Journal of Neuroscience Research 32: 149-158 (1992)

Interaction of Multiple Nuclear Proteins With the Promoter Region of the Mouse 68-kDa Neurofilament Gene T.R. Ivanov and I.R. Brown Department of Zoology, Scarborough Campus, University of Toronto, West Hill, Ontario, Canada

Four brain-specific, DNase I hypersensitive sites (HSS) have been mapped to the 5’ flanking region of the mouse 68-kDa neurofilament gene. These sites are contained within a 1.7-kb sequence that confers neuronal specificity of expression of this gene in transgenic mice. To identify DNA sequences that might be involved in gene regulation, the HSS situated near the promoter region has been analyzed by gel mobility shift assays and DNase I footprinting to investigate protein binding sequences. Of particular interest are two footprints localized to a 9-nucleotide sequence that flanks both the light and medium neurofilament gene in mouse and to a sequence that demonstrates partial homology to several promoter regions, including element-1, a motif required for neuron specificity in Drosophila. A prominent footprint was also detected at a sequence that contains a near-perfect palindrome centered at a PstI restriction site. 0 1992 Wiley-Liss, Inc.

Key words: cytoskeleton, gene expression, neuron, transcription

INTRODUCTION In eukaryotes, DNA is complexed with histones to form repeating chromatin units termed nucleosomes (for review, see Reeves, 1984; Eissenberg et al., 1985; Yaniv and Cereghini, 1986; Felsenfeld et al., 1987). Analysis of chromatin structure with DNase I, an enzyme that recognizes and preferentially cleaves chromatin, which is in an “open” or decondensed conformation (Weintraub and Groudine, 1976), has revealed the presence of chromatin regions that are sensitive to low concentrations of DNase I (i.e., DNase I hypersensitive sites or HSS). Hypersensitive sites have been detected primarily within the 5’ flanking region of active genes in a variety of cell types and have been implicated in tissue specificity and the developmental regulation of gene expression (for recent reviews, see Elgin, 1988; Svaren and Chalk0 1992 Wiley-Liss, Inc.

ley, 1990). Structurally, HSS correspond to discontinuities or gaps in the nucleosome repeat unit and typically characterize sequences that must be accessible in chromatin in order to function (for example, promoter and enhancer sequences). The absence of nucleosomes at a promoter region is of particular importance since in vitro reconstitution experiments have shown that promoters can be inactivated when incorporated into nucleosome structures (Lorch et al., 1987; Losa and Brown, 1987). Previously, DNase I has been used to investigate chromatin structure in rat cortical neurons (Ivanov and Brown, 1989). These experiments identified the presence of brain-specific HSS associated with two neuronspecific genes: the 68-kDa neurofilament gene and the neuron-specific enolase gene. The 68-kDa neurofilament gene (NF-L) codes for a polypeptide that is one of the major proteins detected in intermediate filament (IF)-enriched fractions derived from nervous tissue (Hoffman and Lasek, 1975; Liem et al., 1978). NF-L co-assembles with the 150-kDa (NF-M) and the 200-kDa (NF-H) neurofilament polypeptides to form 10-nm filaments that are detected principally, but not exclusively, in axons in which they contribute to cytoskeletal architecture (Morris and Lasek, 1982; Lasek et a]., 1983; Drake and Lasek, 1984). In the present investigation, we report the presence of four brain-specific DNase I HSS flanking the mouse 68-kDa neurofilament gene, one of which maps near the promoter region. Gel mobility shift assays and DNase I protection footprinting experiments reveal a complex pattern of protein-DNA interactions at this site.

Received November 27, 1991; revised January 13, 1992; accepted January 17, 1992. Address reprint requests to Dr. Ian R. Brown, Department of Zoology, Scarborough Campus, University of Toronto, 1265 Military Trail, West Hill, Ontario, Canada MIC 1A4.

