J. Mol. Biol. (1990) 213,247-262

Initiation of Replication of Plasmid pLS1 T h e Initiator P r o t e i n R e p B A c t s o n T w o D i s t a n t D N A

Regions

Adela G. de la Campa, Gloria H. del Solar and Manuel Espinosa Centro de lnvestigaciones Bioldgicas C.S.I.C. Veldzquez 144 28006-Madrid, Spain (Received 31 July 1989; accepted 22 January 1990) The broad host range streptococcal plasmid pLS1 encodes the 24.2 kDa protein RepB, which is involved in the initiation of plasmid replication by an asymmetric rolling circle. RepB was overproduced in an Escherichia coli expression system and the protein was purified and characterized. Determination of the amino-terminal sequence of RepB protein showed that translation starts from the first AUG codon, which is preceded by an atypical ribosomebinding site sequence. RepB protein has in vitro-specific endonuclease and topoisomeraselike activities on the plasmid ori( + ). Footprinting experiments showed that RepB protein binds to a DNA region that includes' three direct repeats of 11 base-pairs. Initiation of replication of pLS1 could start by a RepB-generated specific nick introduced on the plasmid coding strand. However, as a striking difference with other Gram-positive replicons, the nick generated by RepB lies 86 base-pairs upstream from it~ binding region. To explain the action of RepB at a distance, complex Structures of the pLS1 ori(+) are proposed.

1. I n t r o d u c t i o n

Initiation of plasmid replication generally depends on one or more plasmid-encoded products acting co-ordinately with a range of host-encoded replication proteins (Scott, 1984). Many of the wellcharacterized Gram:negative plasmids follow a theta type of replication, in which the synthesis of the leading and lagging strands is coupled (.Thomas, 1988). Uncoupling of the strand syntheses occurs in the single-stranded DNA coliphages, in which the initiator (Rep) protein introduces a strand and sitespecific nick (Kornberg, 1980). This second mechanism, known as rolling circle replication, seems to be the general replication process of most of the small multicopy Gram-positive plasmids (te Riele et al., 1986). Among them, the best characterized replicons are the staphylococcal plasmid pT181 family (Projan & Noviek, 1988, and references cited therein) and the streptococcal plasmid pLS1 (Lacks et al., 1986). This latter 4408 bp~f plasmid is interesting per se because it shows the unusual property ~fAbbreviations used: bp, base-pair(s); IPTG, isopropyl-fl-D-thiogalactoside; EtBr, ethidium bromide; Pol IK, Klenow fragment of the E. coli DNA polymerase I; P.I.R., Protein Identification Resource; a.r.b.s., atypical ribosome binding site; S-D, Shine-Dalgarno. 0022-2836/90/100247-16 $03.00/0

247

of being able to replicate both in Gram-positive (streptococci, Bacillus subtilis) and Gram-negative (Escherichia coli) hosts (Lacks et al., 1986). In the case of plasmid pT181, replication is initiated by the plasmid-encoded protein, RepC, which introduces a strand and site-specific nick at the plasmid ori(÷) (Koepsel et al., 1985a). The replication protein seems to remain covalently attached to the plasmid DNA and the nick could provide a free 3'-OH end which is elongated until the displaced strand reaches the plasmid ori(+) again (Murray et al., 1989, and references cited therein). For a variety of Gram-positive replicons, it has been shown that the end products of this first step are one doublestranded replicated plasmid molecule and one single-stranded circular intermediate per plasmid unit (te Riele et al., 1986). The single-stranded intermediates are apparently converted to duplex DNA molecules upon recognition by the host machinery of a plasmid region (termed o r / ( - ) for pLS1 and palA for pT181) which acts as an initiation signal for the lagging strand synthesis (del Solar et al., 1987a; Gruss et al., 1987). In the case of plasmid pLS1, the use of a cell-free E. coli replication system (del Solar et al., 1987b) allowed the location of the plasmid ori(+) within a 284 bp region which included two inverted repeats, hairpins I and II, and three 11 bp direct repeats or © 1990 Academic Press Limited

A. G. de la Campa et al.

248

iterons (Puyet et al., 1988). Unidirectional replication starts in this region and proceeds in the direction of the plasmid m R N A synthesis, singlestranded intermediates being generated from the plasmid coding strand. The pLS1 o r i ( - ) has a strong potential secondary structure and shares homology with the complementary strand origin of replication of the single-stranded coliphage ¢X174 (del Solar et al., 1987a). The genetic organization of pLS1 (Lacks et al., 1986) is such t h a t the three plasmid genes (tet, repA and repB) are transcribed in the same direction. The gene products RepA and RepB are translated from the same mRNA (G. H. del Solar, J. P~rez-Martin & M. Espinosa, unpublished results) into proteins RepA and RepB. RepA is a 45 amino acid repressor protein involved in the plasmid copy n u m b e r control by binding to the repAB promoter (del Solar et al., 1989), whereas RepB has been postulated to be the initiator of replication protein (Lacks et al., 1986). In this work we report on the purification and characterization of RepB protein with respect to its enzymatic activity and protein size. We show t h a t RepB is indeed the Rep protein of pLS1 and t h a t it has site-specific nicking and closing activities. However, as a difference with other Rep proteins, RepB binds to the three iterons and to a fourth sequence partially homologous to them, whereas the nicking site of RepB is located on hairpin I, 86 bp upstream from the iterons. The single-stranded nick leaves a free 3'-OH end t h a t m a y correspond to the plasmid replication start site. To explain the activity of RepB at a distance, two possible DNA structures of the pLS1 ori( + ), which could place the three iterons and the hairpin I close together, are proposed.

2. Materials and Methods (a) Bacterial strains and plasmids

Streptococcus pneumoniae 708 (end-1 exo-2 trt-l hex-4 ms/M594) was employed in the preparation and construction of the pLSl-based plasmids and in the complementation assays. E. eoli BL21(DE3) (F- ram B gal ompT (int :: P~ocuvs-T7 gene 1 imm21 nin5: Studier & Moffat, 1986; a gift from F. W. Studier) was employed as host for the expression of repB. Plasmids used were: pLS1 (Lacks et al., 1986); pLS5 (having a 332 bp deletion including co-ordinates 33 to 365 of pLS1; Lacks et al., 1986); pLS1A24 (having a 570 bp clockwise deletion including co-ordinates 4240 to 401 of pLS1; Puyet et al., 1988); pCGA3 (pLS1 DNA from coordinates 505 to 804 cloned into pC194; del Solar et al., 1989); pLSM1AA15 (this work); pET5 (Studier & Moffat, 1986); pLS21 and pLS19 (Lacks eta/., 1986; del Solar et al., 1989). Plasmid pET5 (provided by F. W. Studier) is a pBR322-based transcription vector in which the phage T7 RNA polymerase ¢10 promoter has been cloned. Plasmid pLS21 is a hybrid between pLS5 and pET5. Since the tet gene carried by pLS21 was toxic for the E. coli host, this gene was removed by the construction of the Be/I-deleted derivative pLS19 (del Solar et al., 1989). Other plasmids employed to assay the specificity of the nicking activity of RepB were: pBR322 (Bolivar et al., 1977), pKN182 (Molin

