in pMxLl at the nonexpressed M. bovis I pilin gene in the inversion junction site, a 15-bp insert at the putative M. bovis recombinational enhancer binding site, and the deletion of two bases in tfpB which cause a frameshift that reduces the ORF by about one-third. To confirm that the differences were not cloning artifacts, these areas were
VOL. 173, 1991
M. LACUNATA PILIN GENES
4003
tfpB ---a 1751 TACTAAAATAATCAATCACAATTATCATCCATTTCTTTTTATTCTTGTTTTAAAAGATACTTAAGTCATGCTAAATAATT 1831 TTAATAAATTTGTCGCCTCGTCGGTATCAATGGCGTAmGCTGTATTAAGTTGGGCGACGGCTTACGCTTATGGTTIG
1911
GGTCAAGCAGCATATCAT0GCTACCCATGGTGGCATGTAGTGCAAGGTGGTAGCATGATTGCCAGAAGTTTGGCTTATGT 1985
CTGTGTGGTATCCATGATTCTTGTTATTGGCTATTTGATCGGATATCAGGCGTTTA------TTAAGAGATTTTTTGGGC 2065 TACTACATGCCTCTTGGGOTGCATCTCATTTGGGGTTTGTCAAAATTTATTTTATTGGCGATCGTATCAACACCCATC
2145 ATGTTGCTACTGTATT rTATATTGGTATTTTGTCGTCATACCGTCTGATGGGATGTGTACTTTCTAT1TITAGCTATTTC
2225 TTTAGTTTGCCATAAGTTCGGACGGOCAATCTCTTTTlCTATTCGTCTTAGGAGTTGATOAGTAACGAAAAATATTATC 2305
AGATTTTTATGGCTTTTAMTTGTGTATGTGGTCGTTTCTGCGTTTTCGATAGGGTATTTGCGTTCAGCCTTTTTTACG 2383
GGTTATGAT--TATTGAAGTAGAGAATCGCCCTTATTACATCTTGGTGGCAAACGGTGATGAAGAGTTTATCTTGGGTGA 2463 GAACATCAAGCACAACAGTCATTTTATCTTTTTTAATCGCAAAACTTTAAATCATTACACCATACACATCACACCATCTC 2543 CTTATCTACCCTATAAAAACCAACTATCGGCACAAATATACCACCAAGAATAAGCAATATTTGACAATTTGTATAGTAAA 2623 TTCTATTCAAAGCACAACAAAGGTTCTCCGTTCGTGGTAAGCTATGCCCGCCCATAACGGAGAACCGCTTCACCCGCAGG
********************T** ****TA****************************************** 2703 CAGGCTCAGAGCGAACGGTTTTTGTATGATTTTGATATGAATTGAGTGTGGTTAGACTTGAATGTGTAACCTGAGCTGGT ******* ****** * ******_**** **** ***************
*******.*_
2783 ACGCCAACGGTTCTTTGAGTGGCGGTTTTTCTTATATTTGATGTTAATTGCTCTTTTTAAGAGATGTTAATAGTGGTTGC 2861
TGATGATGTATTTACGTAAAACACCACCCCATAAAGGAGCGGTG--TTTTGTAATCTAAGAGTAGATTATTACTGAGCTG ******************************--- **GT************cT**G*** --- ***T*TcTTGA
2941
TACAGCCAGTTGGGATAAATTTGTCTTTCCAACCAGTAGCACCAGAACCGTTAATAGTACAACTCCATACACCATCAOCA C***JL*********T*G**C**C*****GT*TT**CT**TTG******A*C(;**TT*G***G**********O;****T* 3021 OCACGA TT1TGCAT0ATTTTCGCACCAGTGATGTCTTTATTAGCACGTGTACCCAAGGTGCCAOTAATAOToCCAOCTGA *T** *T*C* **T(;*** *AACA*TqTTTG*C** *******TTTGT** ********A*** *L* *****A**T**ACC 3098
ACTAGTAGCAGAGAAACCACTTAATTCAACATTTGACATCAAGTTGGAACGAGGTT -
GTTOGTGTCAGTTA
*T*GTC***---A****************GAA*******GA*************TGTGCTA*TTCT*ACCT***C*
3175
GACCAATATCCTCTTTGGAGGTATCAGCATTATTAGCTTCAATACTGGCTCTTTACCTTCAAACAAAGCAGCATCTAC& *********T******T**L**GCT--- *GAT*CTT*ACTT*GC**A**AGT************T*G*************
3255
GCAGTTTTACCAGCAGCTAGTTCGCCCACTACACGAGTAGTTTGAGACTTAGAGATGTAGTCTTGGTAAGCAGGTAGAGC 3303 .Z- tfpI GATTGCAGCTAGGTAGAGCGATTGCAGCTAGGATACCAATAAATGTTA
---*******a******************************
FIG. 2. Comparison of the DNA sequences of the M. lacunata (top) and M. bovis (bottom) pilin gene inversion regions. Comparison begins immediately 5' of the previously published piv sequence (12). Symbols: *, identity to the M. lacunata sequence; -, gaps. The tfpB, tfpI, and tfpQ genes and direction are given in boldface. DNA gaps in coding regions are positioned to correspond to optimization of amino acid homologies. The 19-bp insert in tfpl (3247 to 3265), the 15-bp insert (2678 to 2692) in the underlined M. bovis putative recombinational enhancer (5), and the AT deletion (2315 to 2316) in tfpB are italicized.
amplified by PCR from the genomic DNA of M. lacunata ATCC 17956 and M. bovis Epp63 and from plasmid pMxLl. The results from the amplified region are shown in Fig. 4. Using primers L3 and L4 in the nonexpressed pilin gene region, genomic DNA from M. lacunata ATCC 17956 P+,
M. lacunata ATCC 17956 P-, and M. bovis Epp63 resulted in single bands at 170, 151, and 151 bp, respectively. Plasmid pMxLl produced two or three bands in the PCR reaction, the lowest corresponding to the M. bovis Epp63 and M. lacunata ATCC 17956 P- band (151 bp), the middle at the M.
4004
J. BACTERIOL.
ROZSA AND MARRS 1 kb
Lll
L8
M. bovis tfpB
Putative M. bovis recombinational enhancer
Pilin
expression locus
-4-1-
-
-44
FIG. 3. Schematic comparison of the pilin gene inversion regions of M. lacunata ATCC 17956 and M. bovis Epp63. The sequencing strategy for M. lacunata ATC 17956 is shown by arrows below. Directions of transcription of putative genes are shown by arrows above. Differential shading of the tfpB gene defines the relative size of the gene for M. lacunata and M. bovis. The black area 5' of the inversion region indicates the conserved regions of tfpQ and tfql. The small black and white box at the 3' end of the tfpI gene indicate the 19-bp perfect tandem repeat, of which one is indicated in tfpQ by a small white box. The 15-bp insert is shown as a black line in the 60-bp putative M. bovis recombinational enhancer (stippled box). PCR and DNA sequencing primer locations and direction are shown.