150

Ivanov and Brown

MATERIALS AND METHODS Localization of DNase I Hypersensitive Sites Nuclei were isoiated from 10-day CD-1 mouse brain and liver by centrifugation through dense sucrose and digested with increasing concentrations of DNase I as previously described (Ivanov and Brown, 1989). DNase I HSS were mapped by indirect-end labeling (Wu, 1980). Briefly, DNA purified from DNase I-digested nuclei was cut with HindII, size-fractionated by agarose gel electrophoresis, and transferred to a nylon membrane (Biotrans-ICN Biomedicals). Blots were probed with a 779-bp KpnI-Hind11 fragment contained within a mouse 68-kDa neurofilament genomic clone (kindly provided by N.J. Cowan) (Lewis and Cowan, 1986). DNA was labeled using random oligonucleotides as primers (Feinburg and Vogelstein, 1983). Hybridization, wash conditions and autoradiography were as previously described (Ivanov and Brown, 1989). Preparation of Nuclear Extracts For gel mobility shift assays and DNase I protection footprinting experiments, nuclei were purified from 10-day CD-1 mouse brain and liver as described by Gorski et al. (1986) with minor modifications. Tissue was homogenized in 1.8 M sucrose containing 10 mM HEPES pH 7.6, 25 mM KC1, 0.15 mM spermine, 0.5 mM spermidine, 1 mM EDTA, and 10% glycerol and spun at 32,000 rpm (200,OOOg) for 35 min in SW4OL rotors. Nuclear extracts were prepared as previously described (Gorski et al., 1986) and stored at -70°C. Protein concentrations were determined as described by Bradford (1976) (Bio-Rad protein assay). Gel Mobility Shift Assays For protein-DNA binding assays, an NF-L 228-bp NheI-AvaI DNA fragment (Fig. 2, probe 1) was end labeled with C X - ~ ~ P - ~(spec. C T P act. 800 Ci/mmol) and Klenow fragment. Binding reactions contained 25 mM HEPES pH 7.6, 60 mM KCl, 10% glycerol, 1 mM EDTA, 1 mM dithiothreitol, 5 mM MgCl,, 1 pg poly (dI.dC) and varying amounts of either brain or liver nuclear extract in a final volume of 20 p1. The optimal amount of poly (dI.dC) required for the binding assays (to remove nonspecific protein-DNA interactions) was determined by incubating a labeled 231-bp pBR322 fragment with increasing amounts of poly (dI.dC). Nuclear extracts were incubated on ice with poly(dI.dC) for 30 min prior to the addition of the labeled NF-L DNA. Probe was added to the reaction mix (approximately 5,000-9,000 cpm) and incubated for an additional 30 min. For competition assays, cold 228-bp NF-L fragment or a 231-bp fragment from pBR322 was added to the binding reaction 30 min prior to the addition of the

labeled probe. Protein-DNA complexes were separated from free DNA by gel electrophoresis through 4% acrylamide (acrylamideibisacrylamide ratio: 30: l), 0.5 X TBE gels. Gels were soaked in 7% glycerol for 20 min, dried, and set up for autoradiography.

DNase I Protection Footprinting Two DNA fragments were used for the footprinting experiments. The first NF-L fragment, 228 bp in length, is identical to the sequence used for the mobility shift assays. The second NF-L probe, a 232-bp NruI-Pstl fragment (Fig. 2, probe 2), overlaps the first sequence but contains additional upstream sequences. The 228 bp fragment was labeled at either the 3‘ end of the coding strand (AvaI site) or the 5’ end of the noncoding strand (NheI site). The second probe contains approximately 25 bp of the sequencing vector, pBluescript (KS) (Stratagene) and was labeled at the vector’s XbaI restriction site. End-labeled DNA fragments (5,000 cpdbinding reaction) were incubated with nuclear extracts as described, except that the volume was increased to 100 p1 and the amount of nuclear extract and poly dI.dC was increased. Limited DNase I digests were performed by the addition of 3 p1 of digestion buffer containing 75 mM EDTA, 250 mM CaCl,, and DNase I at a concentration of 12.5 pg/ml. Digests were performed on ice for 2, 5, or 10 min and terminated by the addition of 50 p1 of stop buffer containing 160 mM Tris pH 8.0, 160 mM EDTA, 4% SDS, 40 pg/ml yeast tRNA, and 0.8 mg/ml proteinase K. Samples were incubated at 45°C for 3-4 hr, extracted sequentially with phenol, phenolichloroform: IAA, and chloroform:IAA, precipitated with 2.5 vol of ethanol and analyzed by electrophoresis through 8% acrylamide (19:1), 8 M urea sequencing gels. A + G ladders were generated by Maxam and Gilbert (1980) sequencing of labeled probes. Alternatively, end-labeled MspI cut pBR322 fragments were used as size markers. RESULTS Localization of DNase I Hypersensitive Sites in the Mouse 68-kDa Neurofilament Gene Previous experiments using DNase I and a 68-kDa neurofilament cDNA probe revealed the presence of DNase I hypersensitive sites (HSS) associated with the neurofilament gene in brain nuclei (Ivanov and Brown, 1989). Since HSS frequently correspond to DNA regulatory regions (Elgin, 1988; Svaren and Chalkley, 1990), neurofilament gene HSS were mapped in 10-day CD-1 mice by indirect end-labeling (Wu, 1980). DNA purified from DNase I-digested brain or liver nuclei was cut with HindIII, size fractionated, and transferred to a nylon

Mouse NF-L Promoter: Protein-DNA Interactions

151

A BRAIN

0

LIVER DNose I

10 25 35

0 10 25 35uglml

4.7kb41 3.9 -

3.62.9 -

-

-

C

a

Y

tt t

t

w.E

‘a

I Y

7 .-

I

probe

1 kb

Fig. 1. Mapping of brain-specific hypersensitive sites flanking the mouse 68-kDa neurofilament gene (NF-L). A: Autoradiogram of Southern blot demonstrating the presence of HSS flanking the mouse NF-L gene. Isolated brain and liver nuclei were digested with increasing concentrations of DNase I. Following treatment with proteinase K, purified DNA was cut with Hind11 and size-fractionated by gel electrophoresis. Fragments were transferred to a nylon membrane and probed with

an oligo-labeled neurofilament genomic probe (B). HSS were detected as subbands of the 4.7-kb Hind11 gene fragment and are approximately 2.9, 3.6, 3.9, and 4.1 kb in length. B: Partial restriction map of the mouse NF-L gene. Arrows indicate the locations of the HSS. The 779-bp KpnI-Hind11 fragment used for the mapping of HSS is indicated below the restriction map. Solid boxes represent exon regions.