& NordstrSm, 1980), pT181 (Kahn & Novick, 1983), pE194 and pC194 (Horinouchi & Weisblum, 1982a,b), and pBAGI, pBAG3 and pBAG4 (this work). Plasmid pBAG1 is a pBR332-based replicon in which the Sau3A small fragment of plasmid pJS3 (carrying the pC194 cat gene; Ballester et al., 1986) was cloned at the pBR332 single BamHI site. Plasmids pBAG3 and pBAG4 are derivatives of pBAGI, in which a pLS5 PstI-BglI fragment coordinates 5 to 804 of pLS1) was cloned at its unique PstI site in the two orientations. (b) Analysis of plasmid-ensoded proteins The pET5 veetor]BL21(DE3) host cloning system allows the specific synthesis and labelling of protein products encoded by genes placed under the control of the phage T7 ¢10 promoter (Studier & Moffat, 1986; Rosenberg et al., 1987). The strain harbours a defective lambda prophage in which the T7 RNA polymerase gene (under the control of the lacUV5 promoter) has been cloned. In the presence of IPTG the synthesis of the T7 RNA polymerase is induced and, as a consequence, mainly plasmid-eneoded proteins are synthesized. To label the proteins encoded by pLS19, a 1 ml culture of BL21(DE3) harbouring this plasmid was grown at 37°C in M9 medium containing 200 #g of ampicillin. When the culture reached A6oo = 0-5, cells were induced with IPTG (1 ~mol), incubation proceeded for 30 min and 200 pg of rifampiein were added. After 90 min, 10pmol of [3SS]methionine (1000 Ci/mmol) were added. Incorporation of the isotope was terminated 10 min later by addition of an excess of cold methionine and chilling of the culture. The cells were centrifuged, suspended in 0"5 ml of 0"l M-Tris'HCl (pH 7"5) containing 125 pg of lysozyme and lysed by 20 min incubation at 4°C, addition of 0"2% (v/v) Triton X-100 and freezing and thawing. The labelled samples contained about 5000 cts/min per ~l. Proteins were separated by eleetrophoresis in 10% to 25% (w/v) polyaerylamide gradient gels, and they were revealed by staining the gels with Coomassie brilliant blue, photography and fluorography. (c) Purification of RepB To purify RepB, E. coli BL21(DE3) harbouring pLS19 was used {Fig. l(a)). Different conditions of IPTG induetion and of rifampicin treatment were assayed (not shown); the best yield of RepB was obtained by induction for 30 min followed by 90 min of rifampicin treatment. Purification of RepB was achieved in 5 steps, all performed at 0°C to 4°C. The buffer used throughout was buffer B (20 mM-Tris-HCl (pH 8"0), 50 mM-KCI, 1 mM-EDTA, 5 mM-dithiothreitol, 5% (v/v) ethylene glycol). Step 1: Preparation of crude extracts. Cells from a 2 1 induced culture were collected by centrifugation, washed and suspended in 20 ml of buffer. Cells were lysed by passage through a French pressure cell (20,000 lb/in2), debris were removed by eentrifugation and the resulting crude extract was mixed with a 1 ml labelled culture extract. Step 2: Streptomycin sulphate precipitation. To the 20 ml crude extracts (A26o = 100), 6 ml of 25% (w/v) streptomycin sulphate were added dropwise while gently stirring. Mixing continued for 30 rain and the RepB-containing supernatant was collected after centrifugation. Most of RepA precipitated with the nucleic acids, as expected from the strong DNA-binding properties of this protein (del Solar et al., 1989).

Initiation of Replication of Plasmid pLS1 Step 3: Ammonium sulphate fractionation. A solution of ammonium sulphate was made by adding 12"3 g of solid ammonium sulphate to 26 ml of supernatant liquid and mixing for 60 min. The precipitate was collected by centrifugation, dissolved in 10 ml of buffer B and dialysed overnight against 2 l of the same buffer. Step 4: DEAE-Sephacell chromatography. The ammonium sulphate fraction was applied at 15 ml/h to a 0'9 cm x 13 cm column of DEAE-Sephacell (Pharmacia), equilibrated with buffer B and washed with 9 ml of buffer. Proteins were eluted with a 50 mM to 500 mM-KCI linear gradient (10 column volumes) and 2 ml fractions were collected. A single labelled polypeptide with a mobility corresponding to RepB eluted at 160 mM-KC1, whereas RepA and fl-lactamase did not bind to the matrix. Step 5: H eparin-aqarose chromatography. RepBcontaining fractions were pooled, diluted with 10 ml of buffer and applied at 15 ml/h to a 1-4 cm x 4 cm heparinagarose column. The column was washed with 20 ml of the same buffer and then a 150 mM to 600 mM-KCI gradient (10 column volumes) was applied and RepB eluted at 425 mM. At this step, RepB seemed to be pure as judged by gel electrophoresis followed by staining and fluorography. The protein was conserved by dialysis of the heparin-agarose peak fractions against buffer B (without ethylene glycol) with 50% glycerol and storage at - 2 0 ° C . After 1 year under these conditions no apparent loss of activity was observed. The yield of RepB was about 0-85 mg from 193 mg of protein from the crude extract (Table 1). Enzymatic activity of RepB at the different stages of purification was measured by relaxation of supercoiled plasmid pLS1 (14 ng/#l) in buffer A (20 mM-Tris "HCI (pH 8"0), 1 mM-EDTA, 100 mM-KCI, 5mM-dithiothreitol, 5 % ethylene glycol) containing 20 mM-MnC12. After incubation at 37 °C for 30 min, reactions were stopped by the addition of 0.2 vol. 50% glycerol, 20 mM-EDTA, 0"2% (w/v) bromophenol blue. The mixtures were loaded on 1% (w/v) agarose gels and electrophoresed at room temperature in 89 mM-Trisborate buffer (pH 8-3) for 15 h at 3 V/cm, in the presence of 1 #g EtBr/ml. Gels were photographed and negatives were scanned to measure the ratio between supercoiled plasmid DNA (CCC) and fast-migrating plasmid forms that have been relaxed and closed by RepB (RC). One unit of RepB is defined as the amount of protein required to convert 1 #g of C~C to RC pLS1 DNA in 60 min at 37 °C. (d) Sedimentation of proteins in glycerol gradients Samples (350 ~l) were prepared as follows: 105 #l from heparin-agarose column peak fractions (concentrated by dialysis against 50 % glycerol in buffer B without ethylene glycol) were mixed with 245 ~l of the same buffer. The samples were applied on top of 3"8 ml 15% to 35% (w/v) glycerol gradients and centrifuged at 59,000 revs/min, 4°C for 15 h in a SW-60 Beckman rotor. Tubes containing standard proteins (3"5 rag), prepared as described above, were run simultaneously. :Fractions (approx. 150 ~l) were collected by pumping from the bottom of the tubes. They were assayed for enzymatic activity, [35S]methionine label or protein content (A2so).