lacunata ATCC 17956 P+ band (170 bp), and an upper band migrating slightly more slowly. Similar analysis using primers L5 and L6 for PCR of the M. bovis putative recombinational enhancer region showed a single band of 94 bp for M. bovis Epp63, a single band of 109 bp for M. lacunata ATCC 17956, and a single band of 109 bp for plasmid pMxLl. PCR
1
2
3
4 5
6 7 8 9
10
11
FIG. 4. PCR analysis of the 19-bp insert in the pilin gene using primers L3 and L4 (lanes 1 to 4), the 15-bp insert in the M. bovis putative recombinational enhancer (5) using primers L5 and L6 (lanes 6 to 8), and the 2-base deletion result in the truncation of the M. lacunata tfpB gene using primers L1o and L18 (lanes 9 to 11). PCR was carried out according to the manufacturer's directions, using an annealing temperature of 55°C and [Mg2+] of 0.75 mM; 8 ml of the product was electrophoresed on a 4% (3% NuSieve-1% agarose) agarose gel as described in the text. Lanes: 1, pMxLl; 2, M. lacunata ATCC 17956 P+; 3, M. lacunata ATCC 17956 P-; 4, M. bovis Epp63 Q P+; 5, A digested with PstI; 6, pMxL1; 7, M. lacunata ATCC 17956 P+; 8, M. bovis Epp63 Q P+; 9, pMxLl; 10, M. lacunata ATCC 17956 P+; 11, M. bovis Epp63 Q P+.
using primers L10 and L18 resulted in bands at approximately 283 bp for pMxLl, M. lacunata ATCC 17956, and M. bovis Epp63. When the PCR products of M. lacunata and pMxLl were sequenced, all three regions were found to perfectly match the DNA sequence determined by sequencing plasmid pMxLl. The sequence for the amplified genomic DNA from the M. bovis sequence in these areas also corresponded exactly to previous sequence results from M. bovis DNA cloned into plasmids in E. coli. The sequence of the upper band sometimes present in pMxLl amplified by using primers L3 and L4 showed that it was a heteroduplex of the 151-bp band and the 170-bp band. The slower migration is presumably due to the effect of a 19-bp single-stranded loop present in the heteroduplex DNA. DISCUSSION the We have cloned pilin gene inversion region into E. coli from piliated M. lacunata ATCC 17956, based on hybridization to a probe containing M. bovis Epp63 tfpQ as previously reported (12). The resulting plasmid, pMxLl, was found to invert a 2-kb region of DNA. Previous work on M. bovis has shown that the inversion region contains one complete gene in the expression locus and one partial gene capable of switching into the expression locus (5, 13). The presence of pilin gene homology and an invertible region on pMxLl suggested that M. lacunata might share the gene structure and switching mechanisms found for M. bovis. Western blot results using M. bovis Q antiserum indicated that pMxLl produced a weak band that corresponds to pilin from M. lacunata ATCC 17956. However, once the plasmid was phase locked in orientation 1 (pMxL5), a much stronger pilin band was produced. Phase-locked constructs in orientation 2 (pMxL6) failed to produce pilin, which was not surprising given the presence of a 19-bp insert early in the gene. M. lacunata tfpQ and tfpI pilin genes were defined on the basis of the transcriptional direction of tfpB, so they would
M. LACUNA TA PILIN GENES
VOL. 173, 1991
4005
M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ M. bovis TfpI M. bovis Dalton 2d
M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ M. bovis TfpI M. bovis Dalton 2d
D XG t..T LIQ 1N K.JA ..IG -....i
IC AA
a
xIS
S
N
VN P S A D
M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ M. bovis TfpI M. bovis Dalton 2d
E T G G -V [; A [B1 S N V ES S 1G S S v N I G G G A A S E S A v S S T
M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ M. bovis TfpI M. bovis Dalton 2d M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ
V-ITC NH.JQ S JT I N
Q G T G S G T I N G S A
:.V..'
I D G
M. bovis Tfpl M. bovis Dalton 2d
s
RE
T
Q
_ __ ED K X P.....x.S X.
N T A P A Q
i
J.GV
AKYIK
GNG
Y
NG -KG
v
K A
FIG. 5. Comparison of predicted amino acid sequences of M. lacunata TfpQ, M. lacunata TfpI, M. bovis Epp63 TfpQ, M. bovis TfpI, and M. bovis Dalton 2d pilins. The M. lacunata TfpI sequence is presented with one of the 19-bp repeats removed for analysis.
correspond to similarly named genes in M. bovis. The predicted amino acid sequence of M. lacunata TfpQ was found to be most like the M. bovis Epp63 Q pilin sequence. However, a partial gene on the opposite side of the inversion region also had homology to both M. bovis Q and I pilins. This partial gene corresponds to the nonexpressed I pilin gene of M. bovis and, like the M. bovis gene, would be expected to produce pilin if put into the expression locus after an inversion event. As mentioned previously, this is not the case with M. lacunata tfpl pilin, since analysis of the gene revealed a perfect 19-bp tandem repeat near the middle of the 26-bp inversion junction site. This 19-bp duplication causes a frameshift in the M. lacunata tfpI pilin gene that disrupts the translation of this gene even when in the expression locus. By removing one of the 19-bp repeats from the sequence used for analysis, the predicted amino acid sequence of the M. lacunata TfpI pilin was most similar to the M. bovis Epp63 Q pilin sequence, although M. lacunata TfpQ had a slightly higher percent match to M. bovis Q pilin. Comparison of the two M. lacunata pilin genes, with the 19 bp deleted from TfpI for analysis, revealed 82.3% homology at the amino acid level between these two pilins, compared with the 73% homology between the two M. bovis Q and I pilins. This high level of homology explains why using M. bovis anti-Q or anti-I serum gives similar results on Western blots. Although pMxLl made pilin on Western blots, the amount was far less than that observed with piliated M. lacunata ATCC 17956 or the phase-locked construct pMxL5, even though at least as much total protein was loaded in the pMxLl lane. There are two possible explanations for the decreased pilin production of pMxLl. One reason for reduced pilin production in E. coli containing pMxLl involves
the mixed population of cells containing pMxLl in either orientation 1 or orientation 2. Since pMxLl is usually isolated at about 50% in each orientation and the plasmids in orientation 2 are not capable of expressing pilin, only half of the cells containing pMxLl will be able to express pilin, thus reducing the amount of pilin observed on the Western blot. A second factor is that inversion causes an apparent reduction of the plasmid copy number available for pilin production in E. coli. Quantitative yields of plasmid pMxLl are far lower that those obtained from phase-locked derivatives of pMxLl, even though the phase-locked derivatives are 2 kb larger as a result of insertion of the fl interposon. The origin of the 19-bp insert in the pilin gene and inversion site is unclear. Since the duplication occurs at the site of the normal inversion event, it may be a result of an aberrant inversion-repair event. M. bovis Epp63 was found to have a 60-bp region within the inversion region that has a 50% homology to the recombinational enhancers found in the Cin inversion system of phage P1 (5). When this area was examined by sequencing PCR amplification products of M. lacunata ATCC 17956 and pMxLl, there was a 15-bp insert relative to the putative M. bov,is recombination enhancer. This insertion would disrupt the critical spacing requirement of 48 bp between the center of two potential Fis binding sites (7). We are carrying out further genetic analyses using Fis mutants and other potential host gene mutations thought to be important in inversion events (11). Comparison of amino acids of the pilins of pMxLl from M. lacunata and M. bovis. The predicted amino acid sequences of the two pilins derived from the DNA sequence of pMxLl compared with previously determined amino acid sequences of the M. bovis pilin genes are shown in Fig. 5. The M.
