European Journal of Medicinal Chemistry 73 (2014) 126e134

Contents lists available at ScienceDirect

European Journal of Medicinal Chemistry journal homepage: http://www.elsevier.com/locate/ejmech

Original article

Insights on pregnane-X-receptor modulation. Natural and semisynthetic steroids from Theonella marine sponges Valentina Sepe a, *, Claudio D’Amore b, Raffella Ummarino a, Barbara Renga b, Maria Valeria D’Auria a, Ettore Novellino a, Annamaria Sinisi a, Orazio Taglialatela-Scafati a, Yoichi Nakao c, Vittorio Limongelli a, Angela Zampella a, Stefano Fiorucci b a b c

Dipartimento di Farmacia, Università di Napoli “Federico II”, 80131 Napoli, Italy Dipartimento di Medicina Clinica e Sperimentale, Università degli Studi di Perugia, 06132 Perugia, Italy Department of Chemistry and Biochemistry, Waseda University, 3-4-1 Okubo, Shinjuku-ku, Tokyo 169-8555, Japan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 2 August 2013 Received in revised form 28 November 2013 Accepted 2 December 2013 Available online 15 December 2013

Pregnane-X-receptor (PXR) is a member of nuclear receptors superfamily that activates gene transcription by binding to responsive elements in the promoter of target genes. PXR is a master gene orchestrating the expression/activity of genes involved in the metabolism of endobiotics including bilirubin, bile acids, glucose and lipid. In addition PXR oversights the metabolism of the large majority of xenobiotics including a large amount of prescribing drugs. Thus, developing PXR ligands represents a great opportunity for a therapeutic intervention on human diseases including diabetes, obesity, dyslipidemias and liver disorders. To this end, natural compounds represent an arsenal of new chemical scaffolds useful for the identification of novel PXR ligands. Here, we report a series of 4-methylenesteroid derivatives isolated from Theonella marine sponges as novel PXR modulators. In addition, combining medicinal chemistry, pharmacological experiments and computational studies, we have investigated the effects of different modifications on ring A and on the side chain of 4-methylenesteroid derivatives toward PXR modulation. This study provides the molecular bases of ligand/PXR interaction useful for designing novel PXR modulators. Ó 2013 Elsevier Masson SAS. All rights reserved.

Keywords: Theonella marine sponges 4-Methylenesteroids Conicasterol Pregnane-X-receptor Structureeactivity relationship Molecular docking

1. Introduction Pregnane-X-receptor (PXR) is a member of nuclear receptors (NRs) super-family. PXR orchestrates the complex and intricate network of xenobiotic metabolism. After ligand binding, PXR translocates to nucleus and binds to its promoter responsive elements as obligatory heterodimer with retinoid-X-receptor. PXR shares with other NRs several structural features such as a highly

Abbreviations: ABC transporters, ATP-binding cassette transporters; AF-2, activation function 2; COSY, correlation spectroscopy; CYPs, cytochrome P superfamily; DBD, DNA binding domain; FXR, farnesoid-X-receptor; GSTs, glutathione-S-transferases; HepG2, human hepatoma cell line; HMBC, hetero-multi bond correlation; HPLC, high performance liquid chromatography; HR ESIMS, high-resolution electrospray ionization mass spectrometry; HSQC, heteronuclear single-quantum coherence; LBD, ligand binding domain; MPLC, medium pressure liquid chromatography; NMR, nuclear magnetic resonance; NRs, nuclear receptors; PCC, pyridinium chlorochromate; PDB, Protein Data Bank; PXR, pregnane-X-receptor; RT PCR, real time polymerase chain reaction; SULTs, sulfotransferases; TLC, thin-layer chromatography; UGTs, UDP-glucuronyltransferases. * Corresponding author. Tel.: þ39 081 678526; fax: þ39 081 678552. E-mail address: [email protected] (V. Sepe). 0223-5234/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.ejmech.2013.12.005

conserved N-terminal DNA-binding domain (DBD), a less conserved ligand binding domain (LBD), and one transactivation domain, the activation function 2 (AF-2). The key difference with the other NRs lies in the unique conformational flexibility and the large volume of the LBD that is able to accommodate an extraordinary variety of exogenous compounds [1]. Consequently, in the liver and in the gastro-intestinal tract, PXR regulates the expression of genes for Phase I and II drug metabolizing enzymes, including CYPs, carboxylesterases, alcohol and aldehyde dehydrogenases, glucuronyltransferases (UGTs), sulfotransferases (SULTs) and glutathione transferases (GSTs) [2], and numerous efflux transporters [3] (ABC drug efflux transporters, breast cancer resistance protein, multidrug resistance-associated proteins and P-glyco protein). Apart from the afore mentioned pivotal role in regulating drug detoxification, PXR plays also a pleiotropic role in endobiotic metabolism. PXR regulates bile acids homeostasis [4,5], glucose and lipid metabolism [6,7], energy homeostasis, immune responses [8] and, notably, drugedrug interactions [9]. As a result, PXR ligands (agonists and antagonists) are recognized opportunity for the pharmacotherapy of several human diseases including diabetes,

V. Sepe et al. / European Journal of Medicinal Chemistry 73 (2014) 126e134

127

2. Results and discussion 2.1. Structural characterization

Fig. 1. Conicasterol and theonellasterol as biomarkers of Theonella conica and Theonella swinhoei, respectively.

obesity, dyslipidemia, liver disorders [10], immune mediate dysfunctions and cancer. Expectedly, in the last decades a considerable number of chemicals have been show to function as PXR ligands, including widely prescribed drugs such as statins, antibiotics, anticancer compounds as well as environmental toxicants, plasticizers and pesticides. In addition, several natural compounds isolated from herbal medicines and marine organisms have highlighted the potential of novel chemical scaffolds useful for the development of PXR ligands [6,11]. In this context and in the frame of our interest in the discovery of nuclear receptor modulators from marine sources [12e17], we have described several compounds isolated from marine sponges endowed with agonistic activity on PXR including solomonsterols, side chain truncated steroids [18], and the large family of 4-methylenesteroids from Theonella swinhoei [19e22]. Within these new chemotypes of PXR agonists, solomonsterol A was effective in reducing the development of clinical signs and symptoms of colitis in a PXR dependent mechanism [23] and therefore represents the first example of marine lead in the treatment of inflammatory bowel disease. The rare 4methylenesteroids represent the exclusive elements of the steroid biogenetic class in Theonella sponges with conicasterol (1) and theonellasterol (2) (Fig. 1) as ideal biomarkers of Theonella conica and T. swinhoei, respectively [24]. These molecules share substituents and unsaturations on the tetracyclic core but differ in the side chain with a 24S-ethyl group in theonellasterol and a 24R-methyl group in conicasterol. Recently we demonstrated that 4-methylenesteroids are endowed with peculiar pharmacological profiles, ranging from selective antagonism on FXR [25] of theonellasterol (2) to dual modulation on FXR/PXR [19e22] of others 4-methylenesteroids, thus affirming Theonella sponges genus as an invaluable source of nuclear receptor ligands [12]. In this paper we report the results of chemical analysis on the apolar extracts from a Solomon collection of T. swinhoei and from a T. conica specimen collected off Kakeroma Island, Kagoshima pref., leading to the isolation of three new side chain modified 4-methylenesteroids (Fig. 2), endowed with interesting activity on PXR. Moreover the isolation of large amount of the parent compound conicasterol (1), obtained from the Japanese collection of T. conica, allowed to speculate on the effect of punctual modifications on ring A and on the side chain toward PXR modulation and notably, to identify new chemotype of PXR modulators.