(e) Amino-terminal protein sequence determination To a 10-ml sample of the purified RepB protein from the heparin-agarose peak fraction (dialysed against 0"1 M-NH4HC03), 0"5 mg of SDS was added. The sample

249

was then lyophilized and dissolved 4 times in 0"5 ml of redistilled water to remove NH4HCO 3. Approximately 5 nmol of polypeptide was subjected to amino-terminal sequence determination in a gas-phase sequenator (Applied Biosystems). This analysis was kindly performed by Dr M. Kimura (Max-planck Institut fiir Molekulare Genetik, Berlin, F.R.G.). (f) DN A topoisomerase-like activity assays Reaction mixtures (10 to 50 #l) contained 5 to 10 nM of plasmid DNA, 3 to 900 nM of purified RepB protein and 5 to 20 mM-MnC12 in buffer A. After incubation at 37 °C for 60 min, reactions were stopped and the mixtures were electrophoresed (usually in the absence of EtBr), as described above. The time-course binding of RepB to DNA was assayed by treating the samples under the above conditions, but the gels were run in the presence of EtBr. (g) Filter-binding assays Plasmid pLS1A24 DNA (5 pg) was doubly digested with NcoI (co-ordinates 2181 and 4221 of pLS1) and ApaLI (co-ordinate 607). The resulting fragments were labelled with 17 pmol of [a-32p]dTTP (3000 Ci/mmol) and 6 units of Pol I K (final volume, 25 #l). DNA fragments were further digested with AflII (co-ordinate 4022 of pLS1). After extraction with phenol and precipitation with ethanol, samples (60,000 cts]min) of the DNA fragments were mixed with different amounts of purified RepB in a 20 #l reaction mixture containing buffer A and 20 mM-MnC12. The mixtures were incubated at 37 °C for 15 min and filtered through nitrocellulose filters (Millipore, type HA) at 1 ml/min. Filters were washed twice with 5 ml of buffer A and the retained DNA was eluted by incubation of the filters with 1 ~-NaC1, 0"1% SDS for 10min at 65°C and 2 h at 37°C. DNA was recovered by precipitation with ethanol and analysed by electrophoresis on 5 % polyacrylamide gels and autoradiography. (h) DNase I and hydroxyl radical footprinting Plasmid pLS1A24 (20 ~g) was digested with ATaLI; 10 #g were labelled either at the 5' end with [?-32p]ATP and polynucleotide kinase (after alkaline phosphatase treatment) or at the 3' end with [a-32p]dTTP and Pol IK. Next the labelled DNA was digested with NcoI and the resulting fragments were separated on a 5% polyacrylamide gel. The 224 bp NcoI-ApaLI fragment (coordinates 4221 to 607 of pLS 1; presumably containing the plasmid ori(+ )) was eluted, precipitated with ethanol and recovered at a specific activity of l0 T cts/min per ~g. DNase I protection experiments were as described (Galas & Schmitz, 1978). The reaction mixtures (50 to 150 pl) contained 0"1 ng/pl of the labelled fragment in buffer A with 2 mM-MnCl 2 and RepB at concentrations ranging between 0"02 and 0"2 gM. Samples without RepB were used as controls. The mixtures were incubated at 37°C for 15 min, cooled at room temperature and then 0"013 to 0"1 unit of DNase I (2"7 units]p~, RNase and protease-free, Cooper Biomedical, U.S.A.) was added. Incubation was at room temperature (5 min) and reactions were stopped and treated as described (del Solar et al., 1989). Samples (6 ~1, about 20,000 cts/min) were loaded into 8 % polyacrylamide sequencing gels and run together with the sequencing chemical reactions of the same fragment (Maxam & Gilbert, 1980).

A. G. de la Campa et al.

250

Hydroxyl radical footprinting was performed as reported (Tullius & Dombroski, 1986). The labelled DNA fragment (6 ng) was bound to RepB (0"004, 0"06 and 0"6/~M) in buffer A (without ethylene glycol) and the reaction mixtures (50/~l) were incubated as described above. Cleavage of DNA was initiated by the addition of 9/~l of a mixture of reactives (Fe(II)-EDTA solution, H202 and sodium ascorbate) prepared as described (Tullius & Dombroski, 1986). The mixtures were incubated at room temperature for l0 min and reactions stopped by addition of a 15 pl solution containing 40 mM-thiourea, 1"5 M-sodium acetate (pH 6"0) and 0"7 #g tRNA//~I. The DNA was recovered by precipitation with ethanol and dissolved in 18 pl of sequencing loading buffer (Maxam & Gilbert, 1980). Samples were run as described above.

Table 1

Purification of RepB Stage of purification Crude extract Ammonium sulphate DEAE-Sephacell Heparin-agarose

Concentrated in glycerol

Total Volume protein (ml) (rag) 20 10 18 30 4-1

193 51 26"4 0"85 0"83

Total units --~ --~ 6840 3893 3927

Specific activity (units/rag) ---

260 4580 4750

t Values not determinable because of nuclease activity in the fraction.

(i) Determination of the RepB site of cleavage Plasmid pLS1A24 DNA (40/~g) was treated with RepB (500 riM) in buffer A with 20 mM-MnCl2 for 60 rain at 37°C and the sample was dialysed (to remove the MnCl2) against 10 mM-Tris-HCl (pH 7"8), 0"5 mM-EDTA. Then, SDS (0"5%) and proteinase K (1 mg/ml) were added to the DNA-RepB complex and incubated at 37 °C for 2 h. Samples were extracted with phenol, precipitated with ethanol, recovered, and digested with ApaLI and NcoI. DNA fragments were separated on a 5 % polyacrylamide gel and the 224 bp band was eluted and denatured by heating (95°C for 10 rain) and rapid cooling. Labelling of the 3' ends of this fragment was achieved by incubation of 300 pmol of 3' DNA ends, 10 nmol of [~-32p][ddATP (500 Ci/mmol) and 50 to 250 units of terminal transferase in buffer containing 140 mM-sodium caeodylate (pH 7.2), 4 mM-MgC12 and 1 mM-dithiothreitol. The reaction mixtures were incubated at 37°C for 60 min and 32p incorporation was terminated by addition of 20 mMEDTA. DNA samples were denatured by heating (95°C for 5 rain) in the presence of a 30% (v/v) dimethyl sulphoxide solution containing 0-050/o each of bromophenol blue and xylene cyanol. Samples were chilled and electrophoresed on a 2 mm thick 8% polyacrylamide, non-denaturing sequencing gel, which was run until the bromophenol blue migrated 70% of the gel. After autoradiography, single-stranded bands were identified, eluted and subjected to DNA nucleotide sequencing reactions (Maxam & Gilbert, 1980}.

(j) Computer work Search for homologies with the P.I.R. data bank resource and analysis of curvatures in DNA were done with the DNASTAR computer programs (DNASTAR, Inc., U.K.). Predictions of folding of the pLS1 or/(+) region were made with the aid of programs PCFOLD and MOLECULE, developed by M. Zucker and J . R . Thompson, respectively; they were generously provided by the authors. Soft laser densitometric scannings were performed in a LKB Uitroscan 2202 coupled to an Apple II computer. 3. Results

(a) Characteristics of RepB protein The repB gene product has been construction of various plasmids pLS21 (del Solar et al., 1989). To E. coli BL21(DE3) harbouring pLS19