4006
ROZSA AND MARRS
lacunata TfpI pilin is presented without the perfect tandem repeat of 19 bp in the DNA sequence at positions 3247 to 3265. The percent identities between the different pilins in the expression locus are as follows: M. lacunata TfpQ/M. lacunata TfpI, 82.3; M. bovis TfpQ/M. lacunata TfpQ, 76.4; M. bovis TfpQ/M. lacunata TfpI, 75.1; M. bovis TfpQ/M. bovis TfpI, 73.2; M. bovis TfpI/M. lacunata TfpI, 70.8; and M. bovis TfpI/M. lacunata TfpQ, 69.0. Analysis of the inversion region identified an ORF of 193 amino acids which we have named tfpB. This ORF lies entirely within the inversion region and would code for a protein of 21.854 kDa, the function of which is unknown. In M. bovis Epp63, the equivalent ORF is 261 amino acids long (5). Sequence analysis of pMxLl tfpB shows a frameshift deletion of an AT at the point of divergence from M. bovis tfpB. Prior to this frameshift, there is 96.4% identity in the predicted amino acid sequences of the tfpB genes. The intercistronic region between the M. bovis tfpQ and tfpB genes contains a potential stem-loop structure (positions 1571 to 1609; Fig. 2) that could act as a transcriptional terminator for tfpQ (5). The equivalent region in M. lacunata has no transcriptional terminator, and the overall DNA similarity is only 48% in the intercistronic region. This may be significant since there is no apparent promoter for tfpB in either M. bovis or M. lacunata, and therefore it is predicted that M. lacunata tfpB would be cotranscribed at higher levels than is M. bovis tfpB. Further studies measuring actual RNA transcript levels and mRNA start sites of tfpB are necessary to determine whether this is so. The three bands sometimes observed from PCR reaction of pMxLl in the tandem repeat are interesting. The lower band corresponds to M. bovis Epp63 and is the result of primer L3 binding to the identical sequence in the orientation 1 pilin gene that does not contain the repeat. As mentioned, the pilin sequences are very highly conserved in this region so that when inversion takes place, PCR can use primer L3 binding to the nonexpressed pilin and primer L4 3' of the inversion region, making the M. lacunata-sized product. Since pMxLl exists in both orientations, an M. bovis-sized PCR product can arise by binding of the primer L3 tfpQ pilin gene (lacking the 19-bp repeat) in orientation 2 (no pilin expressed). The upper band probably resulted from heteroduplex formation between the PCR products either having or lacking the extra 19 bp. Only one band was observed when the same primers were used with phase-locked constructs (data not shown), which is consistent, since the heteroduplex will form only if both sizes of PCR product are present in the same reaction. Since M. lacunata genomic DNA produced only one PCR band, it may be an indication of the normal (low) inversion frequency of the pilin gene region. Plasmid pMxLl is contained on a high-copy-number plasmid vector, and large amounts of the putative invertase are made such that inversion occurs far more frequently than on the native genomic M. lacunata DNA. ACKNOWLEDGMENTS We thank Elliot Juni for his confirmation of strain ATCC 17956 as an M. lacunata strain. This work was supported by Public Health Service grant 2-ROlEY07125 from the National Eye Institute.
J. BACTERIOL. REFERENCES 1. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523. 2. Bovre, K., and N. Hagen. 1981. The family Neisseriaceae: rod-shaped species of the genera Moraxella, Acinetobacter, Kingella, and Neisseria, and the Branhamella group of cocci, p. 1506-1529. In M. P. Starr, H. Stolp, H. G. Truper, A. Balows, and H. G. Schlegel (ed.), The prokaryotes: a handbook on habitats, isolation, and identification of bacteria. Springer-Verlag, New York. 3. Cooperman, E. W., and A. H. Friedman. 1975. Exogenous Moraxella liquefaciens endophthalmitis. Ophthalmologica 171: 177-180. 4. Dalrymple, B., and J. S. Mattick. 1987. An analysis of the organization and evolution of type 4 fimbrial (MePhe) subunit proteins. J. Mol. Evol. 25:261-269. 5. Fulks, K. A., C. F. Marrs, S. P. Stevens, and M. R. Green. 1990. Sequence analysis of the inversion region containing the pilin genes of Moraxella bovis. J. Bacteriol. 172:310-316. 6. Glasgow, A. C., K. T. Hughes, and M. I. Simon. 1989. Bacterial DNA inversion systems, p. 637-659. In D. E. Berg and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C. 7. Hubner, P., and W. Arber. 1989. Mutational analysis of a prokaryotic recombinational enhancer element with two functions. EMBO J. 8:577-585. 8. Hughes, D, E., and G. W. Pugh. 1970. A five-year study of infectious bovine keratoconjunctivitis in a beef herd. J. Am. Vet. Med. Assoc. 157:443-451. 9. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. 10. Marrs, C. F., K. A. Fulks, M. Hackel, F. W. Rozsa, W. W. Ruehl, S. P. Stevens, and S. W. Weir. 1990. Studies on bacterial type 4 pili in the family Neisseriaceae, p. 69-75. In 0. Olsvik and G. Bukholm (ed.), Application of molecular biology in diagnosis of infectious diseases. Norwegian College of Veterinary Medicine, Oslo. 11. Marrs, C. F., M. Hackel, F. W. Rozsa, and S. P. Stevens. Unpublished data. 12. Marrs, C. F., F. W. Rozsa, M. Hackel, S. P. Stevens, and A. C. Glasgow. 1990. Identification, cloning and sequencing of piv, a new gene involved in inverting the pilin genes of Moraxella lacunata. J. Bacteriol. 172:4370-4377. 13. Marrs, C. F., W. W. Ruehl, G. K. Schoolnik, and S. Falkow. 1988. Pilin gene phase variation of Moraxella bovis is caused by an inversion of the pilin genes. J. Bacteriol. 170:3032-3039. 14. Marrs, C. F., G. Schoolnik, J. M. Koomey, J. Hardy, J. Rothbard, and S. Falkow. 1985. Cloning and sequencing of a Moraxella bovis pilin gene. J. Bacteriol. 163:132-139. 15. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313. 16. Ringvold, A., E. Vik, and L. S. Bevanger. 1985. Moraxella lacunata isolated from epidemic conjunctivitis among teen-aged females. Acta Ophthalmol. 63:427-431. 17. Ruehl, W. W., C. F. Marrs, R. Fernandez, S. Falkow, and G. K. Schoolnik. 1988. Purification, characterization, and pathogenicity of Moraxella bovis pili. J. Exp. Med. 168:983-1002. 18. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 19. Silberfarb, P. M., and J. E. Lawe. 1968. Endocarditis due to Moraxella liquefaciens. Arch. Intern. Med. 122:512-513. 20. Tonjum, T., G. Bukholm, and K. Bovre. 1989. Differentiation of some species of Neisseriaceae and other bacterial groups by DNA-DNA hybridization. APMIS 97:395-405. 21. Towbin, H., T. Staehlin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354.
JOURNAL OF BACTERIOLOGY, JUlY 1991, p. 40004006
0021-9193/91/134000-07$02.00/0
Copyright X 1991, American Society for Microbiology
Interesting Sequence Differences between the Pilin Gene Inversion Regions of Moraxella lacunata ATCC 17956 and Moraxella bovis Epp63 FRANK W. ROZSAt AND CARL F. MARRS* Department of Epidemiology, University of Michigan, Ann Arbor, Michigan 48109 Received 7 December 1990/Accepted 22 April 1991 The bacterium Moraxella lacunata is a causative agent of human conjunctivitis and keratitis. We have previously reported construction of plasmid pMxLl, which includes a 5.9-kb fragment on which the pilin gene inversion region of M. lacunata resides. The inversion region of pMxLl was shown to invert when pMxLl was in an Escherichia coli host cell. In this report, we present Western immunoblot analysis using Moraxelia bovis Epp63 anti-I and anti-Q pilin sera which demonstrate that pMxLl makes pilin only when in orientation 1. The sequence of the pMxLl plasmid containing the invertible region contains a perfect tandem repeat of 19 bp in the orientation 1 nonexpressed pilin gene at the middle of the recombination junction site. This 19-bp insert causes a frameshift and disrupts the pilin gene. The predicted amino acid sequence of this nonfunctional pilin gene (with the 19-bp repeat subtracted) bears closest resemblance to M. bovis Epp63 Q pilin sequence, although the other (functional) M. lacunata pilin encoded by pMxLl shows slightly higher homology to Q pilin. Comparison of the pMxLl sequence with that of the M. bovis Epp63 sequence shows two other particularly interesting differences. One is a 15-bp sequence addition found in pMxLl at the 60-bp region previously reported as a possible M. bovis recombinational enhancer. The second is an AT deletion in pMxLl compared with Epp63 within an open reading frame (tfpB) which results in the pMxLl tfpB open reading frame being one-third shorter than in Epp63. The DNA sequences in these three altered regions from the M. lacunata strain from which pMxLl was derived were amplified by polymerase chain reaction and sequenced. The parent strain was found to contain the differences seen in pMxLl. Comparison of the M. bovis and M. lacunata pilin gene amino acid sequences is also presented.