Preconicasterol (3) was isolated as an amorphous solid with molecular formula C28H44O by HR-ESIMS. This compound was easily identified as a member of the class of 4-methylenesteroids, however its molecular formula suggested that it should not contain any branching on the side chain. Analysis of 1D NMR data (Table 1), guided by inspection of COSY, HSQC and HMBC spectra, allowed the complete assignment of 1H and 13C NMR resonances. All the 1H/13C resonances of the tetracyclic core were practically identical to those of 1 and 2, while the side chain was demonstrated to include a D24 (dH 5.28) double bond, as indicated also by the downfield shift of Me-26 and Me-27 (dH 1.62 and 1.72, respectively). To our knowledge, compound 3 represents the first example of Theonella 4-methylenesteroids to lack any ramification in the side chain. On the basis of the current knowledge about the biogenesis of branched side chain sterols, preconicasterol (3) should be a likely biogenetic precursor of the branched derivatives 1 and 2 as shown in Fig. 3. As for compound 3, the structural elucidation of compounds 4 and 5 was also greatly helped by comparison of spectroscopic data with those of known analogs. Indeed, both 4 and 5 showed NMR signals of the tetracyclic core superimposable to those of already published derivatives [19e21,24]. In particular, 24-dehydroconicasterol D (4) shares the ring system and the two additional hydroxyl groups at C-9 and C-14 with conicasterol D [19], while 25-dehydrotheonellasterol (5) proved to possess the same ring system of compounds 1e3. COSY analysis of the 1H NMR spectrum of 24-dehydroconi casterol D (4) (Table 1), C29H46O3 by HR-ESIMS, indicated that its side chain should include an sp2 methylene, three methyl groups (all doublets at dH 0.99, 1.09 and 1.10), two sp3methines and two sp3 methylenes. The HMBC correlations of the sp2 methylene with C23, C-24 and C-25 indicated its attachment at C-24, thus defining the structure of compound 4 as a new sterol differing from conicasterol D by the presence of an additional double bond between C-24 and C-28. The 1H NMR spectrum of compound 5 (Table 1), C30H48O by HRESIMS, revealed that its side chain should include an ethyl group (dH 1.35, m and 0.90, t), an sp2 methylene (dH 4.83 and 4.89, br s), two sp3 methylenes, two sp3methines and two methyl groups (dH 1.02, d; 1.58, s). The COSY spectrum of 5 organized all the multiplets of the side chain within a single spin system starting from Me-21 and terminating with Me-29, further connected to ring D spin system through H-20. The HMBC cross-peaks of H2-26 with C-24, C-25 and C-27 completely defined the structure of compound 5 as 25dehydrotheonellasterol. On the basis of NMR data, the configuration at C-24 has been assumed the same as that of the biogenetically related theonellasterol and invariably found for 24-ethyl steroids from Theonella.

Fig. 2. New side chain modified 4-methylenesteroids from Theonella collections.

128

V. Sepe et al. / European Journal of Medicinal Chemistry 73 (2014) 126e134

Table 1 1 H and 13C NMR data (700 MHz, C6D6) for preconicasterol dehydroconicasterol D (4) and 25-dehydrotheonellasterol (5). Pos.

3

4

d Ha 1

dC b

3

1.05 1.54 1.32 1.83 3.81

ovl m ovl m m

73.5

4 5

e 1.64 ovl

153.8 49.7

6

1.39 m 1.86 m 1.73 m 2.47 ddd (2.2, 4.3, 13.7) e 1.69 ovl e 1.43 ovl 1.55 m 1.20 ovl 1.98 ovl e e 1.56 ovl 1.38 m 2.26 m

2

7

8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

1.19 0.91 0.62 1.56 1.04 1.23 1.59 2.02 2.16 5.28 e 1.62

ovl s s ovl d (6.6) m ovl m ovl t (6.9) s

1.72 s 4.71 br s 5.30 br s

37.2 33.8

27.4 29.8

126.6 49.5 40.4 20.9 37.9 43.5 143.0 25.0 26.2 57.4 18.5 13.4 34.7 19.3 36.6 25.3 126.3 131.1 17.7 26.0 103.7

24-

5

d Ha 1.35 2.07 1.37 1.90 3.88

(3),

dC m m m m m

e 2.70 br d (12.51) 1.39 m 1.59 m 2.37 ddd (1.8, 4.7, 14.6) 2.54 m e e e 1.55 m 1.81 m 1.41 m 1.76 m e e 4.47 br d 1.54 1.82 1.62 0.71 0.68 1.50 0.99 1.69 1.34 2.01 2.24 e 2.27 1.09

m m m s s ovl d (6.7) ovl ovl m m

1.10 4.90 4.93 4.74 5.35

(6.8) br s br s br s br s

hep (6.8) (6.8)

30.1 33.4 73.0 154.2 41.7 24.8 27.1

135.3 74.9 43.8 29.2 34.4 44.2 150.3 69.6 39.4 53.7 18.3 17.0 34.9 19.2 33.8

d Ha

dC

1.06 ovl 1.55 ovl 1.32 m 1.83 m 3.82 dd (4.8, 11.4) e 1.64 m

20.3 105.8 103.7

0.90 t (7.4)

39.2 32.7 18.4

33.8 73.3 153.8 50.0

1.39 m 1.86 m 1.75 m 2.47 ddd (2.1,4.2,13.8) e 1.69 m e 1.44 ovl 1.56 m 1.21 ovl 1.99 m e e 1.39 ovl 1.56 ovl 2.27 m 1.18 0.93 0.63 1.53 1.02 1.17 1.43 1.28 1.42 1.92 e 4.83 4.89 1.58 1.35

30.6

37.2

m s s m d (6.8) ovl ovl ovl

38.1 43.5 142.0 25.3 26.4

50.3 147.8 112.0

br s br s s m

Coupling constants are in parentheses and given in Hertz. H and ments aided by COSY, HSQC and HMBC experiments. b Ovl: overlapped with other signals.