identified by derived from purify RepB, was employed

(Fig. l(a)). Table 1 summarizes the different stages of purification, which was based on the expected molecular weight of RepB protein and on its nicking and closing activities. At the various stages, proteins were analysed b y polyacrylamide gel electrophoresis, staining (Fig. l(b)) and fluorography (Fig. l(c)). F r o m crude extracts, four bands were detectable with molecular weights t h a t could correspond to the p L S l - e n c o d e d truncated OrfD (35,000; Lacks et al., 1986), fl-lactamase (30,000), R e p B (24,000) and RepA (5000; del Solar et al., 1989). In the last stage, only one single polypeptide with a molecular weight corresponding to the predicted size of RepB (24,252) was observed {Fig. l(b) and (c)). The native conformation of R e p B protein was determined by its sedimentation profile in glycerol gradients, as compared to control proteins. RepB seemed to have a molecular weight of about 145,000 (Fig. 2(a)), indicating t h a t under the conditions used RepB protein appeared to be a hexamer composed of identical subunits. However, we could not analyse the native conformation of R e p B by gel filtration (Sephadex G200 or agarose) because the protein was adsorbed to those supports. This made it difficult unambiguously to assert the native configuration of RepB. Determination of the aminoterminal end of RepB (Fig. 2(b)) showed that, except for the uncertain Y8 residue, the first nine residues were identical with the DNA-derived predicted amino acid sequence beginning a t the ATG start codon a t co-ordinate 853. This ATG is not preceded b y a Shine-Dalgarno (S-D) sequence (Shine & Dalgarno, 1975) but it is located downstream from an atypical ribosome-binding site: 5'-ATTTCT-four or five nucleotides-TATA-nine or ten nucleotides-ATG (Fig. 2(b); a.r.b.s.) t h a t has been found to be functional in other S. pneumoniae genes (de la Campa et al., 1987). Interestingly, there is a second ATG codon at co-ordinate 949 (Fig. 2(b)) preceded b y a possible S - D sequence (GGAGTG, coordinate 940) which does not seem to be used in E. coli. However, this second putative start codon of R e p B could be the one used in S. pneumoniae, the utilization of the first ATG codon being an artifact due to the E. coli expression system employed. To

(o)

H

pLS211

I

I

blo

reTA repB

PT7 orf

',,i i feP o

pL5191

I.......I-I

I Ikb

I

I

(b) CE ~" 51

L

U

AS

.~-~ ~

.

i:~'

~

•

,:

'

CE

"

-

Hepor in-allarole

U

OrfD-

,

-

: ~ .'~

(=)

Heparln-~garon * . St

DI[AE

AS

DEAE

111

Bla-

~4~,~.~ Rep B -

R-,p A -

.,-., ,, ........... .. -. . . . . . . . . . .

~':,",-~.:i~'.~...~.i.~:l('~,-. ..;:.."'~..~-" ::.~ " i .~ .:;/.~:j!~:.~::~-/ r .~:"

~:: . : . .

•

~.:. '.:

:

,

Figure 1. Purification of RepB protein. (a) Maps of plasmids carrying the repB gene. Plasmids are shown linearized at 1 of the 2 EcoRI sites. Only the relevant restriction sites and genes (arrows) are indicated, as well as the position of the T7 ~10 promoter (PTT)" The pET5 and pLS5 moieties of pLS21 are depicted; the map of pLS]9 and its BclI deletion (broken line) is also shown. (b) Steps of purification of RepB protein as revealed by polyaerylamide gel electrophoresis and staining. (c) Fluorography of the same gel, with the labelled pLS19 products indicated. St, standard proteins: rabbit phosphorylase b, bovine serum albumin, chicken ovalbumin, carbonic anhydrase, trypsin inhibitor and lysozyme. An E. coli BL21 (DE3) culture harbouring pLS19 was induced and labelled as indicated in Materials and Methods. CE, crude extracts prepared from [3SS]methionine-labelled (L; l/xl, 0"1/xg protein, 5000 ets/min) or unlabelled (U; 4 ~l, 38/xg protein) cultures. AS, ammonium sulphate fraction (6/d, 30 ~g protein); DEAE, pooled peak fractions from the DEAESephacell column (10/xl, 15 pg protein); Heparin-agarose, 5/xl, 10/~l and 20/xl from peak fractions of the heparinagarose column (0"03/xg protein//~g).

A. G. de la Campa et al.

252

(b)

(o) J

x

= ~

--~),' Giobuii~

= I •-~ 0 . 8 ~ 0-6

1~¢bT~ ,S A~TTATACT TT~ ~ T ~ T ~ T T • • a • ~ • • ? •

T T&crr'TATCCT J ~ I ~ T ~ T I r c c A J ~

~T--

li~e~'reA,t&c T'~4dUtCeCTT(~6Ta(~.,eA;(~-

a 04 OeoxyribonucleaseI

¢)

ICIO GC A A I " T A I IT • I S

-~ 0.2 ~

Lysozme ,

0,2

0.4

0.6

l

l

0-8

1.0

..... ..,..

Relotlve distance sedimented

(d) SV~XX~X~LLaSXS~*"VOVV~X~VZ..Y~Y Rell8

TF

RepF

ZI • •

LL

YPI[

V

J

~ A

tl L •

o

V6

S ....

P L H D K

0 ~ - -

44 •

•

-

-

----

o

D e----

V

K A N Y H V L

el *

$$6

**

"

•

R.

....

At

e

t o t - - -

F

•

Helk,meePl~) *

$0 4 •

I [ . .

*

I

m

|

¥

R I s U (21~B) p~

~e

Figure 2. Characteristics of RepB protein. (a) Native conformation of RepB determined by sedimentation in glycerol gradients (15% to 35% (v/v)). Protein standards (lysozyme, 14 kDa; DNase I, 31 kDa; bovine serum albumin, 67 kDa; and sheep 7-globin, 150 kDa) were run in parallel tubes. The position of RepB protein was determined by [35S]methionine label and by enzymatic activity. (b) Amino-terminal sequence determination of RepB protein and DNA sequence at the right end of the deletion of pLSM1AA15. The coding sequence for RepB and the predicted residues from the DNA sequence of pLS1 are shown between co-ordinates 820 and 960. Amino acid identities are indicated by an asterisk; ? indicates possibility of identity. The start ATG codon, the atypical ribosome binding site sequence (a.r.b.s.), the second potential start codon and its putative S-D sequence are also indicated. (c) Comparison of the amino-terminal region of RepB with the homologous regions of Rep proteins of pE194 (RepF) and pADB201 (ORFA); asterisks indicate residue identities; amino acid positions are indicated. (d) Possible ieucine zipper in RepB and comparison with other homologous proteins; encirc]ed, Leu repeats every 7th position; the identical residues are boxed; amino acid positions are indicated in brackets.

rule out this possibility, a series of deleted derivatives of pLS1 were constructed by Bal31-1imited digestion of pLS1 DNA linearized at the single BglI site (co-ordinate 804). Several isolates were analysed and sequenced. One of them, termed pLSMIAA15, showed a deletion including co-ordinates 760 and 853. This deletion removed the repA gene (but not the repAB promoter) and the first nucleotide of the RepB initiation codon (Fig. 2(b)). Transfer of pLSMIAA15 to a S. pneumoniae strain devoid of plasmid was unsuccessful; this plasmid could only be established in the pneumocoecal host when the replication functions were given in trans by a plasmid containing the pLS1 replicon. The above results strongly indicate that RepB is indeed translated from the first ATG codon. If a RepB* polypeptide (similar to the A* protein of ¢X174) is synthesized by pLS1, it does not seem to be sufficient for replication in vivo, as the A* protein is also insufficient (Colasanti & Denhart, 1987). Since RepB translation uses an a.r.b.s, both in E. coli and in S. pneumoniae (and likely in B. subtilis), recognition of the atypical site by ribosomes may be widespread among bacteria. It is worth mentioning that among plasmids of Gram-positive bacteria, rep genes of the pT181 family show a S-D sequence (Projan & Novick, 1988), whereas rep genes of pC194 and pE194 show neither S-D nor a.r.b.s, sequences (Horinouchi & Weisblum, 1982a,b; Villafane et al.,