Moraxella pilin gene inversion systems and those of the Hin family of bacterial DNA invertible elements (5, 6, 12, 13). In this report, we present the DNA sequence of the pilin gene inversion region of M. lacunata ATCC 17956 as cloned onto pMxLl and compare it with the previously reported DNA sequence of M. bovis Epp63 (5). We present polymerase chain reaction (PCR) analysis using the parental M. lacunata ATCC 17956 in three regions that differ between pMxLl and Epp63. We also compare the predicted amino acid sequences of the M. lacunata pilins with three M. bovis pilin amino acid sequences.
The type 4 (MePhe) class of bacterial pili is found on a wide variety of gram-negative bacteria (4), including Moraxella bovis (14) and Moraxella lacunata (12). The type 4 piliated (P+) bacteria of the family Neisseriaceae (including Moraxella, Branhamella, Neisseria, and other genera) display several phenotypic differences from the equivalent nonpiliated (P-) bacteria. These phenotypes include colony morphology, pitting of agar, autoagglutination, pellicle formation, hemagglutination, twitching motility, and increased competence for natural DNA transformation (for a review, see reference 10). We have been studying the type 4 pilin gene regions of M. bovis and M. lacunata. These organisms are very closely related, as determined by both DNA-DNA hybridization analysis (20) and transformation studies (2). M. bovis is the primary cause of bovine infectious keratoconjunctivitis (8), and M. lacunata is a pathogen which occasionally causes conjunctivitis in humans (3, 16, 19). A single strain of M. bovis is capable of producing one or the other of two pilin types, named Q (previously P) and I (previously x) for strain Epp63 (14, 17). The switch in expression between the tfpQ and tfpl pilin genes is due to an inversion of a 2.1-kb region of DNA (5, 13). When tfpQ is in the expression locus it is in orientation 1, while orientation 2 has tfpI in the expression locus. We have shown that a gene (piv) adjacent to the inversion region is required for inversions to occur (12). We have described both similarities and differences between the
*
MATERIALS AND METHODS Bacterial strains, plasmids, and media. M. bovis Epp63 was described previously (5, 13) and grown on GC agar base
(Difco Laboratories, Detroit, Mich.) with 1% IsoVitaleX (BBL Microbiology Systems, Cockeysville, Md.). Escherichia coli strains containing drug-resistant plasmids were grown on L agar containing the following concentrations (in micrograms per milliliter) of the appropriate antibiotic: carbenicillin, 100; streptomycin, 100; spectinomycin, 25; tetracycline, 15; kanamycin, 25; or chloramphenicol, 12.5 (Sigma Chemical Co., St. Louis, Mo.). E. coli DH5a [F- endAl hsdRJ7 supE44 thi-J recAl gyrA96 relAl A(argF-lacZYA)U169 (+80dlacZAM15)] (Bethesda Research Laboratories, Inc., Gaithersburg, Md.) was used for transformation of deletion derivatives and Ql interposon insertions of pMxLl. M. lacunata ATCC 17956 was grown on heart infusion agar at 35°C and was kindly provided by Elliot Juni, University of Michigan, Ann Arbor. Plasmids pMxLl, pMxL5, and pMxL6 were constructed as described previously (12).
Corresponding author.
t Present address: Department of Microbiology, Biozentrum, University of Basel, CH-4056, Basel, Switzerland. 4000
M. LACUNATA PILIN GENES
VOL. 173, 1991
DNA isolation and manipulation. Phage and plasmid DNAs were isolated as described previously (1, 14). Restriction enzymes were purchased from New England BioLabs, Inc., Beverly, Mass.; Bethesda Research Laboratories; Boehringer Mannheim Biochemicals, Indianapolis, Ind.; or Promega Biotec, Madison, Wis. Restriction endonuclease digestions and agarose gel electrophoresis were carried out as previously described (12, 14). Restriction enzyme-generated DNA fragments were isolated from ethidium bromidestained gels by using long-wave UV light to localize the fragments; then the bands were excised from the gel, and the agarose was removed by using Geneclean (Bio 101, Inc., La Jolla, Calif.). Deletion derivatives of pMxLl were obtained by using exonuclease III digestion of double-cut DNA and the Erase-a-Base system (Promega Biotec) as described previously (12). Insertion of the fl interposon at the HinclI site in piv to generate phase-locked constructs pMxL5 and pMxL6 was described previously (12). Synthetic oligonucleotide primers. Synthetic oligonucleotide primers for DNA sequencing and PCR were purchased from Genosys Biotechnologies, Inc. (Woodlands, Tex.) and included L3 (5'-GCAGTTTTACCAGCAGCTAG-3'), L4 (5'GTTATTCGCCAAAATCGCCC-3'), L5 (5'-CAGGCTCA GAGCGAACGGTT-3'), L6 (5'-CCGCCACTCAAAGAAC CGTT-3'), L8 (5'-GCATTGTCTGTGCCAAC-3'), L9 (5'GATACCGACGAGGCGAC-3'), L10 (5'-CCGTCTGATG GGATGAG-3'), Lii (5'-GCAGTGCCACTGATACCG-3'), and L18 (5'-GATGTTCTCACCCAAGA-3'); their positions are shown in Fig. 3. DNA sequencing. Deletion derivatives of pMxLl were sequenced by the dideoxy-chain termination method of Sanger et al. (18) as previously described (5, 12), using T7 polymerase (Sequenase) from United States Biochemical and the synthetic oligonucleotide primers L3, L4, L5, L6, L8, L9, L10, and Lii described above. Double-stranded PCR products were sequenced directly after purification on 3% NuSieve-1% agarose (FMC Bioproducts, Rockland, Maine) and cutting out the band of interest. The band was removed from the gel matrix by using Geneclean (Bio 101) and sequenced as described above with the addition of 0.05% Tween 20 (J. T. Baker Chemical Co., Phillipsburg, N.J.) and 0.05% Nonidet P-40 (Sigma) throughout the annealing, labeling, and termination steps, using the MN buffer in the Sequenase kit (United States Biochemical) for sequencing short molecules. Primers used for sequencing PCR products were L4 for the tandem repeat region, L5 for the recombinational enhancer region, and L18 for the AT deletion in tfpB. PCR to amplify genomic DNA. Synthetic oligonucleotide primers L3, L4, L5, L6, L10, and L18 were made to match completely conserved sequence regions so they could be used for amplification of both pMxLl and M. bovis genomic DNA in the regions of interest. PCR was carried out in an Eppendorf MicroCycler according to the manufacturer's instructions except that 55°C was used for the annealing temperature. DNA sequence analysis. DNA sequence analysis was performed by DNAstar (Madison, Wis.) or the Eugene Program (Baylor College of Medicine, Houston, Tex.). DNA sequences were compared with those in the GenBank data base (IntelliGenetics, Inc., Mountain View, Calif.), and translated open reading frames (ORFs) were compared with sequences in the PIR data base (Georgetown University,
Washington, D.C.). Western immunoblots. Whole cells were denatured by boiling in 2% sodium dodecyl sulfate-I% 2-mercaptoetha-
1
2
3
4
5
6
7
8
9 10
4001
11
FIG. 1. Western transfer analysis of whole-cell lysates of M. bovis Epp63, M. lacunata ATCC 17956, and the cloned M. lacunata pilin gene in pMxLl in E. coli DHSa. Samples were electrophoresed on a 13% sodium dodecyl sulfate-polyacrylamide gel and electrophoretically transferred to nitrocellulose paper. The resulting filter was incubated with M. bovis Epp63 Q pilin antiserum (1:1,500) as described in the text. Lanes: 1, M. bovis Epp63 Q P-; 2, M. bovis Epp63 Q P+; 3, M. bovis Epp63 I P-; 4, M. bovis I P+; 5, M. lacunata ATCC 17956 P-; 6, M. lacunata ATCC 17956 P+; 7, pMxLl in E. coli DH5ot; 8, pMxL5 (phase locked in orientation 1) in E. coli DH5a; 9, pMxL6 (phase locked in orientation 2) in E. coli DH5a; 10, E. coli DH5a; 11, pMxLldRl3 (parent plasmid of pMxL5 and pMxL6) in E. coli DH5ot. P- indicates pilus negative but can be either pilin negative as in lane 1 or pilin positive as in lane 3. The closely positioned multiple bands of immunoreactivity in lanes 6, 7, 8, and 11 are an artifact of the electrophoretic conditions and are not always observed. We believe that these bands represent the same pilin molecules.