126.6 49.9 40.3 21.8

30.1

ovl

1

30.1

57.4 18.8 13.7 34.9 19.6 34.0

18.3 27.2 12.8

4.71 br s 5.30 br s

a

27.8

and already reported for theonellasterol [26], hydrogenation of exocyclic double-bond on conicasterol ring A produced exclusively the 4b-methyl derivative 6, as a result of the steric influence played by b Me-19 in orienting the access of H2 molecule to the double bond. Structural and stereochemical characterization was based on careful analysis of 1H NMR spectrum. Up-field shift exhibited by H3 (from 3.82 in 1 to 3.53 in 6) and the presence of an additional methyl doublet at dH 0.93 clearly suggested the presence of an additional methyl group at C-4. Small coupling constant H-3/H-4 (3.2 Hz) was consistent with their cis relationship and therefore with the b-orientation of methyl group at position-4. On the other hand, double bond reduction on conicasterone intermediate [27], obtained through PCC oxidation of the oxymethine function at C-3, afforded a mixture of diasteroisomeric ketone derivatives differing in the orientation of the methyl group at C-4. Sodium borohydride treatment on the crude mixture, followed by HPLC separation, furnished again alcohol 6 along with the diastereoisomers 7 and 8, with different stereochemical arrangements of the substituents at C-3 and C-4. The stereochemical assignment reported in Scheme 1 was substantiated by the almost complete superimposition of proton resonances of all nuclei belonging to the tetracyclic nucleus with those reported for the corresponding derivatives of theonellasterol [26]. Pursuing on ring A modification, also the effect of the introduction of an additional polar group was investigated preparing the 4-ketone derivative 9 through ozonolysis of conicasterol (1) followed by dimethylsulfide work-up (O3, CH2Cl2, 78  C, 5 min, then MeOH and Me2S in excess). Finally the role of the stereochemistry at C-24 was also examined by treatment of a dehydroconicasterol sample [21] with hydrogen in presence of platinum oxide as catalyst (Scheme 2). The reaction proceeded smoothly through the concomitant reduction of the exomethylene at C-4 and C-24 affording derivative 6 and 10, efficiently separated on a C-18 ISIS HPLC column. Having assigned the 24R-methyl side chain in 6, careful comparison of 1H NMR spectra of derivatives 6 and 10, differing exclusively in the region of methyl resonances (0.8e1.1 ppm), clearly inferred 10 as the C-24 epimer of 6. 2.3. Pharmacological evaluation and structureeactivity relationships

103.8 13

C assign-

2.2. Chemical modification on conicasterol scaffold As previously reported [24], conicasterol (1) is the major component of the apolar extract of T. conica. Even if conicasterol, as well as several derivatives, was proved to be a potent PXR agonist [21], conicasterol was observed to be cytotoxic toward HepG2 cells when tested at 50 mM in combination with rifaximin. Nevertheless, we reasoned that the large amount available in our laboratory as well as the presence on its chemical structure of functional groups that could be easily modified make conicasterol a suitable template to provide insights on the key structural motifs responsible of PXR modulation. In particular, conicasterol (1) possesses rare structural features, somewhat difficult to obtain through synthetic routes, especially the exomethylene functionality at C-4. Thus, a simplification in this part would be particularly precious in the perspective of a total synthesis of PXR modulators inspired to conicasterol scaffold and with a better safety profile. As depicted in Scheme 1,

Natural compounds 3e5 and semi-synthetic conicasterol analogs 6e10 were evaluated on PXR in a luciferase reporter assay on a human hepatocyte cell line (HepG2 cells) transiently transfected with pSG5-PXR, pSG5-RXR, pCMV-bgalactosidase, and p(CYP3A4)TK-Luc vectors (Fig. 4). HepG2 cells were stimulated with compounds 3e10 in the presence or in absence of rifaximin (10 mM), a well characterized PXR agonist. As shown in Fig. 4A, compounds 3 and 8, when administered alone, transactivate PXR with a potency comparable with that of rifaximin. Even if partial inhibitions of PXR transactivation caused by rifaximin are shown in Fig. 4B, none compound of this series could be judged an effective antagonist. In details, when cells were co-exposed to compounds 3 and 8 and rifaximin, the two compounds caused a slightly reversion of the pharmacological effect of rifaximin. This finding is common when a full agonist (rifaximin) is mixed with partial (less potent) agonists such as compounds 3 and 8. As concern compound 6, even if a slight antagonistic effect was demonstrated at 50 mM, this behavior was not confirmed when 6 was co-administered with rifaximin at different concentration [28]. To further investigate the structureeactivity relationship, we first performed the substitution of the exomethylene at C-4 with a

V. Sepe et al. / European Journal of Medicinal Chemistry 73 (2014) 126e134

129

Fig. 3. Biogenetic relationships between preconicasterol (3) and other known Theonella steroids.

methyl appendage to produce derivatives 6, 7, 8, and 10 with only 8 still able to fit in PXR-LBD. Compatible with the large contribution of apolar amino acids in PXR LBD, the introduction of an additional polar group on ring A in derivative 9 causes a loss of activity in luciferase reporter assay. Second, in the derivatives that still retain the exomethylene functionality, the substitution on the side chain produces a high impact on PXR activity. Similarly to theonellasterol, a potent and selective FXR antagonist devoid of any activity toward PXR and other metabolic NRs [25], compound 5, with an ethyl group at C-24, was inactive. Also in vitro data on 3 and 4 are quite interesting. 24-dehydroconicasterol D (4) shares the tetracyclic core with the PXR agonists theonellasterol E and

conicasterol D [19] and the side chain with the inactive dehydroconicasterol [21]. The observed loss of activity for 4 points the attention on the negative effect played by the presence of an exomethylene functionality on the side chain of this rich family of marine PXR ligands. On the other hand, preconicasterol (3), endowed with a cholestan-type side chain, maintains an agonistic behavior toward PXR. Then the concentrationeresponse curve for preconicasterol (3) and semi-synthetic derivative 8 was investigated. As shown in Fig. 5, compounds 3 and 8 transactivate PXR with an EC50 of z21 mM and of z18 mM, thus indicating a dose dependent agonism towards PXR for both conicasterol derivatives.

Scheme 1. Synthesis of derivatives 6e9. Reaction conditions: a) H2, 10% Pt/C, THF dry/MeOH dry 1:1 v/v, 71%; b) PCC, CH2Cl2 dry, quantitative yield; c) H2, Pd/C, THF dry/MeOH dry 1:1 v/v, quantitative yield; d) NaBH4, MeOH dry; e) O3, CH2Cl2, 78  C, then DMS, 74%.

Scheme 2. Synthesis of derivatives 6 and 10. Reaction condition: a) H2, PtO2, hexane dry, 70%.

130

V. Sepe et al. / European Journal of Medicinal Chemistry 73 (2014) 126e134

Fig. 4. Transactivation assay performed on HepG2 cells transiently transfected with full-length PXR, RXR, bgal and the canonical PXRE containing 3 inverted repeats (IR1). At 24 h post-transfection, cells were primed with (A) rifaximin (R) and compounds 3e10 (10 mM) or with (B) compounds 3e10 (50 mM) plus rifaximin (10 mM) for 18 h (*: p < 0.05 vs not treated cells; #: p < 0.05 vs rifaximin).

Fig. 5. Concentration response-curves for 3 and 8. HepG2 cells were transfected for PXR transactivation assay and stimulated with rising concentrations of 3 and 8 (1, 10 and 50 mM). Rifaximin (1, 10 and 50 mM) was used as a positive control to evaluate the PXR transactivation. RLU: Luciferase Relative light Units, RRU: Renilla Relative light Units. Results are expressed as mean  standard error; *p < 0.05 vs not treated cells.