membrane. DNA fragments were probed with a 779-bp KpnI-Hind11 mouse neurofilament genomic fragment. Four brain-specific HSS were identified flanking the mouse 68-kDa neurofilament (NF-L) gene. These sites are detected as subbands of the 4.7-kb Hind11 gene fragment, 2.9, 3.6, 3.9, and 4.1 kb in length (Fig. 1A), schematically shown in Figure 1B. The 2.9-kb band corresponds to the presence of a HSS located near the promoter region of the NF-L gene. This region contains a polypyrimidine tract (55 out of 63 nucleotides are either C or T) and several regulatory elements, for example, a TATA box and an Spl consensus sequence. Three addi-

tional HSS are located farther upstream from the promoter region.

Detection of Protein-DNA Complexes by Gel Mobility Shift Assays To determine whether the DNase I HSS located near the promoter region of the NF-L gene contains protein-binding sites, gel mobility shift assays were performed with a labeled 228-bp NheI-AvaI DNA fragment (NF-L probe 1 shown in Fig. 2). Probe 1 was incubated with increasing amounts of either brain or liver nuclear extract. The binding reaction was then electrophoresed

152

Ivanov and Brown

nuclear extract and digested with DNase 1 for the indicated lengths of time. Following treatment with proteinase K, samples were analyzed by gel electrophoresis through a 8 M urea sequencing gel. Footprints were deI tected as gaps in the nucleotide ladder and represent regions protected from DNase I digestion. probe 1 The protected regions shown in Figure 4A correprobe 2 spond to transcriptional regulatory sequences, including an Spl consensus sequence (- 17 to +3), a TATA box -50 bp (TATAAATA) and the 5-bp cAMP responsive element Fig. 2. Identification of the probes used for the analysis of (CRE) core sequence (CGTCA) (Comb et al., 1986; protein-DNA interactions at the promoter region of the mouse Montminy et al., 1986; Angel et al., 1987). The latter 68-kDa NF-L gene. Partial restriction map of the NF-L pro- two sequences are contained within a single footprint moter is shown. The relative positions of the TATA box and located -54 to - 19 relative to the transcription start site. the transcription start site are indicated (Monteiro and CleveWhen experiments were performed using a probe land, 1989). Probe 1 corresponds to an NF-L 228 bp NheI- labeled at the opposite end, two footprints were detected AvaI DNA fragment. Probe 2 corresponds to a 232-bp NruI- upstream from the cAMP responsive element (Fig. 4B). PstI DNA fragment. The first protected region, -87 to -59, contains a 9-bp sequence (CTGCCCCCT), designated NF-L/M, which is common to both the light and medium mouse neurofilathrough low-ionic-strength polyacrylamide gels to sepa- ment gene (Levy et al., 1987). This sequence partially rate free probe from protein-DNA complexes. overlaps the second part of the putative SNN consensus The incubation of brain nuclear extract with NF-L (CGCGCTGCC) that flanks the rat and human synapsin probe 1 resulted in the detection of 6 bands of reduced gene and the human NGF receptor gene (Sauenvald et electrophoretic mobility (Fig. 3A, left panel). Bands a al., 1990). This footprint also contains a downstream and b are the most prominent and appear as a distinct AP-2-like sequence (GGCCTGGC) . The second footdoublet, while bands d to g are more diffuse. Shifted print, - 111 to -93, contains a near perfect palindrome bands were not detected when proteinase K was included centered at a PstI restriction site (TTGGCTG/ in the binding reaction (data not shown). The tissue spec- CAGCAA). The 5' end of this footprint was determined ificity of the binding factors was investigated by per- by electrophoresing samples through thicker (1.5-mm) forming identical assays with liver nuclear extract (Fig. sequencing gels for shorter periods of time (data not 3A, right panel). While bands b and f' appear to be brain shown). Although a computer search has not revealed specific and are not detected with liver nuclear extract, any significant homologies to previously identified regthree bands, a, d, and g, were also observed with liver ulatory elements, this sequence is noteworthy because nuclear extract. Band c corresponds to a protein-DNA dyad symmetries frequently are the targets of nuclear complex which is unique to liver. binding proteins (Angel et al., 1987; Deutch et al., 1988; To determine whether the protein-DNA complexes Norman et al., 1988; Nakamura et al., 1990). The 3' end represent the interactions of nuclear proteins with spe- of this footprint is bounded by two nucleotides (indicated cific DNA sequences contained within NF-L probe 1, by arrows in Fig. 4B) that, in the presence of brain competition assays were performed (Fig. 3B,C). The in- nuclear extract, demonstrate an increased sensitivity to cubation of cold 228-bp NF-L fragment with brain or DNase I. Footprints were not detected when cold NF-L liver nuclear extract, prior to the addition of labeled probe 1 was added to the binding reaction prior to the probe 1, resulted in a significant decrease in the intensity addition of labeled probe 1 (data not shown). of the shifted bands (Fig. 3B). A decrease in intensity To investigate the tissue specificity of the DNA was not observed, however, with a 231-bp fragment binding proteins, DNase I protection footprinting experfrom pBR322 (Fig. 3C). The detected complexes there- iments were performed with liver nuclear extract. As fore appear to represent the interactions of nuclear pro- shown in Figure 5 , a footprint, -51 to -37, was deteins with specific sequences contained within probe 1. tected encompassing the CAMP-responsive element (CRE). Weak footprints were observed for regions conDNase I Footprinting Analysis of Brain Nuclear taining the TATA box, the 9-bp NF-L/M motif common Proteins Binding to NF-L Probe 1 to the mouse NF-L and NF-M genes and the AP-2-like To further analyze protein-DNA interactions, sequence. Footprints were also observed at -87 to -83, DNase I footprinting experiments were performed. NF-L and - I 1 1 to -93 and correspond to the SNN consensus probe 1 was incubated with increasing amounts of brain sequence and the PstI palindrome, respectively. Nucle-400