nol-50 mM Tris, pH 7.5. Preparations were separated on a 13% polyacrylamide gels, using the system of Laemmli (9). Gels were stained with Coomassie blue to confirm the relative amounts of total protein present in each lane. Gels were immunoblotted as follows. Proteins were electrophoretically transferred to nitrocellulose paper by the method of Towbin et al. (21). Filters were treated with 5% nonfat dry milk in PBS (0.1 M phosphate-buffered saline, pH 7.5) with 0.05% (vol/vol) Tween 20 for 1 h, incubated with rabbit anti-M. bovis I pilin antiserum (1:1,650) for 4 to 10 h, washed with PBS-0.05% Tween 20, incubated with goat anti-rabbit antibody conjugate (1:3,000) for 2 h, washed in PBS, and developed by using 0.5 mg of 3,3'-diaminobenzidine (Sigma) per ml in PBS with 0.01% (vol/vol) 30% hydrogen peroxide; the reaction was stopped by a wash in water. Nucleotide sequence accession numbers. The GenBank numbers for the reported M. lacunata and M. bovis DNA sequences are M59711 and M59712, respectively.
RESULTS Plasmid pMxLl produces pilin in Western blots. As described previously (12), we observed different hybridization patterns between piliated and nonpiliated M. lacunata ATCC 17956 DNA when probed with labeled, cloned M. bovis tfpQ DNA. These patterns were similar to those observed when M. bovis Epp63 undergoes phase variation, the switching of tfpQ to tfpI in the expression locus. We obtained a XZAP library of M. lacunata DNA and cloned the pilin gene region of M. lacunata. One of the plasmid clones (pMxLl) was isolated for further study. Plasmid pMxLl, which contained a putative invertase gene (piv), also contains a 2-kb invertible region which in M. bovis contains the pilin genes (12). To determine whether the M. lacunata pilin could be expressed in E. coli, Western blots were performed. From Western blot results (Fig. 1), it was apparent that pMxLl in E. coli produced a pilin protein the same size as that of the parent strain M. lacunata ATCC 17956, although in reduced quantity and slightly larger in size than the M. bovis Q pilin. Furthermore, when pMxLl was phase locked by insertion of the Ql fragment (a streptomycinspectinomycin resistance gene flanked by transcriptional and
4002
J. BACTERIOL.
ROZSA AND MARRS 80
TTACTAATAQTACTTCCTTTGGAGTGCTTTTATGAAAAAATTAATCCTAACCACGCTTGTCGCTGCCCTTGCTTTGACA 160 GCGTGTAGCAAAGAGACCAGCGATAAGGCTGCCGAGACGGTCAGTCTGCCGCCACTGACACCGCCAATAACGCCAAAGCC 240 GCTGCTGACACTGTGGCCGCCGAGCGAAGCTGCAGCCAATGCGACCGCTGAAGGTGTCTCTAATGTCGCTCATGACGTGG 319
CAAATAATGGCGTAGAAAATGCCAAAATACCGCCGAAACCGCCGCACG-GTGGTCTCTOATGCCGCCACCGCCACCGCC 399
GATGCCGTGACAGGGGCTGCCAGCAGTGCCACTGATACCGTAACAGGCAACACCGCCACCGCCGAACAGCQAGCCCCCGA 479
GACACAAAAGTACTAATCCACCATCACCAAAGCCCCGAACATGTTC:GGCTTTTTTGATAAAAATGAATTTACAGCCAG 558
CGAATCTGATGTTCGCCATGGATCTGTGATGTTCACCCATTTCACATCATCTTATGCCGTTTATCAACATTGACAAAA638
TCGTCACACTGACAQTTAATGCCATGTCAGTGTCCATTTGTGTCAAAAATTGGCTAATATGACAAATTTTGGCAACAA 718
TTTTTGATAGGTAAAAATTTTGTCCATGTCAAAATTGGCATCCCCAAAATGTCGCCCACCTGCCAAATGTC 798
AAlAAATCCAAkAACTGACAAAAATTGTCACCCAAAATTACCTGCCAGACATCAAATTTTAAAAATTTTTAAAAATTTTT
G****************************************C***************************-----------
878
TrGGTAAAAAAGAAAAATTTGTACATATCTTAATCAATTAAAAATGGCAAAATCTGCTTATTTTTTAGACAAAA ******************
**** *
*T**** ************* **A*********A***C****** ** ****
957
TTTTTAAAATTTTCTCAATTTTGCCTATTTTTCCCAAAA-CAGTCCAAATCCGCCAAAGTTGGCACGACAATGCAAC 1037
AGTATGAGTGTAAGGTTAGCAAATATGTTTAAAGTTGCTAATCACTTAACTTAAACAAACTGG-CAATATCGCCCCTATO 1117 _ tfpQ AACTAAGGAGTTCATTATGAACOCTCAAAAGGTTTCACCCTTATCOAACTAATGATTGTAATCGCCATTATTGGTATCC 1197
TAGCTGCAATCGCTCTACCTGCTTACCAAGACTACATCTCTAAGTCTCAAACTACTCGTGTAOTGGCGAACTAGCTGCT 1277 OOTAARA
GTACTGTTTTTTGAAGGTAAAGAGC
**************G*****************G******AC**CAAC*A*G
CAQCCGCAACCTCTAAGAO **TvA**AC**T---****
1356
AGATATTGGCTZJACTTCCACCOGTGCAAGOCTCGCTCTAATCTACTAAAGAAACTOTTAT ***C**C***C*T**CA*T**T**C**T*CC*****T*****CT*OA*G --------- T*A*T***AALTA*A*0***Tg 1431 -TCTCTGCCACTAGTTCAOCTGGTACTATZACTOGT&CCTTGGTAACCGTOCCAATAAAGACATCAGTGGTGCT ---T***AL*** --- T*****C***C*aAGJA*C***S***************************GC******* 1511
OTTCAA
aTcATcaccTcAAACGTGCTATGAcGGTOTaTGGacTqGTCACOTACAGCAAOGCACTGCTACCGGTTGGAAGGATAA *****T******TC!r****A*OCG**A***********C**CQC*aA*TJ*
*C***C*JL********ATC***
1591
ATTTATTCCAcACAOTTOCACAAATACTOCACCATAATTTTAATTATTGAATATATTTTAGTTATGCGAAATCACCTCTT v**CG*aJ**T**T*****T*A*G*O--------- ***Q*CATGAT*C**ATC*CAAC*ACCCA*TCOC---------
1671
ATTGGAGGTGATTTTTGTTTGTGAGAGAAATTCTTTACAATAAATATACAAAAATAAGAAAACAcTTGTCTATTTT
-******TrG*TG****-**AACATA*AG*CAL*A**A********************************************