To further characterize these derivatives, the effect of the two modulators, 3 and 8, on the expression of CyP3A4 (cytochrome P) and on Multidrug Resistance Proteins (MDR1 and MPR3), three canonical PXR target genes, was examined by RT-PCR. As shown in

Fig. 6, the exposure of HepG2 cells to 3 and 8 increased the expression of mRNA for the above PXR targeted genes, thereby confirming at molecular level that these compounds are PXR agonists.

Fig. 6. Real-Time PCR analysis of mRNA relative expression of the PXR target genes CYP3A4, MDR1, MRP3 in HepG2 cells treated with rifaximin (10 mM), 3 and 8 (10 mM). Values are normalized relatively to GAPDH mRNA and are expressed relative to those of not treated cells (NT), which are arbitrarily set to 1. (*: p < 0.05 vs not treated cells).

V. Sepe et al. / European Journal of Medicinal Chemistry 73 (2014) 126e134

131

Fig. 7. Representation of the binding mode of the agonists, preconicasterol (3) (violet sticks in A) and derivative 8 (cyan sticks in B), predicted by docking calculations in the PXR LBD (PBD code 3HVL). PXR is shown as green cartoon, while AF-2 helix is colored in orange. Amino acids involved in ligand binding are shown as green and orange sticks. Residues from Pro268 to Arg287, from Ser350 to Arg360, and all hydrogens are omitted for clarity. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

2.4. Molecular docking studies To elucidate at atomic level the interaction between PXR and the derivatives generated in this study, docking calculations on the most active compounds of the series have been performed. In particular, three different X-ray structures of the PXR LBD (pdb codes: 3hvl, 1nrl and 1m13) have been used to take into account the conformational plasticity of the binding site. In fact, docking software treats protein as a rigid body, thus the use of multiple conformations of the target, if available, is advisable to increase the chances of success of the calculation. In the present case, the agonist compounds, preconicasterol (3) and derivative 8, were undergone to docking calculations that predicted a very similar binding behavior for both agonists in PXR-LBD. In particular, considering the docking results obtained using the three LBD X-ray structures, the most occurring binding mode of preconicasterol (3) and derivative 8 is that shown in Fig. 7. In this state, the hydroxyl group on the ring A of preconicasterol (3) and derivative 8 engages H-bond interactions with the backbone carbonyl oxygens of His407 and Thr408. These interactions represent the anchor point of the ligands in the LBD with the rest of the molecule oriented in the binding pocket forming further favorable interactions such as the hydrophobic contacts between the Me-19 and the ring A with Met243, Phe251, Met425 and Phe429. In particular, the last two residues are located in the activation function 2 region (AF-2) on a small flexible alpha helix (AF-2 helix) responsible for the binding of the co-activator and the corepressor peptides. This part of the protein is supposed to undergo conformational motion responsible for the transition of the nuclear receptor from the agonist to the antagonist form. A similar mechanism of action has been very recently suggested by us and other authors for other nuclear receptors [13,29e31]. On this background, it is reasonable to think that the hydrophobic package established at the AF-2 region by agonist compounds, preconicasterol (3) and derivative 8, stabilizes PXR in the agonist conformation. Finally, in the LBD, the steroidal scaffold of 3 and 8 engages similar interactions with Leu209, while the flexible side chains are settled in a very hydrophobic pocket. Here, preconicasterol (3) and derivative 8 establish a number of favorable contacts with residues such as Phe288, Trp299, Tyr306 and Met246 (Fig. 7A and B). Of relevance, despite the different stereochemistry at C-3 on ring A and the presence of a methylene group in preconicasterol (3)

instead of the methyl one in derivative 8, the binding pattern of these compounds is very similar, supporting the reproducibility and the reliability of the docking calculations. 3. Conclusion NRs play a key role in cellular homeostasis, controlling a wide range of reactions through the regulation of the transcription of specific target genes. This receptor family shares common structural features such as the presence of the LBD responsible for the binding of ligands and co-activator peptides necessary to activate the gene transcription. Despite these similarities, each nuclear receptor shows a specific pattern of interaction with its ligands that, together with the conformational plasticity of the LBD, hampers the rational drug design of new active molecules. In this scenario, elucidating the molecular requisites for the binding to a specific nuclear receptor represents an important advance to understand its functional mechanism and to provide the bases for an exogenous control of its activity. In this framework, we have developed a series of natural and semisynthetic steroids from Theonella marine sponges, as novel modulators of the nuclear receptor PXR. We have assessed their activity profiles through a number of pharmacological experiments and, with the aid of computational studies, we have investigated the effects of different modifications on ring A and on the side chain of the 4-methylenesteroid derivatives toward PXR. This study reaffirms the role of natural products as essential chemical probes in the today’s research arsenal to shed light on complex biological processes and biochemical pathways. 4. Experimental section 4.1. General experimental procedures Specific rotations were measured on a PerkineElmer 243 B polarimeter. High-resolution ESI-MS spectra were performed with a Micromass QTOF spectrometer. ESI-MS experiments were performed on an Applied Biosystem API 2000 triple-quadrupole mass spectrometer. NMR spectra on preconicasterol (3), 24dehydroconicasterol D (4) and 25-dehydrotheonellasterol (5) were obtained on Varian Inova 700 NMR spectrometer (1H at 700 MHz, 13C at 175 MHz, respectively) equipped with a Sun