1987; our observations). This genetic arrangement might indicate a way of keeping low intracellular levels of the initiator protein. However, the pneumococcal polA gene (which codifies the seemingly abundant protein DNA polymerase I) lacks a ribosomal binding site sequence (LSpez et al., 1989). RepB secondary structure predictions by a number of computer programs did not show any ~-helix-turn-~-helix motif typical of many DNAbinding proteins (Pabo & Sauer, 1984). A possible leucine "zipper" (Landschulz et al., 1988) with an array of four L residues every seventh position (residues 77, 84, 91 and 98) is observed (Fig. 2(d)). No similar hypothetical structure was found for other Gram-positive plasmid-encoded Rep proteins, in spite of the similarities between RepB and other initiator proteins (Bergemann et al., 1989; Fig. 2(c)). However, RepU from plasmid p U B l l 0 and RecF proteins did show three L residues every seventh position {Fig. 2(d)) and a leucine "zipper" seems to exist in the Rep protein of plasmid pPS10 from Pseudomonas (R. Giraldo & R. Diaz, personal communication). None of those features has been observed for Rep proteins of the plasmid pT181 family. The l~epB-predicted isoelectric point is 8.81 due to its 32 strongly basic residues, 25 of them being K (12°/o of the protein). Similarities between RepB and other postulated plasmid Rep proteins have been reported (RepF of pE194: Minton et al.,

Initiation of Replication of Plasmid pLS1 1988; ORFA of pADB201: Bergemann et al., 1989). We have found that the more significant similarities are three well-defined blocks at the amino-terminal ends of the Rep proteins, which could be ascribed to regions of functional relevance (Fig. 2(c)). This would agree with the observation that the carboxylterminal region of RepF is dispensable for replication (Villafane et al., 1987). In addition to those, a search for homologies of RepB against the whole P.I.R. data bank gave the highest, albeit modest (about 20~/o identities), scores to protein P3 of bacteriophage ¢29 and to the replication protein of phage T4, both involved in the initiation of replication (not shown). Weaker homologies were observed with other Rep proteins from Gram-positive plasmids and no significant homologies were detected between RepB and the initiator proteins of singlestranded coliphages (¢X174, M13 or G4). (b) Topoisomerase-like activity of RepB

In vitro replication of exogenously added pLS1 or pLS5 DNA in cell-free extracts of E. coli is severely inhibited by rifampicin (del Solar et al., 1987b). However, we have observed no significant inhibition by the drug when the extracts are prepared from pLSl-containing cultures (G. H. del Solar & M. Espinosa, unpublished results). This finding indicates that the role of the host RNA polymerase is exerted on the expression of plasmid-coded proteins rather than on replication through synthesis of an RNA primer. Replication of bacteriophage ¢X174 (Kornberg, 1980) and of plasmid pT181 DNAs (Koepsel et al., 1985b) does not require an RNA primer and proceeds via the rolling circle mechanism. Furthermore, RepC of pT181 has nicking and closing activities, similar to that of DNA topoisomerase I (Koepsel et al., 1985a). Thus, it was logical to assume that RepB would also have a nicking-closing activity demonstrable by relaxation of superhelical DNA through the generation of a transient nick. To perform these assays, we made use of plasmid pLS1A24 because its deletion right endpoint (including co-ordinate 401) is the closest to the left end of the origin we have isolated so far. Plasmid pLS1A24 DNA was incubated with varying amouhts of purified RepB protein and the products were analysed by gel eleetrophoresis in the absence of EtBr (Fig. 3(a)). The results showed that the supercoiled monomeric forms of the plasmid were converted to relaxed circular forms and to a variety of products with different degrees of superhelicity. At the highest RepB concentration, more than 90 ~/o of supercoiled pLS1A24 DNA was converted to relaxed circular forms and topoisomers. Analysis of the reaction products by two-dimensional gel electrophoresis in the presence of chloroquine (Lockshon & Morris, 1983) showed the presence of positive supercoiis (about 50~/o) and a distribution of topoisomers having one to ten superhelical turns (not shown). The appearance of a mixture of negative and positive topoisomers in the presence of chloroquine indicates that the reaction products

253

generated by RepB have (on average) less negative superhelical turns than has the RepB-untreated plasmid. Such a distribution of topoisomers is characteristic of nicking-closing enzymes (Gellert, 1981). The topoisomerase-like activity of RepB was dependent on the presence of Mn 2+ in the reaction, its optimal concentration being 20 mM (Fig. 3(a)). Other divalent cations such as Mg2+, Ca 2+ and Z n 2+ were ineffective (not shown). A time-course experiment was performed by incubating pLS1A24 DNA with purified RepB protein and by collecting samples at various times. The reaction products were analysed by gel electrophoresis in the presence of EtBr. It appeared that about 50~o of the plasmid supercoiled monomers were converted into relaxed circles after 30 minutes of incubation with RepB (Fig. 3(b)). From the above experiments, it seems that pLSl-encoded RepB protein, as RepC of pT181, has both single-stranded endonuclease and ligation activities. To demonstrate that RepB is the initiator of replication protein of pLS1, the specificity of RepB protein for plasmid DNA was assayed. We first treated various plasmid DNAs (unrelated to pLS1) with purified RepB protein. Plasmids used were: the E. coli plasmids pKN182 (R1 replicon) and pBR322 (ColE 1 replicon); the Staphylococcus aureus plasmids pT181 and pC194, and, as a control, plasmid pLS1A24. As expected, only pLS1A24 DNA was relaxed by RepB protein (Fig. 3(c)), indicating that the protein recognizes only its own target DNA. However, it could be argued that these replicons are too phylogenetieally distant from pLS1, because it has been reported that the RepC protein of pTl81 is able to relax in vitro supercoiled DNA of the closely related plasmid pC221 but not of unrelated plasmids (Projan & Noviek, 1988). Since it has been proposed that pLS1 and pE194 should be classified as belonging to the same family on the basis of the homology between RepF and RepB (Minton et al., 1988), we tested the nicking of pEl94 DNA by RepB protein. No relaxation of pE194 DNA was observed, even at very high RepB concentrations (not shown). Thus, in spite of the homology between the ori(+) of both plasmids (see Discussion and Fig. 8), it seems that other requirements may be necessary for ori(+) recognition by RepB. The specificity of RepB protein for ori(+) of pLS1 was also tested by the use of pBR322-based plasmids in which origin-containing sequences of pLS1 have been cloned in two orientations. To this end, plasmids pBAG3 and pBAG4, carrying the 467 bp PstI-BglI fragment of pLS5 (co-ordinates 5 to 804 of pLS1) were incubated with RepB protein. As a control, plasmid pBAG1 DNA was employed. Analysis of the reaction products clearly showed that plasmid DNAs containing pLSl-ori(+) sequences were specifically relaxed by RepB, independently of the orientation of the cloned DNA (Fig. 3(d)). The same specific nicking by RepB was observed when the "passenger" pLS1 DNA was reduced to 270 bp, by cloning into pBAGI the small pLS5 PstI-ApaLI fragment (not shown). We may

CCC --

RC--,

0

L

3

5

I0

30

50

[Rep B] (riM) I00

(a)

300

500

9 0 0 ! MN

15

Fig. 3.

I0

20 i

[MnCl2] (raM)

--2.2

--2.8 --Z.7

-3.1

--3,8

4-Z

--8.3

--:'1.3

;CC' I RC

OC-m

0-5

!

eJmmm,

D

2

:b)

m

tO 3 0 6 0 M

m~:=

5

.

I

Mlm

m

i

1.3

[.3

l.5

!.2

:'7

.3

°

-

H

pKNI82 r_ +-1

tc)

pTISl r_ +-I

pBR322 pLSI/~ 24 pCI94 r_ +--1 r_ ~ ~ ["'p"](..)