-300

I

-290

-100

Mouse NF-L Promoter: Protein-DNA Interactions

A

B

153

C

Fig. 3. Detection of protein-DNA complexes with NF-L probe 1 by gel mobility shift assays. A: NF-L probe 1 described in Figure 2 (approximately 9,000 cpm) was incubated with increasing amounts of either brain nuclear extract (0-12 p g protein) or liver nuclear extract (0-9.6 pg protein) in the presence of 1 pg poly (dI.dC). Protein-DNA complexes were separated from free probe by gel electrophoresis. Gels were

dried and set up for autoradiography. Protein-DNA complexes are indicated by arrows (a-g). B, C: For competition assays, excess amounts (indicated by the numbers above the gel lanes) of cold NF-L probe 1 (B) or pBR322 (C) were incubated with nuclear extract (8 pg'protein) 30 min prior to the addition of the labeled probe.

otides hypersensitive to DNase I, located between these two footprints in experiments with brain nuclear extracts (Fig. 4B), were not as prominent in experiments with liver nuclear extracts (Fig. 5B).

several Drosophila genes, including ultrabithorax (Biggin and Tjian, 1988), fushi turazu (Hiromi et al., 1985), dopa decarboxylase (Scholnick et al., 1986) and engrailed (Soeller et al., 1988). This sequence, designated element-1 (Scholnick et al., 1986) is required for the transcription of the aforementioned genes in neuronal cell populations (Hiromi et al., 1985; Biggin and Tjian, 1988; Bray et al., 1989). Other sequences that show similarities to element-1 include the long terminal repeat of hamster intracisternal A particle (88% homology) (On0 and Ohishi, 1983) and the promoter of the Drosophila hsp26 gene (81% homology) (Holmgren et al., 1981; Ingolia and Craig, 1981). The 3' end is also similar to a transcription factor binding site within the adenovirus E2 promoter (Kovesdi et al., 1986; Nakahira et al., 1990). A less prominent footprint is detected when probe 2 was incubated with liver nuclear extracts (Fig. 6B).

Detection of a Protein-DNA Complex Upstream from the PstI Palindrome Footprinting experiments with NF-L probe 1 did not permit an analysis of sequences near the NheI restriction site. To overcome this, a second NF-L probe was used (probe 2 shown in Fig. 2). Probe 2 , a 232-bp NruIPstI fragment, partially overlaps probe 1 but contains additional upstream sequences. The incubation of NF-L probe 2 with brain nuclear extract resulted in the protection of a region located - 135 to at least - 1 18 relative to the transcription start site (Fig. 6A). The precise 3' border of this footprint was difficult to determine, possibly as the result of the infrequency of DNase I cutting at this sequence. The protected region contains several overlapping transcriptional regulatory sequences, including Spl (CCCCGCC), AP-2 DISCUSSION Previously, we have used the enzyme DNase I to (TCGCCCCCGC) (Nakahira et al., 1990), and a 16-bp sequence that shows 70% homology to regions flanking investigate chromatin structure in rat cortical neurons

154

A

Ivanov and Brown

B

Fig. 4. DNase I footprint analysis of NF-L probe 1 with brain nuclear extract. Footprinting reactions were performed with NF-L probe 1 labeled at either the 3’ end of the coding strand (A) or the 5’ end of the noncoding strand (B). Probe 1 (5,000 cpm) was incubated with increasing amounts of brain nuclear extract (protein concentration 10 pg/pl) in the presence of 2 pg poly (dI.dC) in a volume of 100 pl. DNase I digests were performed for 2 min (0 and 1.7 p1 of nuclear extract added to binding reaction), 5 min (3.3 kl), or 10 min (6.7 and 10 11.1). Samples were treated with proteinase K, extracted, and analyzed on sequencing gels. Regions protected from DNase I cleavage are indicated by square brackets. Possible target DNA sequences for nuclear proteins within these regions are indicated by solid boxes. NF-WM corresponds to a 9-bp motif flanking the mouse NF-L and NF-M genes. PstI corresponds to the dyad symmetry centered at a Pstl restriction site. Arrows between -93 and -87 identify nucleotides that are hypersensitive to DNase I in the presence of brain nuclear extract.