132

V. Sepe et al. / European Journal of Medicinal Chemistry 73 (2014) 126e134

hardware, d (ppm), J in Hz, spectra referred to C6HD5 as internal standards (dH 7.16, dC 128.4). NMR spectra on all synthetic intermediates (derivatives 6e10) were obtained on Varian Inova 400 NMR spectrometer (1H at 400 MHz, 13C at 100 MHz, respectively) and recorded in C6HD5 as internal standards. HPLC was performed using a Waters Model 510 pump equipped with Waters Rheodine injector and a differential refractometer, model 401. Reaction progress was monitored via thin-layer chromatography (TLC) on AlugramÒ silica gel G/UV254 plates. Silica gel MN Kieselgel 60 (70e230 mesh) from Macherey-Nagel Company was used for column chromatography. All chemicals were obtained from SigmaeAldrich, Inc. Solvents and reagents were used as supplied from commercial sources with the following exceptions. Hexane, dichloromethane and tetrahydrofurane were distilled from calcium hydride immediately prior to use. Methanol was dried from magnesium methoxide as follow. Magnesium turnings (5 g) and iodine (0.5 g) are refluxed in a small (50e100 mL) quantity of methanol until all of the magnesium has reacted. The mixture is diluted (up to 1 L) with reagent grade methanol, refluxed for 2e3 h then distilled under nitrogen. All reactions were carried out under argon atmosphere using flame-dried glassware. The purities of compounds were determined to be greater than 95% by HPLC. 4.2. Sponge material and separation of individual sterols 4.2.1. T. conica The sponge (S07101) was collected off Amami-oshima Is., Kagoshima prefecture, Japan, on June 22, 2007 and kept at 25  C until extracted. The frozen sponge (1020 g) was extracted with MeOH (5  1000 mL) and evaporated. The extract was suspended in H2O (1100 mL) and extracted with CHCl3 (2  800 mL) and n-BuOH (2  700 mL). The CHCl3 and n-BuOH layers were combined, evaporated, and partitioned between 90% MeOH (800 mL) and nhexane (2  800 mL). The n-hexane extract was chromatographed by silica gel MPLC using a solvent gradient system from CH2Cl2 to CH2Cl2/MeOH 1:1. Fractions eluted with CH2Cl2:MeOH 995:5 (40 mg) were further purified by HPLC on a Nucleodur 100-5 C18 (5 mm; 10 mm i.d.  250 mm) with MeOH/H2O (999.5:0.5) as eluent (flow rate 3 mL/min) to give 0.7 mg of preconicasterol (3) (tR ¼ 58.5 min). 4.2.1.1. Preconicasterol 3. White amorphous solid; [a]25 D þ14.6 (c 0.07, MeOH); 1H and 13C NMR data in C6D6 given in Table 1; HRMSESI m/z 397.3475 [M þ Hþ], C28H45O requires 397.3475. 4.2.2. T. swinhoei (R3170) For general experimental procedure, sponge collection and Kupchan’s partitioning procedure see Zampella et al. [19]. The nhexane extract (19.7 g) was chromatographed in two runs by silica gel MPLC using a solvent gradient system from CH2Cl2 to CHCl2/ MeOH 1:1. Fractions eluted with CH2Cl2:MeOH 99:1 (351 mg) were further purified by HPLC on a Nucleodur 100-5 C18 (5 mm; 10 mm i.d.  250 mm) with MeOH/H2O (998:2) as eluent (flow rate 3 mL/ min) to give 1.7 mg of 25-dehydrotheonellasterol (5) (tR ¼ 12.4 min). The chloroformic extract (4.76 g) was chromatographed by silica gel MPLC using a solvent gradient system from CH2Cl2 to CHCl2:MeOH 1:1. Fractions eluted with CH2Cl2:MeOH 97:3 (3 mg) were further purified by HPLC on a Luna 5m 100-5 C18 (5 mm; 4.5 mm

i.d.  250 mm) with MeOH/H2O (95:5) as eluent (flow rate 0.8 mL/ min) to give 0.2 mg of 24-dehydroconicasterol D (4) (tR ¼ 9 min). 4.2.2.1. 24-Dehydroconicasterol D 4. White amorphous solid; 1 13 [a]25 C NMR data in C6D6 given in D 67.0 (c 0.02, CHCl3); H and Table 1; HRMS-ESI m/z 443.3527 [M þ Hþ], C29H47O3 requires 443.3525. 4.2.2.2. 25-Dehydrotheonellasterol 5. White amorphous solid; 1 13 [a]25 C NMR data in C6D6 given in D þ17.9 (c 0.17, MeOH); H and Table 1; HRMS-ESI m/z 425.3788 [M þ Hþ], C30H49O requires 425.3783. 4.3. Chemical modification 4.3.1. (24R)-24-Methyl-4b-methyl-5a-cholest-8(14)en-3b-ol 6 A conicasterol sample (10 mg, 0.024 mmol) was hydrogenated in THF dry/MeOH dry 1:1 v/v (5 mL) in presence of Pt/C as catalyst. The reaction was stirred under H2 for 15 min. The mixture was filtered through SiO2 and the recovered filtrate was concentrated to afford 7 mg of pure compound 6 (0.017 mmol, 71%). 4.3.2. (24R)-24-Methyl-4b-methyl-5a-cholest-8(14)en-3b-ol 6 1 [a ]D 25 ¼ þ10.1 (c 0.03, CH3OH); selected H NMR (400 MHz C6D6): d 3.53 (1H, m), 2.47 (1H, dd, J ¼ 3.2, 12.1 Hz), 1.03 (3H, d, J ¼ 6.5 Hz), 0.94 (3H, s), 0.93 (3H, d, J ¼ 6.6 Hz), 0.91 (3H, d, J ¼ 6.8 Hz), 0.86 (6H, d, J ¼ 6.8 Hz), 0.75 (3H, s). HRMS-ESI m/z 415.3937 [M þ Hþ], C29H51O requires 415.3940. 4.3.3. (24R)-24-Methyl-4a-methyl-5a-cholest-8(14)en-3b-ol 7 and (24R)-24-methyl-4a-methyl-5a-cholest-8(14)en-3a-ol 8 Pyridinium chlorochromate (52 mg, 0.24 mmol) in CH2Cl2 dry (2 mL) was added at the solution of conicasterol (50 mg, 0.12 mmol) in dichloromethane (5 mL). The reaction mixture was stirred at room temperature for 12 h, then was added water. The aqueous phase was extracted with dichloromethane (3  30 mL) and the combined organic phases were dried with Na2SO4 and evaporated to dryness. The residue was passed through a short column of silica gel (2 g) and eluted with CH2Cl2 to give conicasterone [27] (50 mg, quantitative yield) as amorphous solid, that was subjected to next step without any purification procedure. Conicasterone was hydrogenated in presence of palladium 5% wt on activated carbon (5 mg) in THF dry/MeOH dry 1:1 v/v (5 mL) in an oven-dried 25 mL flask. The reaction was stirred at room temperature under H2 for 1 h. Then the mixture was filtered through SiO2 and the recovered filtrate was concentrated. Purification by HPLC on a Nucleodur Isis 100-5 C18 (5 mm; 4.5 mm i.d.  250 mm) with MeOH/H2O (999.5:0.5) as eluent (flow rate 1 mL/min) afforded 33.6 mg (67.3% from conicasterone) of 4b-methyl derivative (tR ¼ 48 min) and 16.4 mg (32.7% from conicasterone) of 4a-methyl derivative (tR ¼ 52 min) as amorphous solids. To a solution of 4b-methyl derivative (30 mg, 0.07 mmol) in dry methanol (5 mL) was added NaBH4 (13 mg, 0.35 mmol) at 0  C. After 1 h, the reaction was quenched by addition of MeOH (3 mL) and then concentrated under vacuo. Ethyl acetate and water were added and the separated aqueous phase was extracted with ethyl acetate (3  30 mL). The combined organic phases were washed with water, dried with Na2SO4 and concentrated to obtain compound 6 as a white solid (26 mg, 87%). Compounds 7 and 8 were obtained by NaBH4 reduction as described before, starting from 4a-methyl derivative (15 mg). The obtained mixture was purified by HPLC on a Nucleodur Isis 100-5 C18 (5 mm; 4.5 mm i.d.  250 mm) with MeOH/H2O (999.5:0.5) as eluent (flow rate 1 mL/min) to give 6.6 mg (44% from 4a-methyl