translational stop signals and restriction site linkers; 15) into the Hincll site of piv, pilin was made only when pMxLl was in orientation 1 (pMxL5). No pilin was observed when pMxLl was phase locked in orientation 2 (pMxL6) by either deletions or insertions in the invertase gene. Sequencing the M. lacunata inversion region found on pMxLl. After determination of the DNA sequence of the inversion region on pMxLl (see Materials and Methods for details), the sequence was compared with our previously published (5) sequence of the M. bovis pilin gene inversion
region (Fig. 2). Figure 3 shows a map of the pilin gene inversion region and three interesting differences that were found in the DNA sequence between pMxLl and M. bovis Epp63. These include a 19-bp perfect tandem repeat in pMxLl at the nonexpressed M. bovis I pilin gene in the inversion junction site, a 15-bp insert at the putative M. bovis recombinational enhancer binding site, and the deletion of two bases in tfpB which cause a frameshift that reduces the ORF by about one-third. To confirm that the differences were not cloning artifacts, these areas were
VOL. 173, 1991
M. LACUNATA PILIN GENES
4003
tfpB ---a 1751 TACTAAAATAATCAATCACAATTATCATCCATTTCTTTTTATTCTTGTTTTAAAAGATACTTAAGTCATGCTAAATAATT 1831 TTAATAAATTTGTCGCCTCGTCGGTATCAATGGCGTAmGCTGTATTAAGTTGGGCGACGGCTTACGCTTATGGTTIG
1911
GGTCAAGCAGCATATCAT0GCTACCCATGGTGGCATGTAGTGCAAGGTGGTAGCATGATTGCCAGAAGTTTGGCTTATGT 1985
CTGTGTGGTATCCATGATTCTTGTTATTGGCTATTTGATCGGATATCAGGCGTTTA------TTAAGAGATTTTTTGGGC 2065 TACTACATGCCTCTTGGGOTGCATCTCATTTGGGGTTTGTCAAAATTTATTTTATTGGCGATCGTATCAACACCCATC
2145 ATGTTGCTACTGTATT rTATATTGGTATTTTGTCGTCATACCGTCTGATGGGATGTGTACTTTCTAT1TITAGCTATTTC
2225 TTTAGTTTGCCATAAGTTCGGACGGOCAATCTCTTTTlCTATTCGTCTTAGGAGTTGATOAGTAACGAAAAATATTATC 2305
AGATTTTTATGGCTTTTAMTTGTGTATGTGGTCGTTTCTGCGTTTTCGATAGGGTATTTGCGTTCAGCCTTTTTTACG 2383
GGTTATGAT--TATTGAAGTAGAGAATCGCCCTTATTACATCTTGGTGGCAAACGGTGATGAAGAGTTTATCTTGGGTGA 2463 GAACATCAAGCACAACAGTCATTTTATCTTTTTTAATCGCAAAACTTTAAATCATTACACCATACACATCACACCATCTC 2543 CTTATCTACCCTATAAAAACCAACTATCGGCACAAATATACCACCAAGAATAAGCAATATTTGACAATTTGTATAGTAAA 2623 TTCTATTCAAAGCACAACAAAGGTTCTCCGTTCGTGGTAAGCTATGCCCGCCCATAACGGAGAACCGCTTCACCCGCAGG
********************T** ****TA****************************************** 2703 CAGGCTCAGAGCGAACGGTTTTTGTATGATTTTGATATGAATTGAGTGTGGTTAGACTTGAATGTGTAACCTGAGCTGGT ******* ****** * ******_**** **** ***************
*******.*_
2783 ACGCCAACGGTTCTTTGAGTGGCGGTTTTTCTTATATTTGATGTTAATTGCTCTTTTTAAGAGATGTTAATAGTGGTTGC 2861
TGATGATGTATTTACGTAAAACACCACCCCATAAAGGAGCGGTG--TTTTGTAATCTAAGAGTAGATTATTACTGAGCTG ******************************--- **GT************cT**G*** --- ***T*TcTTGA
2941
TACAGCCAGTTGGGATAAATTTGTCTTTCCAACCAGTAGCACCAGAACCGTTAATAGTACAACTCCATACACCATCAOCA C***JL*********T*G**C**C*****GT*TT**CT**TTG******A*C(;**TT*G***G**********O;****T* 3021 OCACGA TT1TGCAT0ATTTTCGCACCAGTGATGTCTTTATTAGCACGTGTACCCAAGGTGCCAOTAATAOToCCAOCTGA *T** *T*C* **T(;*** *AACA*TqTTTG*C** *******TTTGT** ********A*** *L* *****A**T**ACC 3098
ACTAGTAGCAGAGAAACCACTTAATTCAACATTTGACATCAAGTTGGAACGAGGTT -
GTTOGTGTCAGTTA
*T*GTC***---A****************GAA*******GA*************TGTGCTA*TTCT*ACCT***C*
3175
GACCAATATCCTCTTTGGAGGTATCAGCATTATTAGCTTCAATACTGGCTCTTTACCTTCAAACAAAGCAGCATCTAC& *********T******T**L**GCT--- *GAT*CTT*ACTT*GC**A**AGT************T*G*************
3255
GCAGTTTTACCAGCAGCTAGTTCGCCCACTACACGAGTAGTTTGAGACTTAGAGATGTAGTCTTGGTAAGCAGGTAGAGC 3303 .Z- tfpI GATTGCAGCTAGGTAGAGCGATTGCAGCTAGGATACCAATAAATGTTA
---*******a******************************
FIG. 2. Comparison of the DNA sequences of the M. lacunata (top) and M. bovis (bottom) pilin gene inversion regions. Comparison begins immediately 5' of the previously published piv sequence (12). Symbols: *, identity to the M. lacunata sequence; -, gaps. The tfpB, tfpI, and tfpQ genes and direction are given in boldface. DNA gaps in coding regions are positioned to correspond to optimization of amino acid homologies. The 19-bp insert in tfpl (3247 to 3265), the 15-bp insert (2678 to 2692) in the underlined M. bovis putative recombinational enhancer (5), and the AT deletion (2315 to 2316) in tfpB are italicized.
amplified by PCR from the genomic DNA of M. lacunata ATCC 17956 and M. bovis Epp63 and from plasmid pMxLl. The results from the amplified region are shown in Fig. 4. Using primers L3 and L4 in the nonexpressed pilin gene region, genomic DNA from M. lacunata ATCC 17956 P+,
M. lacunata ATCC 17956 P-, and M. bovis Epp63 resulted in single bands at 170, 151, and 151 bp, respectively. Plasmid pMxLl produced two or three bands in the PCR reaction, the lowest corresponding to the M. bovis Epp63 and M. lacunata ATCC 17956 P- band (151 bp), the middle at the M.