(Ivanov and Brown, 1989). These studies suggested that both transcribed and nontranscribed genes are in a relatively decondensed chromatin conformation in cortical neurons. These experiments also identified brain-specific hypersensitive sites (HSS) associated with the neuronspecific enolase gene and the 68-kDa neurofilament gene (NF-L). Experiments described in this paper identify four brain-specific HSS flanking the 5’ region of the mouse NF-L gene. A DNA region that encompasses the first HSS has been analyzed by gel mobility shift assays and DNase I protection footprinting. Regions protected from DNase I digestion following the incubation of probes with brain nuclear extracts are shown in Figure 7 and correspond to (1) previously described regulatory ele-

A

B

Fig. 5. DNase I footprinting analysis of NF-L probe 1 with liver nuclear extract. The tissue specificity of the protected regions was investigated by performing footprinting reactions with liver nuclear extract. Experiments were performed with NF-L probe 1 labeled at the 5’ end of the noncoding strand. The protein concentration of the liver nuclear extracts and the duration of the DNase 1 digest were as indicated in Figure 4. Footprints are indicated by square brackets. Sequences that are weakly protected from DNase I digestion are indicated by lines and include the TATA box, the AP-2-like sequence, and the NF-L/M motif. The nucleotides that were hypersensitive to DNase I in the presence of brain nuclear extract are indicated by arrows.

ments, (2) sequences shared between the NF-L gene and genes encoding other neurofilament polypeptides, ( 3 ) sequences shared between NF-L and other genes expressed in neuronal cell populations, and (4)a novel palindrome sequence centered at a PstI restriction site. Footprints were detected over regions containing a TATA box, Spl consensus sequences, a 5-bp CRE core sequence (CGTCA), and two AP-2-like sequences. One of the AP-2-like sequences is located 20 bp upstream from the 5-bp CRE core sequence. This spatial arrangement has previously been reported for other brain CAMPresponsive genes, including the human proenkephalin gene (Hyman et al., 1989) and the human p-SlOO gene (Allore et al., 1990). Comparisons of the 5‘ flanking regions of neurofilament genes and other neuron-specific genes have revealed small regions of sequence homology. As previ-

Mouse NF-L Promoter: Protein-DNA Interactions

155

et al., 1981; Ingolia and Craig, 1981) and the LTR of hamster intracisternal A particle (On0 and Ohishi, 1983). The most intriguing homology however is to Drosophila element- 1, a sequence required for the expression of the dopa decarboxylase (Ddc) gene in the Drosophilu central nervous system (CNS) (Scholnick et al., 1986). Element- 1 sequences have been identified flanking other Drosophifu genes that are transcribed in neuronal cell populations, includingfushi turuzu (Hiromi et al., 1985), ultrabithorax (Biggin and Tjian, 1988), and engruiled (Soeller et al., 1988). Two Drosophifu proteins that bind element- 1 (Elf- 1 and NTF- 1) have recently been cloned and are transcribed during embryogenesis in a restricted population of neurons and within the epidermis (Bray et al., 1989; Dynlacht et al., 1989). The homology of Drosophila element-I to the promoter region of genes expressed in a number of cell types, for example, the hsp26 gene (Ireland et al., 1982; Sirotkin and Davidson, 1983; Zimmerman et al., 1983), however, suggests that other mechanisms must be involved in the neuron specificity of these Drosophila genes. While we have mapped DNase I HSS to identify Fig. 6. Footprinting analysis of NF-L probe 2 with brain and regions that may be involved in the regulation of the liver nuclear extracts. Footprinting reactions were performed mouse 68-kDa neurofilament gene, other investigators as described for Figure 4 using NF-L probe 2 labeled at the XbaI site located in the vector pBluescript (KS). Probe 2 was have performed functional analyses (i.e., the generation incubated with either brain (A) or liver (B) nuclear extracts. of transgenic mice and transfection assays). Monteiro Protein concentrations and the duration of the DNase I digests and Cleveland (1989) have reported the transcription of a were as indicated in Figure 4. Protected regions are indicated transfected DNA sequence (pNF-L[Bam]) containing the mouse NF-L gene (including 1.7 kb of flanking seby square brackets. quence) in fibroblasts suggesting that non-neuronal cell types contain the nuclear factors required for the tranously indicated, the mouse NF-L and NF-M gene both scription of the endogenous NF-L gene. The absence of contain an identical 9-bp motif (CTGCCCCCT) located transcription of the endogenous gene in non-neuronal 50 and 90 bp, respectively, upstream from the TATA cell types may reflect the inaccessibility of these factors box (Levy et al., 1987). Incubation of brain nuclear ex- to their target DNA sequence. Similar results have been tracts with NF-L probe 1 resulted in the protection of a reported by Nakahira et a1. (1990), by Julien et al. (1987) region containing this motif. This footprint also contains following the transfection of mouse fibroblasts with the an AP-2-like sequence and the second part of the putative human NF-L gene, and by Zopf et al. (1990), who have SNN consensus sequence (Sauenvald et a]., 1990). This described the expression of the chicken NF-M gene in consensus has been detected flanking the rat and human transfected fibroblasts. synapsin gene (Sauerwald et al., 1990) and the human Monteiro et al. (1990) have also generated transNGF receptor gene (Sehgal et al., 1988). For the rat genic mice containing the mouse NF-L gene (pNFsynapsin gene, the SNN consensus sequence is contained L[Bam]). Transgene RNA was detected in the brains of within a region critical for cell-specific transcription in a such mice suggesting that elements contained within transfected mouse neuroblastoma cell line (Sauenvald et pNF-L(Bam) specify neuronal expression. A similar patal., 1990). tern of neuron-specific expression has been observed by The footprint detected following the incubation of Byrne and Ruddle (1989) using a 1.5-kb HindII-SmaI brain nuclear extract with NF-L probe 2 contains several fragment of the mouse NF-L promoter (Lewis and interesting sequences, including an Spl consensus, an Cowan, 1986) in a two-tiered multiplex regulatory netAP-2-like binding site, and an E2F binding site. The E2F work. Since transfection experiments suggest that the motif (underlined sequence) is contained within a larger mouse NF-L promoter can function in various cell lines, 16-nucleotide region (GCCTTTGCTTTTGCGC) that mechanisms may exist to repress NF-L gene transcripdemonstrates partial homology to several promoter re- tion in non-neuronal cells (Nakahira et al., 1990). gions, including the Drosophilu hsp26 gene (Holmgren A repressor or silencer mechanism has previously