V. Sepe et al. / European Journal of Medicinal Chemistry 73 (2014) 126e134

derivative) of 7 (tR ¼ 47.5 min) and 4.4 mg of 8 (31% from 4a-methyl derivative) (tR ¼ 50 min) as amorphous solids. 4.3.4. (24R)-24-Methyl-4a-methyl-5a-cholest-8(14)en-3b-ol 7 1 [a]D 25 ¼ þ7.2 (c 0.03, CH3OH); selected H NMR (400 MHz C6D6): d 2.99 (1H, m), 2.00 (1H, dt, J ¼ 5.4, 12.6 Hz), 1.03 (3H, d, J ¼ 6.6 Hz), 1.01 (3H, d, J ¼ 6.5 Hz), 0.94 (3H, s), 0.91 (3H, d, J ¼ 6.8 Hz), 0.86 (6H, d, J ¼ 6.6 Hz), 0.70 (3H, s). HRMS-ESI m/z 415.3935 [M þ Hþ], C29H51O requires 415.3940. 4.3.5. (24R)-24-Methyl-4a-methyl-5a-cholest-8(14)en-3a-ol 8 1 [a]D 25 ¼ 6.6 (c 0.04, CH3OH); selected H NMR (400 MHz C6D6): d 3.55 (1H, br m), 2.48 (1H, dd, J ¼ 3.1, 12.0 Hz), 1.03 (3H, d, J ¼ 7.0 Hz), 0.93 (6H, d, J ¼ 7.3 Hz), 0.91 (3H, s), 0.86 (6H, d, J ¼ 6.6 Hz), 0.75 (3H, s). HRMS-ESI m/z 415.3938 [M þ Hþ], C29H51O requires 415.3940. 4.3.6. (24R)-24-Methyl-3b-hydroxyl-5a-cholest-8(14)en-4-one 9 At a solution of conicasterol (5 mg, 0.012 mmol) in CH2Cl2 dry kept under argon at 78  C was bubbled a stream of O3 until a bluecolored solution resulted. After stirring for 1 h, excess of ozone was removed upon bubbling N2 and the solution was treated with excess dimethylsulfide (2 mL). After 8 h, the solution was concentrated under vacuo to remove the solvent and the mixture was purified by HPLC on a Nucleodur Isis 100-5 C18 (5 mm; 4.5 mm i.d.  250 mm) with MeOH/H2O (999.5:0.5) as eluent (flow rate 1 mL/min) to give 3.7 mg (74%) of 9 (tR ¼ 27.5 min) as an amorphous 1 solid. [a]D 25 ¼ þ8.6 (c 0.17, CH3OH); selected H NMR (400 MHz C6D6): d 3.82 (1H, m), 1.01 (3H, d, J ¼ 6.8 Hz), 0.91 (3H, d, J ¼ 6.8 Hz), 0.86 (6H, d, J ¼ 6.3 Hz), 0.82 (3H, s), 0.45 (3H, s); HRMS-ESI m/z 415.3573 [M þ Hþ], C28H47O2 requires 415.3576. 4.3.7. (24R)-24-Methyl-4b-methyl-5a-cholest-8(14)en-3b-ol 6 and (24S)-24-methyl-4b-methyl-5a-cholest-8(14)en-3b-ol 10 At a solution of dehydroconicasterol (10 mg, 0.024 mmol) in hexane dry (5 mL) was added platinum oxide on carbon (5 mg) and the flask was evacuated and flushed first with argon and then with hydrogen. The reaction was stirred at room temperature under H2 for 5 min. The mixture was filtered through Celite, and the recovered filtrate was concentrated. The mixture was purified by HPLC on a Nucleodur Isis 100-5 C18 (5 mm; 4.5 mm i.d.  250 mm) with MeOH/H2O (999.5:0.5) as eluent (flow rate 1 mL/min) to give 2.6 mg of 6 (tR ¼ 48 min) and 4.0 mg of 10 (tR ¼ 53 min) as amorphous solids. 4.3.8. (24S)-24-Methyl-4b-methyl-5a-cholest-8(14)en-3b-ol 10 1 [a]D 25 ¼ 8.0 (c 0.03, CH3OH); selected H NMR (400 MHz C6D6): d 3.53 (1H, m), 2.47 (1H, dd, J ¼ 3.2, 12.0 Hz), 1.03 (3H, d, J ¼ 6.4 Hz), 0.93 (3H,s), 0.92 (3H, d, J ¼ 7.0 Hz), 0.91 (3H, d, J ¼ 7.0 Hz), 0.86 (3H, d, J ¼ 6.6 Hz), 0.84 (3H, d, J ¼ 7.0 Hz), 0.74 (3H, s). HRMS-ESI m/z 415.3942 [M þ Hþ], C29H51O requires 415.3940. 4.4. Luciferase assay HepG2 cells were cultured at 37  C in Minimum Essential Medium with Earl’s salts containing10% fetal bovine serum (FBS), 1% Lglutamine and 1% penicillin/streptomycin. Cells were plated in a 24-wells plate at 5  104 cells/well. The transfection experiments were performed using Fugene HD (Promega, Milan, Italy) according to manufacturer specifications. For PXR mediated transactivation, cells were transfected with 75 ng pSG5-hPXRT1, 75 ng pSG5-RXR, 125 ngpCMV-bgal and with 250 ng of the reporter vector pGL3(henance)PXRE. At 24 h post-transfection, cells were primed with rifaximin or compounds 3e10 (10 mM in agonism) or with compounds 3e10 (50 mM plus rifaximin 10 mM, antagonism) for

133

18 h. Twenty mL of cellular lysates were read using the Luciferase Substrate (Promega) and luminescence was measured using the Glomax 20/20 luminometer (Promega). Luciferase activities were normalized for transfection efficiencies by dividing the relative light units by b-galactosidase activity expressed from cotransfected pCMV-bgal. In another experimental setting, HepG2 cells were transfected with 75 ng pSG5-hPXRT1, 75 ng pSG5-RXR, 100 ng pGL4.70-Renilla and pGL3(henance)PXRE and treated with rising doses of 3 and 8 (1, 10 and 50 mM) and rifaximin (1, 10 and 50 mM) as positive control. Twenty mL of cellular lysates were read using Dual-Luciferase Reporter Assay System (Promega) according manufacturer specifications. Luciferase activities were normalized for transfection efficiencies by dividing the Luciferase relative light units (RLU) by Renilla relative lights units (RRU) expressed from cells cotransfected with pGL4.70-Renilla. 4.5. Real time PCR HepG2 cells were stimulated 18 h with rifaximin (10 mM) and compounds 3 and 8 (10 mM). Total RNA was extracted using the TRIzol reagent (Invitrogen), and reverse-transcribed using random hexamer primers and Super Script-II reverse transcriptase (Invitrogen). mRNA was quantified by Real-Time quantitative PCR on iCycler apparatus (Biorad) using specific primers: hGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; hCYP3A4: caagacccctttgtggaaaa and cgaggcgactttctttcatc; hMDR1: gtggggcaagtcagttcatt and tcttcacctccaggctcagt; hMRP3: cacacggatctgacagacaatga and acagggcactcagctgtctca. For quantitative RT-PCR, 10 ng of template was dissolved in a 20 mL solution containing 200 nM of each primer and 10 mL of KAPA SYBR FAST Universal qPCR Kit (KAPA BIOSYSTEMS). All reactions were performed in triplicate, and the thermal cycling conditions were as follows: 3 min at 95  C, followed by 40 cycles of 95  C for 15 s, 58  C for 20 s and 72  C for 30 s. The relative mRNA expression was calculated accordingly with the Ct method. All PCR primers were designed using the software PRIMER3 (http://frodo.wi.mit.edu/primer3/) using published sequence data obtained from the NCBI database. 4.6. Computational details Molecular docking of preconicasterol (3) and derivative 8 in the three-dimensional X-ray structures of the PXR LBD (PDB codes: 3hvl, 1nrl and 1m13) [32e34] without the co-crystallized inhibitor and waters were carried out using the AutoDock software package (version 4.2) [35]. Ligand and receptor structures were converted to AutoDock format files using the ADT software, and the GesteigerMarsili partial charges were then assigned. A box around the binding pocket has defined the docking area and grids points of 48  40  38 with 0.375  A spacing were calculated within this area for all the ligand atom types using AutoGrid4. For each ligand, 100 separate docking calculations were performed. Each docking run consisted of 25 million energy evaluations using the Lamarckian genetic algorithm local search (GALS) method. Otherwise default docking parameters were applied. The docking conformations were clustered on the basis of the root-mean square deviation values (rmsd tolerance ¼ 1.5  A) between the Cartesian coordinates of the ligand atoms and were ranked based on the AutoDock scoring function. Acknowledgments This work was supported by grants from MAREX-Exploring Marine Resources for Bioactive Compounds: From Discovery to Sustainable Production and Industrial Applications (Call FP7-KBBE-