(a)

pBA61 pBAG3 pBAG4 'o 30 co' 'o 3o co' 'o 30 co' .

6.0

-2-8

-3.1

-3-8

-4.8

-

- 8.3

- 21.3

Figure 3. Nicking and closing activities of RepB protein. (a) Effect of increasing amounts of RepB and requirement of Mn 2 + for enzymatic activity. Plasmid pLS1A24 (6 nM) was incubated with RepB at the indicated concentrations in the presence of 20 mra-MnCI 2 or with 50 nm-RepB and various concentrations of MnCl 2. (b) Time-course (in min) relaxation of plasmid pLSIA24 (6 nM) by RepB (100 nM). (c) Substrate specificity of RepB on supercoiled forms of various plasmid DNAs (0"56/ag); the reaction mixtures were incubated (+) or not ( - ) with RepB protein (500 nra). (d) Specificity of the nicking-closing activities of RepB protein (at the indicated concentrations) on cloned pLSI ori( + ) ',plasmids pBAG3 and pBAG4). All gels, except in (b) were run in the absence of EtBr. OC, relaxed open circles; CCC, covalently closed; RC, relaxed circular plasmid forms. ~tandards used were prepared from phage T7 DNA digested with MboI (M) or with HpaII (H), and the sizes of some of the generated fragments (in 103 base-pairs) are indicated.

2"1"

2"2-

2"4-

2"11 " 2"7"

3wl o

3"11"

4°2 -

6"0"

8"3

~1"3

"

256

A. G. de la Campa et al.

conclude that foreign sequences surrounding the plasmid ori(+) and/or overall G + C content of plasmid DNA do not affect RepB recognition of its target.

o

~

I

I

I

i

!

(c) Interactions between RepB and pLS1 ori( + ) The specificity of binding of RepB to the ori(+) region of pLS1 was tested by analysis of the DNA-RepB complexes retained on nitrocellulose filters. We have delimited the ori(+) of pLS1 to a 284 bp region from co-ordinate 401 (right end of the deletion of pLS1A24) to co-ordinate 685 (right end of the HinfID fragment; Puyet et al., 1988). Plasmid pLS1A24 DNA was digested with NcoI and ApaLI and the resulting three fragments were labelled at their 3' ends. They were further digested with Af/II to reduce the 2040 bp NcoI fragment A to fragments of 1841 and 199 bp. The latter fragment is contiguous to the 224 bp NcoI-ApaLI fragment, which presumably contained the plasmid ori(+) (Fig. 4(a)). DNA samples were incubated without any, or with two concentrations of purified RepB protein, filtered and the retained fragments analysed by polyacrylamide gel electrophoresis. Results (Fig. 4(b)) showed that the 224 bp NcoI-ApaLI fragment was retained and that the amount of DNA retained depended on the amount of RepB protein used. In addition, a partially digested 423 bp fragment (AflII-ApaLI) was also retained by RepB. Similar results were obtained when the DNA was digested with other enzymes or when Mn ~+ was omitted from the incubation buffer (not shown). The results indicate that RepB protein specifically binds to DNA sequences within the ori(+) of pLS1 and that the binding (but not the nicking) ability of RepB is independent of divalent cations. To determine the exact binding site(s) of RepB protein within the origin, DNase I and Fe(EDTA)hydroxyl radical footprinting experiments were performed. Plasmid pLS1A24 DNA was linearized with ApaLI, labelled at the 5' or at the 3' ends and further digested with NcoI. Consequently, the origin-containing 224 bp NcoI-ApaLI fragments had either the coding or the non-coding strand labelled at one end. Discrimination between the interaction of RepB protein with one or the other strand was important because we have shown that the coding strand is the one that is rendered singlestranded upon pLS1 replication (Puyet et al., 1988). The desired DNA fragments were purified, treated with RepB protein and subjected to partial digestion with DNase I or to attack with hydroxyl radical. RepB-untreated DNA samples were used as controls. The results are shown in Figure 5. For the coding strand, it was apparent that RepB protected three or four regions from the DNase I digestion. The results for the non-coding strand showed a similar pattern, but a displacement of three to four bases was seen. The protected regions were bounded by residues showing enhanced cleavage, although the pattern is too complex to define the footprints

o~

~

(o)

--

'~' II

l~

orl(+) i

(b)

Ikb

[Rep 8] (aM)

I

0

,~ i:'" " - .

~

iO0

160

•

1841

i

1574

....,/-

--

423

gii-''

:~:

~

199

Figure 4. Specificity of binding of RepB protein to pLS1 regions containing the plasmid ori(+) assayed by filter binding. (a) Schematic map of pLS1A24 showing the positions of the restriction enzymes used. (b) Retention of DNA-RepB complexes on nitrocellulose filters. Labelled pLS1A24 DNA fragments were incubated or not with 2 amounts of RepB and filtered. The DNA retained was analysed by electrophoresis in polyacrylamide gel and aut~radiography. Lane I, Control sample, unfiltered input DNA. The sizes of the fragments are indicated on the right. Note that the 423 bp retained fragment results from a partial digestion by AflII.

- -

580-

570 -

5 6 0 --

550 -

540

- -

o

~)

o

0

to

o.

0

o

0

~

o

~0

o

0

OH*

o

~)

•

I4(..) ¢..) 4-

I÷

.~ 0

0

0

0

~ L n ~ .o o. o

DNose I

0

mO .

klan-coding strand

0

~o o.

OH"

0

I D

0

0

0

0

strand

strand

0

Non-coding

Coding

F i g u r e 5. DNase I and hydroxyl radical footprints of RepB bound to the pLS1 ori( + ). Plasmid pLS1A24 was digested with ApaLI, 5' or 3' end-labelled and digested with NcoI. The origin-containing 224 bp fragment was incubated without any, or with, RepB (indicated amounts in ~M). The D N A - R e p B mixtures were subjected to limited digestion with DNase I or to hydroxyl radical attack. The products were run in a sequencing get together with the sequencing reactions of the same DNA fragments. Filled trrows indicate the 3 iterons (I1 to I3) and the hatched arrow indicates a partially homologous repeat. Numbers on the left refer to co-ordinates of pLS1. On the right, the DNase I reactions were run for longer times to show regions not affected by the binding of RepB.

13

[2

I1

530

0

)Nose I

Coding strand

A. O. de la Campa et al.

258

Codin9

Non-coding

-Rep B

-Rep B

+RepB

I

Figure 6. Densitometer scans of autoradiographs (from Fig. 5) showing the hydroxyl radical cleavage patterns of DNA fragments complexed or not with RepB at a concentration of 0"6 ~M.