A

B

156

ivanov and Brown -241

GAATAAGCAGGGAAGTTATGGGGGTCTCAGAGAAAGTAGGGGTCCTCATAG~AAGCGGCCA

m

-1 79

APb2 E2F GGCTGGAGCCGCAGCTCGCTAGCCTCCTGTCGTTCGCCCCCGCCTTTGCTTTTGCGCAG~T element-1 SPl

’

--

-107

I + + 1

S” I CCTCCCCTTGGCTGCAGCAACGCGCTGCCCCCTACTGGCCTGGCCACGGCGAGTCGATCACAG Pst I palindrome NF-L/M AP -2

-4 6

TCTGCGTCAGAGTCCCGGCGTATAAATAGAGGTGGCAGGACCCGCCGAGCCGCACACAGCC CRE TATA Spl 4

Fig. 7. Representation of DNase I footprints on the 68-kDa neurofilament promoter region. The interaction of the mouse NF-L promoter region with brain nuclear extracts has been mapped out. Regions protected from DNase I digestion in the presence of brain nuclear extracts are indicated by square

brackets above the sequence. Possible target DNA sequences for nuclear proteins are identified by lines above and below the sequence. Nucleotides that were sensitive to DNase I in the presence of brain nuclear extracts (small vertical arrows) and the transcription start site are indicated.

been proposed for the gene encoding rat SCG10, a membrane-bound protein that accumulates in growth cones and perinuclear regions during development and regeneration (Anderson and Axel, 1985). The transcription of the SCGlO gene in expressing cells is associated with the presence of two DNase I HSS flanking the gene (Vandenberg et al., 1989). In liver, which does not express SCG10, the gene is in a “closed” DNase I insensitive chromatin conformation. Transient transfection assays and transgenic experiments suggest that a silencer element is contained within the distal promoter of the SCGlO gene (Mori et al., 1990; Wuenschell et al., 1990). This silencer element appears to repress the formation of HSS in non-neuronal tissue but permits the assembly of HSS in neuronal tissue. Negative regulatory regions have been identified for other brain genes, including the rat type I1 sodium channel gene (Maue et al., 1989) and the mouse NCAM gene (Hirsch et al., 1990). The results in the present communication suggest that modifications to brain chromatin structure (i.e., the establishment of chromatin DNase I hypersensitive sites) play an important role in the tissue specificity of mouse NF-L gene expression. Four brain-specific HSS are contained within the 1.7 kb of flanking sequence required for the neuron specificity of the NF-L gene in transgenic mice (Byrne and Ruddle, 1989; Monteiro et al., 1990). Analysis of the protein-DNA interactions corresponding to the HSS located near the NF-L promoter has revealed a complex pattern of protein-DNA interactions for both

brain and liver nuclear extracts by gel mobility shift assays and protection footprinting. Minor differences were detected between tissue types, for example, the absence of a protected region encompassing NF-L/M upon incubation of NF-L probe 1 with liver extract. The apparent absence of major brain-specific protein-DNA interactions, however, is in agreement with transfection experiments that describe the expression of neurofilament genes in non-neuronal cell types (Julien et al., 1987; Monteiro and Cleveland, 1989; Nakahira et al., 1990; Zopf et al., 1990). The absence of NF-L gene transcription in non-neuronal cells may therefore be due to chromosomal restraints imposed upon the gene in nonbrain tissues and not to the absence of required transcription factors. Alternatively, the tissue specificity of NF-L expression may reside in upstream HSS regions that are currently under investigation.

ACKNOWLEDGMENTS We thank Dr. N.J. Cowan for generously providing the mouse genomic NF-L clone, pLR. This research was supported by grants from NSERC Canada to I.R.B.

REFERENCES Allore RJ, Friend WC, O’Hanlon DO, Neilson KM, Baumal R, Dunn RJ, Marks A (1990): Cloning and expression of the human p-SlOO gene. J Biol Chem 265:15537-15543.