134

V. Sepe et al. / European Journal of Medicinal Chemistry 73 (2014) 126e134

2009-3, Project nr. 245137) and from MIUR, PRIN 2009 Sostanze ad attività antitumorale: isolamento da fonti marine and PRIN 2010/ 2011 (E61J12000210001). NMR spectra were provided by the CSIAS, Centro Interdipartimentale di Analisi Strumentale, Department of Pharmacy, University of Naples. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.ejmech.2013.12.005. References [1] R.E. Watkins, G.B. Wisely, L.B. Moore, J.L. Collins, M.H. Lambert, S.P. Williams, T.M. Willson, S.A. Kliewer, M.R. Redinbo, The human nuclear xenobiotic receptor PXR: structural determinants of directed promiscuity, Science 292 (2001) 2329e2333. [2] J.M. Rosenfeld, R. Vargas Jr., W. Xie, R.M. Evans, Genetic profiling defines the xenobiotic gene network controlled by the nuclear receptor pregnane X receptor, Mol. Endocrinol. 17 (2003) 1268e1282. [3] T.W. Synold, I. Dussault, B.M. Forman, The orphan nuclear receptor SXR coordinately regulates drug metabolism and efflux, Nat. Med. 7 (2001) 584e 590. [4] B. Staudinger, S.A. Goodwin, D. Jones, K.I. Hawkins-Brown, A. MacKenzie, Y. LaTour, C.D. Liu, K.K. Klaassen, J. Brown, T.M. Reinhard, B.H. Willson, S.A. Kliewer, The nuclear receptor PXR is a lithocholic acid sensor that protects against liver toxicity, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 3369e3374. [5] S. Fiorucci, S. Cipriani, F. Baldelli, A. Mencarelli, Bile acid-activated receptors in the treatment of dyslipidemia and related disorders, Prog. Lipid Res. 49 (2010) 171e185. [6] J. Gao, W. Xie, Targeting xenobiotic receptors PXR and CAR for metabolic diseases, Trends Pharmacol. Sci. 33 (2012) 552e558. [7] H.I. Swanson, T. Wada, W. Xie, B. Renga, A. Zampella, E. Distrutti, S. Fiorucci, B. Kong, A.M. Thomas, G.L. Guo, R. Narayanan, M. Yepuru, J.T. Dalton, J.Y. Chiang, Role of nuclear receptors in lipid dysfunction and obesity-related diseases, Drug Metab. Dispos. 41 (2013) 1e11. [8] J. Cheng, Y.M. Shah, X. Ma, X. Pang, T. Tanaka, T. Kodama, K.W. Krausz, F.J. Gonzalez, Therapeutic role of rifaximin in inflammatory bowel disease: clinical implication of human pregnane X receptor activation, J. Pharmacol. Exp. Ther. 335 (2010) 32e41. [9] Y. Chen, Y. Tang, C. Guo, J. Wang, D. Boral, D. Nie, Nuclear receptors in the multidrug resistance through the regulation of drug-metabolizing enzymes and drug transporters, Biochem. Pharmacol. 83 (2012) 1112e1126. [10] S. Fiorucci, A. Zampella, E. Distrutti, Development of FXR, PXR and CAR agonists and antagonists for treatment of liver disorders, Curr. Top. Med. Chem. 12 (2012) 605e624. [11] M.V. D’Auria, V. Sepe, A. Zampella, Natural ligands for nuclear receptors: biology and potential therapeutic applications, Curr. Top. Med. Chem. 12 (2012) 637e669. [12] S. Fiorucci, E. Distrutti, G. Bifulco, M.V. D’Auria, A. Zampella, Marine sponge steroids as nuclear receptor ligands, Trends Pharmacol. Sci. 33 (2012) 591e 601. [13] F.S. Di Leva, C. Festa, C. D’Amore, S. De Marino, B. Renga, M.V. D’Auria, E. Novellino, V. Limongelli, A. Zampella, S. Fiorucci, Binding mechanism of the farnesoid X receptor marine antagonist suvanine reveals a strategy to forestall drug modulation on nuclear receptors. Design, synthesis, and biological evaluation of novel ligands, J. Med. Chem. 56 (2013) 4701e4717. [14] C. Festa, G. Lauro, S. De Marino, M.V. D’Auria, M.C. Monti, A. Casapullo, C. D’Amore, B. Renga, A. Mencarelli, S. Petek, G. Bifulco, S. Fiorucci, A. Zampella, Plakilactones from the marine sponge Plakinastrella mamillaris. Discovery of a new class of marine ligands of peroxisome proliferatoractivated receptor g, J. Med. Chem. 55 (2012) 8303e8317. [15] V. Sepe, G. Bifulco, B. Renga, C. D’Amore, S. Fiorucci, A. Zampella, Discovery of sulfated sterols from marine invertebrates as a new class of marine natural antagonists of farnesoid-X-receptor, J. Med. Chem. 54 (2012) 1314e1320. [16] M.G. Chini, C.R. Jones, A. Zampella, M.V. D’Auria, B. Renga, S. Fiorucci, C.P. Butts, G. Bifulco, Quantitative NMR-derived interproton distances combined with quantum mechanical calculations of 13C chemical shifts in the stereochemical determination of conicasterol F, a nuclear receptor ligand from Theonella swinhoei, J. Org. Chem. 77 (2012) 1489e1496. [17] C. Festa, C. D’Amore, B. Renga, G. Lauro, S. De Marino, M.V. D’Auria, G. Bifulco, A. Zampella, S. Fiorucci, Oxygenated polyketides from Plakinastrella mamillaris as a new chemotype of PXR agonists, Mar. Drugs 11 (2013) 2314e2327.