precisely. To check if more sequences were affected by RepB, DNase I reaction products were analysed either by longer electrophoresis {Fig. 5, right panel} or by labelling the fragment at the NcoI site (not shown). No further protected regions were detected. From the hydroxyl radical footprinting it could be seen that the same regions were protected by RepB, although the largest DNase I footprint was divided into three {Fig. 5). From the above results we may conclude that RepB contacts regions in both strands of pLS1 DNA, spanning at most from coordinate 530 to 587. Within this region, the plasmid three 11 bp iterons (I1 to I3): 5'-CGGCGACTTTT-3' {co-ordinates 534 to 566} are located (Fig. 5, filled arrows}. A fourth imperfect iteron (5'-TAGAGATTTTT-3') follows immediately and constitutes the second footprint {Fig. 5, broken arrow). It is worth noting that the target of the pLSl-encoded repressor RepA {co-ordinate 581 to 628: del Solar et al., 1989) overlaps the first region protected by RepB (co-ordinates 583 to 587}. Whether this overlapping has any involvement in the regulation of pLS1 replication is not known at present. Densitometer scans of lanes without any, or with the highest concentration of RepB from hydroxyl radical reactions showed the presence of four footprints which were more apparent in the coding strand (Fig. 6). The first footprint is dubious because it is also observable (although less intense) in RepBuntreated samples. Discrimination of bands was not possible in upper regions of the gel. In the noncoding strand without RepB, it seemed that a set of five high cut bases followed by another set of five less cleaved bases was repeated. This sinusoidal cleavage pattern is typical of curved DNA (Burkhoff & Tullius, 1987). The origin-containing

224 bp NcoI-AloaLI fragment is intrinsically curved as judged from its temperature-dependent anomalous electrophoretic mobility on polyacrylamide gels (not shown), confirming our previous results on DNA curving in this region of pLS1 (P~rez-Mart/n et al., 1988). (d) Site of cleavage of pLS1 by RepB During replication of pLS1, single-stranded molecules are generated, probably due to specific binding of RepB to pLS1 ori(+) sequences followed by nicking of plasmid DNA and strand displacement during replication (del Solar et al., 1987a). To test the ability of purified RepB protein to cleave the pLS1 region to which it binds, plasmid pCGA3 was employed. This plasmid contains the pC194cop replicon {Ballester et al., 1990) in which the pLS1 AluI-BglI fragment (co-ordinates 505 to 804) has been cloned (del Solar et al., 1989}. The cloned fragment contains the region protected by RepB as determined by the above footprinting experiments. Relaxation experiments performed with pCAG3 showed that RepB protein failed to relax the plasmid DNA, although the protein was specifically bound to the cloned fragment (not shown). This finding suggested to us that sequences outside the RepB-binding region might be important for the nicking activity of the protein. Determination of the RepB site of cleavage was as follows: plasmid pLSIA24 DNA was relaxed with RepB protein {under conditions in which about 50 ~o of the DNA was nicked) and then digested with NcoI and ApaLI. The 224 bp fragment contains the plasmid ori( + ) {Fig. 4(a)), and should consist of a mixture of nicked and intact DNA molecules. The fragment

Initiation of Replication of Plasmid pLS1

(a)

D

•

N

3

2

259

,

(b)

I-2--

3--

T A T O 6 O 6 6 6 6 C T

ds--

T

'\

(d) CTA GA~ |448+44g) G-C G-C G'~ r

(c)

1404~ 3. GGGGGATTTTTTCTCCGAA&AAATCTAAAAT-AGTGGCGAGTGCCAA&&TCA CACGGCTCACGGTTTTAGT Hlckln 9 site

(4)

~

3';YT']-~llllll(~illll]l"s

(I)

3' ,

f-AA&AAAAACGeCC T T ¥ &GCCTe TAG&GC TGCtAAGGGT TTGAeOGCTCG T CAA ~ T T T T T TTTGCG6 AAAT CO OAAT C TCGAC~ T T CCCAAAC TC CGAGCAG T T T

(2i

I

~'.LIIlII]II]IIIlI]IIII'~:, Itl Q

I I

•

O11

l

I

•

I

..o..,,,+u,..,,,m:,,.,,,,t+u+,,..?:r.7.... I

I

+AAAAA C ttt 4111

r A C G A A A A & G £ 1 T TO

t I ,~+ oc, r I t I T £ T A A C

5 ' I flOOl

J

Figure 7. Determination of the RepB nicking site. (a) Plasmid pLS1A24 DNA was treated with RepB, digested with NcoI and ApaLI and the or/(+ )-containing 224 bp fragment was purified and 3' end-labelled with terminal transferase. DNA was denatured (D) and the bands were separated on a polyacrylamide non-denaturing sequencing gel. As a control, a native DNA fragment (N) was run, which allowed the identification of the RepB-uncleaved double-stranded DNA. (b) The bands were eluted and subjected to the Maxam & Gilbert (1980) chemical reactions, which allowed the identification of the bands. (c) Scheme of the identification of the nicked DNA strand; an asterisk indicates the position of labelling. (d) DNA sequence of the ori( + ) region of plasmid pLS1 from co-ordinates 400 to 600. For clarity, both DNA strands are shown only after hairpin I. The right endpoint of the deletion in pLS1A24 is indicated. The arrow points to the RepB nicking site, located on the loop of hairpin I. The bases protected by RepB, as determined by DNase I (bracketed) and by hydroxyl radical (0) footprintings are indicated in both strands. The 3 iterons and the 4 partially homologous sequences .are underlined. was purified, denatured and 3' end-labelled with terminal transferase. Analysis of the polyacrylamide gels showed five bands, one of which migrated with a mobility corresponding to the native fragment (Fig. 7(a)). The remaining four fragments were separated, purified and identified by determination of their nucleotide sequence (Fig. 7(b)). Bands 3 and 4 were generated by cleavage of band 2 by RepB. Band 1 corresponds to the complementary strand of band 2, the one not nicked by RepB (Fig. 7(c)). Analysis of the nucleotide sequence showed that the cleavage site generated by RepB protein occurs between nucleotides 448 and 449 (G/A) of the pLS1 coding strand. No nucleotides were removed from the nick site by RepB, indicating that RepB only introduces a single-stranded nick on the plasmid DNA. We conclude that the cleavage site of RepB is located on the loop of hairpin I, 86 bp upstream from the first nucleotide of the iteron I1 (Fig. 7(d)).

This finding explains the inability of RepB protein to relax plasmid pCGA3 DNA, because it lacks hairpin I. A summary of the footprinting experiments and the location of the binding and nicking sites of RepB protein in pLS1 is depicted in Figure 7(d).

4. D i s c u s s i o n

We report on the characterization of RepB, the Rep protein of the streptococcal plasmid pLS1. We also show that, unlike other Rep proteins of Grampositive plasmids (Koepsel et al., 1985a, 1986) or those of single-stranded DNA coliphages (see Baas, 1985), RepB acts at a distance (Fig. 7). The nicking site of RepB falls into the G/A class that includes phage ~bX174 (Langeveld et al., 1978) and likely pC194 (Gros et al., 1987 and references cited therin),