Mouse NF-L Promoter: Protein-DNA hteractions Anderson DJ, Axel R (1985): Molecular probes for the development and plasticity of neural crest derivatives. Cell 42:649-662. Angel P, Imagawa M, Chiu R, Stein B, Imbra RJ, Rahmsdorf HJ, Jonat C, Herrlich P, Karin M (1987): Phorbol ester-inducible genes contain a common cis element recognized by a TPAmodulated transacting factor. Cell 49:729-739. Biggin MD, Tjian R (1988): Transcription factors that activate the ultrabithorax promoter in developmentally staged extracts. Cell 531699-71 1. Bradford MM ( I 976): A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248-254. Bray SJ, Burke B, Brown NH, Hirsh J (1989): Embryonic expression pattern of a family of Drosophila proteins that interact with a central nervous system regulatory element. Genes Dev 3: 11301145. Byrne GW, Ruddle FH (1989): Multiplex gene regulation: A twotiered approach to transgene regulation in transgenic mice. Proc Natl Acad Sci USA 865473-5477. Comb M, Birnberg NC, Seasholtz A, Herbert E, Goodman HM (1986): A cyclic AMP- and phorbol ester-inducible element. Nature 323:353-356. Deutch PJ, Hoeffler JP, Jameson JL, Habener JF (1988): Cyclic AMP and phorbol ester-stimulated transcription mediated by similar DNA elements that bind distinct proteins. Proc Natl Acad Sci USA 85:7922-7926. Drake PF, Lasek RJ (1984): Regional differences in neuronal cytoskeleton. J Neurosci 5: 1173-1 186. Dynlacht BD, Attardi LD, Admon A, Freeman M, Tjian R (1989): Functional analysis of NTF- I , a developmentally regulated Drosophila transcription factor that binds neuronal cis elements. Genes Dev 3:1677-1688. Eissenberg JC, Cartwright IL, Thomas GH, Elgin SCR (1985): Selected topics in chromatin structure. Annu Rev Genet 19:485536. Elgin SCR (1988): The formation and function of DNase I hypersensitive sites in the process of gene activation. J Cell Biol 263: 19259-1 9262. Feinberg AP, Vogelstein B (1983): A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132:6-13. Felsenfeld G , Emerson BM, Jackson PD, Lewis CD, Hesse JE, Lieber MR, Nickol JM (1987): Chromatin structure near an expressed gene. In Poste G, Cooke ST (eds): “New Frontiers in the Study of Gene Functions.” New York: Plenum, pp 99-109. Gorski K, Carneiro M, Schibler U (1986): Tissue-specific in vitro transcription from the mouse albumin promoter. Cell 47:767776. Hiromi Y, Kuroiwa A, Gehring WJ (1985): Control elements of the Drosophila segmentation gene fushi furuzu. Cell 43:603613. Hirsch MR, Gaugler L, Deagostini-Bazin H, Bally-Cuif L, Goridis C (1990): Identification of positive and negative regulatory elements governing cell-type-specific expression of the neural cell adhesion molecule gene. Mol Cell Biol 10:1959-1968. Hoffman PN, Lasek RJ (1975): The slow component of axonal transport. Identification of major structural polypeptides of the axon and their generality among mammalian neurons. J Cell Biol 66~351-366. Holmgren R, Corces V, Morimoto R, Blackman R, Meselson M (1981): Sequence homologies in the 5’ region of four Drosophilu heat shock genes. Proc Natl Acad Sci USA 78:37753778. Hyman SE, Comb M, Pearlberg J , Goodman HM (1989): An AP-2