4004
J. BACTERIOL.
ROZSA AND MARRS 1 kb
Lll
L8
M. bovis tfpB
Putative M. bovis recombinational enhancer
Pilin
expression locus
-4-1-
-
-44
FIG. 3. Schematic comparison of the pilin gene inversion regions of M. lacunata ATCC 17956 and M. bovis Epp63. The sequencing strategy for M. lacunata ATC 17956 is shown by arrows below. Directions of transcription of putative genes are shown by arrows above. Differential shading of the tfpB gene defines the relative size of the gene for M. lacunata and M. bovis. The black area 5' of the inversion region indicates the conserved regions of tfpQ and tfql. The small black and white box at the 3' end of the tfpI gene indicate the 19-bp perfect tandem repeat, of which one is indicated in tfpQ by a small white box. The 15-bp insert is shown as a black line in the 60-bp putative M. bovis recombinational enhancer (stippled box). PCR and DNA sequencing primer locations and direction are shown.
lacunata ATCC 17956 P+ band (170 bp), and an upper band migrating slightly more slowly. Similar analysis using primers L5 and L6 for PCR of the M. bovis putative recombinational enhancer region showed a single band of 94 bp for M. bovis Epp63, a single band of 109 bp for M. lacunata ATCC 17956, and a single band of 109 bp for plasmid pMxLl. PCR
1
2
3
4 5
6 7 8 9
10
11
FIG. 4. PCR analysis of the 19-bp insert in the pilin gene using primers L3 and L4 (lanes 1 to 4), the 15-bp insert in the M. bovis putative recombinational enhancer (5) using primers L5 and L6 (lanes 6 to 8), and the 2-base deletion result in the truncation of the M. lacunata tfpB gene using primers L1o and L18 (lanes 9 to 11). PCR was carried out according to the manufacturer's directions, using an annealing temperature of 55°C and [Mg2+] of 0.75 mM; 8 ml of the product was electrophoresed on a 4% (3% NuSieve-1% agarose) agarose gel as described in the text. Lanes: 1, pMxLl; 2, M. lacunata ATCC 17956 P+; 3, M. lacunata ATCC 17956 P-; 4, M. bovis Epp63 Q P+; 5, A digested with PstI; 6, pMxL1; 7, M. lacunata ATCC 17956 P+; 8, M. bovis Epp63 Q P+; 9, pMxLl; 10, M. lacunata ATCC 17956 P+; 11, M. bovis Epp63 Q P+.
using primers L10 and L18 resulted in bands at approximately 283 bp for pMxLl, M. lacunata ATCC 17956, and M. bovis Epp63. When the PCR products of M. lacunata and pMxLl were sequenced, all three regions were found to perfectly match the DNA sequence determined by sequencing plasmid pMxLl. The sequence for the amplified genomic DNA from the M. bovis sequence in these areas also corresponded exactly to previous sequence results from M. bovis DNA cloned into plasmids in E. coli. The sequence of the upper band sometimes present in pMxLl amplified by using primers L3 and L4 showed that it was a heteroduplex of the 151-bp band and the 170-bp band. The slower migration is presumably due to the effect of a 19-bp single-stranded loop present in the heteroduplex DNA. DISCUSSION the We have cloned pilin gene inversion region into E. coli from piliated M. lacunata ATCC 17956, based on hybridization to a probe containing M. bovis Epp63 tfpQ as previously reported (12). The resulting plasmid, pMxLl, was found to invert a 2-kb region of DNA. Previous work on M. bovis has shown that the inversion region contains one complete gene in the expression locus and one partial gene capable of switching into the expression locus (5, 13). The presence of pilin gene homology and an invertible region on pMxLl suggested that M. lacunata might share the gene structure and switching mechanisms found for M. bovis. Western blot results using M. bovis Q antiserum indicated that pMxLl produced a weak band that corresponds to pilin from M. lacunata ATCC 17956. However, once the plasmid was phase locked in orientation 1 (pMxL5), a much stronger pilin band was produced. Phase-locked constructs in orientation 2 (pMxL6) failed to produce pilin, which was not surprising given the presence of a 19-bp insert early in the gene. M. lacunata tfpQ and tfpI pilin genes were defined on the basis of the transcriptional direction of tfpB, so they would
M. LACUNA TA PILIN GENES
VOL. 173, 1991
4005
M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ M. bovis TfpI M. bovis Dalton 2d
M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ M. bovis TfpI M. bovis Dalton 2d
D XG t..T LIQ 1N K.JA ..IG -....i
IC AA
a
xIS
S
N
VN P S A D
M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ M. bovis TfpI M. bovis Dalton 2d
E T G G -V [; A [B1 S N V ES S 1G S S v N I G G G A A S E S A v S S T
M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ M. bovis TfpI M. bovis Dalton 2d M. lacunata TfpQ M. lacunata TfpI M. bovis TfpQ
V-ITC NH.JQ S JT I N
Q G T G S G T I N G S A
:.V..'
I D G
M. bovis Tfpl M. bovis Dalton 2d
s
RE
T
Q
_ __ ED K X P.....x.S X.
N T A P A Q
i
J.GV
AKYIK
GNG
Y
NG -KG
v
K A
FIG. 5. Comparison of predicted amino acid sequences of M. lacunata TfpQ, M. lacunata TfpI, M. bovis Epp63 TfpQ, M. bovis TfpI, and M. bovis Dalton 2d pilins. The M. lacunata TfpI sequence is presented with one of the 19-bp repeats removed for analysis.
correspond to similarly named genes in M. bovis. The predicted amino acid sequence of M. lacunata TfpQ was found to be most like the M. bovis Epp63 Q pilin sequence. However, a partial gene on the opposite side of the inversion region also had homology to both M. bovis Q and I pilins. This partial gene corresponds to the nonexpressed I pilin gene of M. bovis and, like the M. bovis gene, would be expected to produce pilin if put into the expression locus after an inversion event. As mentioned previously, this is not the case with M. lacunata tfpl pilin, since analysis of the gene revealed a perfect 19-bp tandem repeat near the middle of the 26-bp inversion junction site. This 19-bp duplication causes a frameshift in the M. lacunata tfpI pilin gene that disrupts the translation of this gene even when in the expression locus. By removing one of the 19-bp repeats from the sequence used for analysis, the predicted amino acid sequence of the M. lacunata TfpI pilin was most similar to the M. bovis Epp63 Q pilin sequence, although M. lacunata TfpQ had a slightly higher percent match to M. bovis Q pilin. Comparison of the two M. lacunata pilin genes, with the 19 bp deleted from TfpI for analysis, revealed 82.3% homology at the amino acid level between these two pilins, compared with the 73% homology between the two M. bovis Q and I pilins. This high level of homology explains why using M. bovis anti-Q or anti-I serum gives similar results on Western blots. Although pMxLl made pilin on Western blots, the amount was far less than that observed with piliated M. lacunata ATCC 17956 or the phase-locked construct pMxL5, even though at least as much total protein was loaded in the pMxLl lane. There are two possible explanations for the decreased pilin production of pMxLl. One reason for reduced pilin production in E. coli containing pMxLl involves
the mixed population of cells containing pMxLl in either orientation 1 or orientation 2. Since pMxLl is usually isolated at about 50% in each orientation and the plasmids in orientation 2 are not capable of expressing pilin, only half of the cells containing pMxLl will be able to express pilin, thus reducing the amount of pilin observed on the Western blot. A second factor is that inversion causes an apparent reduction of the plasmid copy number available for pilin production in E. coli. Quantitative yields of plasmid pMxLl are far lower that those obtained from phase-locked derivatives of pMxLl, even though the phase-locked derivatives are 2 kb larger as a result of insertion of the fl interposon. The origin of the 19-bp insert in the pilin gene and inversion site is unclear. Since the duplication occurs at the site of the normal inversion event, it may be a result of an aberrant inversion-repair event. M. bovis Epp63 was found to have a 60-bp region within the inversion region that has a 50% homology to the recombinational enhancers found in the Cin inversion system of phage P1 (5). When this area was examined by sequencing PCR amplification products of M. lacunata ATCC 17956 and pMxLl, there was a 15-bp insert relative to the putative M. bov,is recombination enhancer. This insertion would disrupt the critical spacing requirement of 48 bp between the center of two potential Fis binding sites (7). We are carrying out further genetic analyses using Fis mutants and other potential host gene mutations thought to be important in inversion events (11). Comparison of amino acids of the pilins of pMxLl from M. lacunata and M. bovis. The predicted amino acid sequences of the two pilins derived from the DNA sequence of pMxLl compared with previously determined amino acid sequences of the M. bovis pilin genes are shown in Fig. 5. The M.