[18] C. Festa, S. De Marino, M.V. D’Auria, G. Bifulco, B. Renga, S. Fiorucci, S. Petek, A. Zampella, Solomonsterols A and B from Theonella swinhoei. The first example of C-24 and C-23 sulfated sterols from a marine source endowed with a PXR agonistic activity, J. Med. Chem. 54 (2011) 401e405. [19] S. De Marino, R. Ummarino, M.V. D’Auria, M.G. Chini, G. Bifulco, B. Renga, C. D’Amore, S. Fiorucci, C. Debitus, A. Zampella, Theonellasterols and conicasterols from Theonella swinhoei. Novel marine natural ligands for human nuclear receptors, J. Med. Chem. 54 (2011) 3065e3075. [20] S. De Marino, V. Sepe, M.V. D’Auria, G. Bifulco, B. Renga, S. Petek, S. Fiorucci, A. Zampella, Towards new ligands of nuclear receptors. Discovery of malaitasterol A, an unique bis-secosterol from marine sponge Theonella swinhoei, Org. Biomol. Chem. 9 (2011) 4856e4862. [21] S. De Marino, R. Ummarino, M.V. D’Auria, M.G. Chini, G. Bifulco, C. D’Amore, B. Renga, A. Mencarelli, S. Petek, S. Fiorucci, A. Zampella, 4-Methylenesterols from Theonella swinhoei sponge are natural pregnane-X-receptor agonists and farnesoid-X-receptor antagonists that modulate innate immunity, Steroids 77 (2012) 484e495. [22] V. Sepe, R. Ummarino, M.V. D’Auria, M.G. Chini, G. Bifulco, B. Renga, C. D’Amore, C. Debitus, S. Fiorucci, A. Zampella, Conicasterol E, a small heterodimer partner sparing farnesoid X receptor modulator endowed with a pregnane X receptor agonistic activity, from the marine sponge Theonella swinhoei, J. Med. Chem. 55 (2012) 84e93. [23] V. Sepe, R. Ummarino, M.V. D’Auria, A. Mencarelli, C. D’Amore, B. Renga, A. Zampella, S. Fiorucci, Total synthesis and pharmacological characterization of solomonsterol A, a potent marine pregnane-X-receptor agonist endowed with anti-inflammatory activity, J. Med. Chem. 54 (2011) 4590e4599. [24] E. Kho, D.K. Imagawa, M. Rohmer, Y. Kashman, C. Djerassi, Sterols in marine invertebrates. 22. Isolation and structure elucidation of conicasterol and theonellasterol, two new 4-methylene sterols from the Red Sea sponges Theonella conica and Theonella swinhoei, J. Org. Chem. 46 (1981) 1836e1839. [25] B. Renga, A. Mencarelli, C. D’Amore, S. Cipriani, M.V. D’Auria, V. Sepe, M.G. Chini, M.C. Monti, G. Bifulco, A. Zampella, S. Fiorucci, Discovery that theonellasterol a marine sponge sterol is a highly selective FXR antagonist that protects against liver injury in cholestasis, PLoS One 7 (2012) e30443. [26] V. Sepe, R. Ummarino, M.V. D’Auria, O. Taglialatela-Scafati, S. De Marino, C. D’Amore, B. Renga, M.G. Chini, G. Bifulco, Y. Nakao, N. Fusetani, S. Fiorucci, A. Zampella, Preliminary structureeactivity relationship on theonellasterol, a new chemotype of FXR antagonist, from the marine sponge Theonella swinhoei, Mar. Drugs 10 (2012) 2448e2466. [27] M. Kobayashi, K. Kawazoe, T. Katori, I. Kitagawa, Marine natural products XXX. Two new 3-keto-4-methylene steroids, theonellasterone and conicasterone, and a DielseAlder type dimeric steroid bistheonellasterone, from the Okinawan marine sponge Theonella swinhoei, Chem. Pharm. Bull. 40 (1992) 1773e 1778. [28] Compound 6 was tested, in combination with rifaximin (10 mM), in a doseresponsive manner (10, 25, 50 mM) in a luciferase reporter assay. No effect was observed at 10 and 25 mM doses and the slightly antagonistic effect respect to rifaximin at 50 mM resulted not enough significant from a statistic point of view, thus preventing from the chance to calculate a formal IC50. [29] S. Ekins, C. Chang, S. Mani, M.D. Krasowski, E.J. Reschly, M. Iyer, V. Kholodovych, N. Ai, W.J. Welsh, M. Sinz, P.W. Swaan, R. Patel, K. Bachmann, Human pregnane X receptor antagonists and agonists define molecular requirements for different binding sites, Mol. Pharmacol. 72 (2007) 592e603. [30] B.L. Wagner, G. Pollio, P. Giangrande, J.C. Webster, M. Breslin, D.E. Mais, C.E. Cook, W.V. Vedeckis, J.A. Cidlowski, D.P. McDonnell, The novel progesterone receptor antagonists RTI 3021-012 and RTI 3021-022 exhibit complex glucocorticoid receptor antagonist activities: implications for the development of dissociated antiprogestins, Endocrinology 140 (1999) 1449e1458. [31] J.T. Link, B. Sorensen, J. Patel, M. Grynfarb, A. Goos-Nilsson, J. Wang, S. Fung, D. Wilcox, B. Zinker, P. Nguyen, B. Hickman, J.M. Schmidt, S. Swanson, Z. Tian, T.J. Reisch, G. Rotert, J. Du, B. Lane, T.W. von Geldern, P.B. Jacobson, Antidiabetic activity of passive nonsteroidal glucocorticoid receptor modulators, J. Med. Chem. 48 (2005) 5295e5304. [32] W. Wang, W.W. Prosise, J. Chen, S.S. Taremi, H.V. Le, V. Madison, X. Cui, A. Thomas, K.C. Cheng, C.A. Lesburg, Construction and characterization of a fully active PXR/SRC-1 tethered protein with increased stability, Protein Eng. Des. Sel. 21 (2008) 425e433. [33] R.E. Watkins, P.R. Davis-Searles, M.H. Lambert, M.R. Redinbo, Coactivator binding promotes the specific interaction between ligand and the pregnane X receptor, J. Mol. Biol. 331 (2003) 815e828. [34] R.E. Watkins, J.M. Maglich, L.B. Moore, G.B. Wisely, S.M. Noble, P.R. DavisSearles, M.H. Lambert, S.A. Kliewer, M.R. Redinbo, A crystal structure of human PXR in complex with the St. John’s wort compound hyperforin, Biochemistry 42 (2003) 1430e1438. [35] G.M. Morris, R. Huey, W. Lindstrom, M.F. Sanner, R.K. Belew, D.S. Goodsell, A.J. Olson, Autodock4 and AutoDockTools4: automated docking with selective receptor flexibility, J. Comput. Chem. 30 (2009) 2785e2791.