157

element acts synergistically with the cyclic AMP- and phorbol ester-inducible enhancer of the human proenkephalin gene. Mol Cell Biol 9:321-324. Ingolia TD, Craig EA (1981): Primary sequence of the 5’ flanking regions of the Drosophila heat shock genes in chromosome subdivision 67B. Nucleic Acids Res 7: 1627-1642. Ireland RC, Berger E, Sirotkin K, Yund MA, Osterbur D, Fristrorn J (1982): Ecdysterone induces the transcription of four heat shock genes in Drosophila S3 cells and imaginal discs. Dev Biol 93:498-507. Ivanov TR, Brown IR (1989): Genes expressed in cortical neuronschromatin conformation and DNase I hypersensitive sites. Neurochem Res 14:129-137. Julien JP, Grosveld F, Yazdanbaksh K, Flavell D, Meijer D, Mushynski W (1987): The structure of a human neurofilament gene (NF-L): A unique exon-intron organization in the intermediate filament gene family. Biochim Biophys Acta 909:lO20. Kovesdi I, Reichel R, Nevins JR (1986): Identification of a cellular transcription factor involved in EIA trans-activation. Cell 45: 2 1 9 -228. Lasek RJ, Oblinger MM, Drake PF (1983): Molecular biology of neuronal geometry: Expression of neurofilament genes influences axonal diameter. Cold Spring Harbor Symp Quant Biol 48: 73 1-74, Levy E, Liem RKH, D’Eustachio P, Cowan NJ (1987): Structure and evolutionary origin of the gene encoding mouse NF-M, the middle-molecular-mass neurofilament protein. Eur J Biochem 166171-77, Lewis SA, Cowan NJ (1986): Anomalous placement of introns in a member of the intermediate filament multigene family: an evolutionary conundrum. Mol Cell Biol 6: 1529-1534. Liem RKH, Yen SH, Salomon GD, Shelanski ML (1978): Intermediate filaments in nervous tissue. J Cell Biol 79:637-645. Lorch Y, LaPointe JW, Kornberg RD (1987): Nucleosomes inhibit the initiation of transcription but allow chain elongation with the displacement of histones. Cell 49:203-210. Losa R, Brown DD (1987): A bacteriophage RNA polymerase transcribes in vitro through a nucleosome core without displacing it. Cell 50:SOI-808. Maue RA, Kraner SD, Goodman RH, Mandel G (1990): Neuronspecific expression of the rat brain type I1 sodium channel gene is directed by upstream regulatory elements. Neuron 4:223231. Maxam AM, Gilbert W (1980): Sequencing end-labeled DNA with base-specific chemical cleavage. Methods Enzymol 65:499560. Monteiro MJ, Cleveland DW (1989): Expression of NF-L and NF-M in fibroblasts reveals co-assembly of neurofilament and vimentin subunits. J Cell Biol 108:579-593. Monteiro MJ, Hoffman PN, Gearhart JD, Cleveland DW (1990): Expression of NF-L in both neuronal and nonneuronal cells of transgenic mice: increased neurofilament density in axons without affecting caliber. J Cell Biol 111:1543-1557. Montminy MR, Sevarino KA, Wagner JA, Mandel G, Goodman RH (1986): Identification of a cyclic-AMP-responsive element within the rat somatostatin gene. Proc Natl Acad Sci USA 83:6682-6686. Mori N, Stein R, Sigmund 0, Anderson DJ (1990): A cell typepreferred silencer element that controls the neural-specific expression of the SCGlO gene. Neuron 4:583-594. Moms JR, Lasek RJ (1982): Stable polymers of the axonal cytoskeleton: The axoplasmic ghost. J Cell Biol 92:192-198. Nakahira K, Ikenaka K , Wada K, Tamura T, Furuichi T, Mikoshiba

158

Ivanov and Brown

K (1990):Structure of the 68-kDa neurofilament gene and regulation of its expression. J Biol Chem 265:19786-19791. Nakamura T, Donovan DM, Hamada K , Sax CM, Norman B, Flanagan JR, Ozato K, Westphalli, Piatigorsky J (1990):Regulation of the mouse aA-crystallin gene: Isolation of a cDNA encoding a protein that binds to a cis sequence motif shared with the major histocompatibility complex class gene and other genes. Mol Cell Biol 10:3700-3708. Norman C, Runswick M, Pollock R, Treisman R (1988): Isolation and properties of cDNA clones encoding SRF, a transcription factor that binds to the c-fos serum responsive element. Cell 55:9891003. Ono M, Ohishi H (1983):Long terminal repeat sequences of intracisternal A particle genes in the Syrian hamster genome: Identification of a tRNAPheas a putative primer tRNA. Nucleic Acids Res 1l:7169-7 179. Reeves R (1984):Transcriptionally active chromatin. Biochim Biophys Acta 782:343-393. Sauerwald A, Hoesche C , Oschwald R, Killimann MW (1990):The 5'-flanking region of the synapsin gene. J Biol Chem 265: 14932-14937. Scholnick SB, Bray SJ, Morgan BA, McCormick CA, Hirsh J (1986): CNS and hypoderm regulatory elements of the DrosophiEa melanoguster dopa decarboxylase gene. Science 234:998-1002. Sehgal A, Patil N, Chao M (1988): A constitutive promoter directs expression of the nerve growth factor receptor gene. Mol Cell Biol 8:3160-3 167. Sirotkin K, Davidson N (1982):Developmentally regulated transcrip-

tion from Drosophila melanogaster chromosomal site 67B. Dev Biol 89:196-210. Soeller WC, Poole SJ,Kornberg T (1988):In vitro transcription of the Drosophila engruiled gene. Genes Dev 2:68-81. Svaren J, Chalkley R (1990): The structure and assembly of active chromatin. Trends Genet 652-56. Vandenbergh DJ, Wuenschell CW, Mori N, Anderson DJ (1989): Chromatin structure as a molecular marker of cell lineage and developmental potential in neural crest-derived chromaffin cells. Neuron 3507-518. Weintraub H, Groudine M (1976):Chromosomal subunits in active genes have an altered conformation. Nature 193:848-856. Wu C (1980):The 5' ends of Drosophilu heat shock genes in chromatin are hypersensitive to DNase I. Nature 286:854-860. Wuenschell CW, Mori N, Anderson DJ (1990): Analysis of SCGlO gene expression in transgenic mice reveals that neural specificity is achieved through selective derepression. Neuron 4: 595-602. Yaniv M, Cereghini S (1986): Structure of transcriptionally active chromatin. CRC Crit Rev Biochem 21:l-26. Z i m e r m a n JL, Petri W, Meselson M (1983): Accumulation of a specific subset of D . melunogaster heat shock mRNAs in normal development without heat shock. Cell 32:1161-1170. Zopf D, Dineva B, Betz H, Gundelfinger ED (1990):Isolation of the chicken middle-molecular weight neurofilament (NF-M) gene and characterization of its promoter. Nucleic Acids Res 18: 521-529.