4006
ROZSA AND MARRS
lacunata TfpI pilin is presented without the perfect tandem repeat of 19 bp in the DNA sequence at positions 3247 to 3265. The percent identities between the different pilins in the expression locus are as follows: M. lacunata TfpQ/M. lacunata TfpI, 82.3; M. bovis TfpQ/M. lacunata TfpQ, 76.4; M. bovis TfpQ/M. lacunata TfpI, 75.1; M. bovis TfpQ/M. bovis TfpI, 73.2; M. bovis TfpI/M. lacunata TfpI, 70.8; and M. bovis TfpI/M. lacunata TfpQ, 69.0. Analysis of the inversion region identified an ORF of 193 amino acids which we have named tfpB. This ORF lies entirely within the inversion region and would code for a protein of 21.854 kDa, the function of which is unknown. In M. bovis Epp63, the equivalent ORF is 261 amino acids long (5). Sequence analysis of pMxLl tfpB shows a frameshift deletion of an AT at the point of divergence from M. bovis tfpB. Prior to this frameshift, there is 96.4% identity in the predicted amino acid sequences of the tfpB genes. The intercistronic region between the M. bovis tfpQ and tfpB genes contains a potential stem-loop structure (positions 1571 to 1609; Fig. 2) that could act as a transcriptional terminator for tfpQ (5). The equivalent region in M. lacunata has no transcriptional terminator, and the overall DNA similarity is only 48% in the intercistronic region. This may be significant since there is no apparent promoter for tfpB in either M. bovis or M. lacunata, and therefore it is predicted that M. lacunata tfpB would be cotranscribed at higher levels than is M. bovis tfpB. Further studies measuring actual RNA transcript levels and mRNA start sites of tfpB are necessary to determine whether this is so. The three bands sometimes observed from PCR reaction of pMxLl in the tandem repeat are interesting. The lower band corresponds to M. bovis Epp63 and is the result of primer L3 binding to the identical sequence in the orientation 1 pilin gene that does not contain the repeat. As mentioned, the pilin sequences are very highly conserved in this region so that when inversion takes place, PCR can use primer L3 binding to the nonexpressed pilin and primer L4 3' of the inversion region, making the M. lacunata-sized product. Since pMxLl exists in both orientations, an M. bovis-sized PCR product can arise by binding of the primer L3 tfpQ pilin gene (lacking the 19-bp repeat) in orientation 2 (no pilin expressed). The upper band probably resulted from heteroduplex formation between the PCR products either having or lacking the extra 19 bp. Only one band was observed when the same primers were used with phase-locked constructs (data not shown), which is consistent, since the heteroduplex will form only if both sizes of PCR product are present in the same reaction. Since M. lacunata genomic DNA produced only one PCR band, it may be an indication of the normal (low) inversion frequency of the pilin gene region. Plasmid pMxLl is contained on a high-copy-number plasmid vector, and large amounts of the putative invertase are made such that inversion occurs far more frequently than on the native genomic M. lacunata DNA. ACKNOWLEDGMENTS We thank Elliot Juni for his confirmation of strain ATCC 17956 as an M. lacunata strain. This work was supported by Public Health Service grant 2-ROlEY07125 from the National Eye Institute.
J. BACTERIOL. REFERENCES 1. Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. 7:1513-1523. 2. Bovre, K., and N. Hagen. 1981. The family Neisseriaceae: rod-shaped species of the genera Moraxella, Acinetobacter, Kingella, and Neisseria, and the Branhamella group of cocci, p. 1506-1529. In M. P. Starr, H. Stolp, H. G. Truper, A. Balows, and H. G. Schlegel (ed.), The prokaryotes: a handbook on habitats, isolation, and identification of bacteria. Springer-Verlag, New York. 3. Cooperman, E. W., and A. H. Friedman. 1975. Exogenous Moraxella liquefaciens endophthalmitis. Ophthalmologica 171: 177-180. 4. Dalrymple, B., and J. S. Mattick. 1987. An analysis of the organization and evolution of type 4 fimbrial (MePhe) subunit proteins. J. Mol. Evol. 25:261-269. 5. Fulks, K. A., C. F. Marrs, S. P. Stevens, and M. R. Green. 1990. Sequence analysis of the inversion region containing the pilin genes of Moraxella bovis. J. Bacteriol. 172:310-316. 6. Glasgow, A. C., K. T. Hughes, and M. I. Simon. 1989. Bacterial DNA inversion systems, p. 637-659. In D. E. Berg and M. M. Howe (ed.), Mobile DNA. American Society for Microbiology, Washington, D.C. 7. Hubner, P., and W. Arber. 1989. Mutational analysis of a prokaryotic recombinational enhancer element with two functions. EMBO J. 8:577-585. 8. Hughes, D, E., and G. W. Pugh. 1970. A five-year study of infectious bovine keratoconjunctivitis in a beef herd. J. Am. Vet. Med. Assoc. 157:443-451. 9. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685. 10. Marrs, C. F., K. A. Fulks, M. Hackel, F. W. Rozsa, W. W. Ruehl, S. P. Stevens, and S. W. Weir. 1990. Studies on bacterial type 4 pili in the family Neisseriaceae, p. 69-75. In 0. Olsvik and G. Bukholm (ed.), Application of molecular biology in diagnosis of infectious diseases. Norwegian College of Veterinary Medicine, Oslo. 11. Marrs, C. F., M. Hackel, F. W. Rozsa, and S. P. Stevens. Unpublished data. 12. Marrs, C. F., F. W. Rozsa, M. Hackel, S. P. Stevens, and A. C. Glasgow. 1990. Identification, cloning and sequencing of piv, a new gene involved in inverting the pilin genes of Moraxella lacunata. J. Bacteriol. 172:4370-4377. 13. Marrs, C. F., W. W. Ruehl, G. K. Schoolnik, and S. Falkow. 1988. Pilin gene phase variation of Moraxella bovis is caused by an inversion of the pilin genes. J. Bacteriol. 170:3032-3039. 14. Marrs, C. F., G. Schoolnik, J. M. Koomey, J. Hardy, J. Rothbard, and S. Falkow. 1985. Cloning and sequencing of a Moraxella bovis pilin gene. J. Bacteriol. 163:132-139. 15. Prentki, P., and H. M. Krisch. 1984. In vitro insertional mutagenesis with a selectable DNA fragment. Gene 29:303-313. 16. Ringvold, A., E. Vik, and L. S. Bevanger. 1985. Moraxella lacunata isolated from epidemic conjunctivitis among teen-aged females. Acta Ophthalmol. 63:427-431. 17. Ruehl, W. W., C. F. Marrs, R. Fernandez, S. Falkow, and G. K. Schoolnik. 1988. Purification, characterization, and pathogenicity of Moraxella bovis pili. J. Exp. Med. 168:983-1002. 18. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 19. Silberfarb, P. M., and J. E. Lawe. 1968. Endocarditis due to Moraxella liquefaciens. Arch. Intern. Med. 122:512-513. 20. Tonjum, T., G. Bukholm, and K. Bovre. 1989. Differentiation of some species of Neisseriaceae and other bacterial groups by DNA-DNA hybridization. APMIS 97:395-405. 21. Towbin, H., T. Staehlin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354.