A. G. de la Campa et al.

260

The homology between these three plasmids is striking, taking into account that they were isolated from different hosts and in different continents (pE194 from S. aureus in Europe by Iordanescu (1976); pMV158 (from which pLS1 derives) from S. agalactiae, in America by Burdett (1980) and pADB201 from Mycoplasma mycoides in Australia by Bergemann & Finch (1988)). The RepB protein of plasmid pLS1 binds to and nicks at two distant DNA regions. Replication through rolling circle requires the Rep protein firstly to recognize and to bind to specific sequences and, secondly, to introduce a strand and sitespecific nick in a contiguous DNA region (Greenstein & Horiuchi, 1987). The vicinity of both binding and nicking DNA regions seems to be general for single-stranded coliphages (see Baas, 1985). The same applies for plasmid pT181, since RepB protein specifically binds to a 32 bp sequence in which its nicking site is included (Koepsel et al., 1985a, 1986). To our knowledge, RepB protein is the first instance of a Rep protein involved in rolling circle replication that acts at a distance from its binding site. Since RepB binds to the plasmid iterons I1 to I3 (Fig. 5) and nicks at hairpin I, 86 bp upstream (Fig. 7), generation of secondary structures in superhelical plasmid DNA must be important for the initiation of pLS1 replication mediated by RepB. In this sense, we have observed that superhelicity is an absolute requirement for in vitro replication of pLS1 (del Solar et al., 1987b). In addition, the analyses of the in vitro replication products from pLS1, showed that plasmid replication was strongly inhibited by the DNA gyrase inhibitor, novobiocin (del Solar et al., 1987b). This inhibition seems to be independent of whether the extracts are prepared from plasmid-free or from plasmid-containing cultures (G. H. del Solar & M. Espinosa, unpublished results), suggesting that supercoiling of the template DNA is essential for pLS1 replication. This is not the case for the in vitro replication system of pT181, in which novobiocin only has a slight influence on plasmid replication (Khan et al., 1981). However, secondary structures (and hence, supercoiling) seem to be needed for the recognition of RepC for its target in vivo (Gennaro et

as opposed to the T/A class shown for the pTl81 family or phage M13 (KoepseI et al., 1985a; Meyer et al., 1979). However, we have neither observed significant homology surrounding the nicking region of RepB and those of the above mentioned replicons nor have we found homology between RepB and their Rep proteins. It has been reported that two closely related plasmid Rep proteins, RepC (of pT181) and RepD (of pC221), show strict recognition requirements in the sense that they do not cross-complement in vivo, although they are able to cross-initiate replication in vitro (Projan & Novick, 1988). RepB protein specifically nicked pLS1 DNA {Fig. 3(c)) even when the plasmid ori( + ) was surrounded by foreign DNA with a different G + C content (Fig. 3(d)). In spite of the homology between RepB and RepF proteins (Fig. 2(c)), RepB was incapable of nicking pE194 DNA, perhaps due to insufficient homology between both proteins and/or because of the different physical structure of the ori(÷) of pLS1 and pE194 (see below). The or/(+) of pLS1 is located in an intergenic region, which is not the case for the pT181 family (Koepsel et al., 1985a; Thomas et al., 1988) nor seemingly was it for pE194 (Villafane et al., 1987). However, while the manuscript was being written, a correction in the location of the pE194 or/(+) placed it upstream from the repF gene (Dempsey & Dubnau, 1989). Analysis of the nucleotide sequence of this region in pla~mid pE194 (Horinouchi & Weisblum, 1982a; Dempsey & Dubnau, 1989) and the sequence of plasmid pADB201 (from co-ordinates 1 to 200; Bergemann et al., 1989) showed a highly conserved DNA sequence with pLS1 (Fig. 8). We predict that the nick site of pE194 and of pADB201 is between the G/A conserved in the three plasmids (Fig. 8). Immediately downstream from this conserved region, three non-homologous 7 bp or 21 bp iterons exist in pE194 (Dempsey & Dubnau, 1989) and in pADB201 (Bergemann et al., 1989), respectively. Perhaps the sequence-recognition specificity of the three Rep proteins is different because of the different DNA sequences of the iterons. No spacing between the putative nicking sites of pE194 and pADB201 and their iterons exists, which is not the case for pLS1.

pEI94 (840,930)

TTCTTAGATTTTTGGGGTTATTTAGGGGAGAAAACATA

pLSI (400,470) pADB20I (40,119)

TGGGGGATTTTTTCTCCGAAAAAATCTAAAATATGG TCACTAGATTAATGGGGTCACGACC . . . . . . . . . . . .

A. . . . . . . . . .

pE194

GGGGGGTACTACG;ACCTCCCCCCTAG -GT GTCCATT GT-C C A TTGTC C --A A A C A A A

pLS 1

GGGGGCTACTACGI,ACCCC CC CTATA GT G - - - CCGA-GTG CCAAAATCAAAAAAAAAA

pADB2OI

GGGGGCTAC TACG ATAGC CCCCAATGAGTGAT--TTGTGACATGTGACG . . . . .

•I(--X--IH(--'/:

-X-'IF.I(-.I(.-It.K-,X,I~/,-*.K-

'k'It'X"K"I(-'I(-'Ie"X'-'X-'IH$'I("I$1*

.l(,.l(.-It,K-'X-*il,-K-

"l(.,l(--'h 4(-

~

-~ 4(-

~.~

*~ -X-.I(-~

-It-I(-*

.X--X-

.X-.k',.l$

454(-

'I(.~-'X.I(.~.)(.

AAA

Figure 8. DNA sequence comparison of the or/(+) regions of plasmid pLS1, pE194 and the one of pADB201 proposed here. Co-ordinates are from Lacks et al. (1986) for pLS1; from Horinouchi & Weisblum (1982a) with the corrections made by Villafane et al. (1987) for pE194; and from Bergemann et al. (1989) for pADB201. Nucleotide identities are indicated by asterisks and the arrow and broken line indicate the RepB nicking site.

Initiation of Replication of Plasmid p L S 1

261

XZ Plane \

~

~

s"~e

13" 5" x

(o)

(b)

Figure 9. Models to explain the action of RepB at a distance, based on 2 possible secondary structures of the pLS1 ori( ÷ ) from co-ordinates 401 to 566, as predicted from computer programs. (a) Sequence-directed curvature of doublestranded DNA as predicted by program BEND showing how curving would approach the iterons to the RepB nicking site. The small square indicates co-ordinate 401. (b) Drawing of the computer output of programs PCFOLD and MOLECULE showing the most probable DNA folding in this region. This intrastrand pairing would also place hairpin I (RepB nicking site; arrow) and the 3 iterons (RepB binding region; heavy lines) close together.

al., 1989), and RepD protein of the cognate plasmid pC221 nicks at the top of a potential stem-loop structure (Thomas et al., 1987). For other staphylococcal plasmids like pC194, it has been proposed that formation of hairpins at the plasmid ori(+) may be important for origin activity (Gros et al., 1987), and yet no secondary structures are required for RepU origin recognition in the closely related plasmid p U B l l 0 (Alonso et al., 1988). In the case of pLS1, we have detected an Sl-sensitive site that maps at around co-ordinate 450, coinciding with hairpin I (Puyet et al., 1988), on which the nicking site of RepB is located (Fig. 7). How could we explain ' the action of RepB at a distance? We have proposed that hairpins I and II and iterons I1 to I3, belong to the pLS1 ori(+) (Puyet et al., 1988). In addition, we have observed a complex sequence-directed curvature at a plasmid locus that includes the repAB promoter, the iterons and upstream sequences at around co-ordinate 472 (P~rez-Martin et al., 1988). Taking all our observations together, we could envisage a very complex structure at the pLS1 ori(+ ), based on the existence of either a sequence-directed curvature at this region and]or a DNA folding that would generate a superstructure. Prediction of sequence-directed DNA curving at the pLS1 ori( + ), from co-ordinates 401 {right end of the deletion in pLS1A24) to 566 (last base of I3), showed that a curved structure could exist (Fig. 9(a)). Prediction of DNA folding from the same co-ordinates showed the most favourable structure, schematized in Figure 9(b). At present we cannot discriminate which of these structures would be more likely to be formed. Be t h a t a s it may, both of the predicted tertiary structures of the pLS1 ori(+) would place the I l - I 3 region and hairpin I close together. I f one of such structures exists, RepB would bind to the three iterons and, due to the vicinity of hairpin I, the subsequent nicking of the plasmid ori(+) would be facilitated.

Whether this DNA region wraps around RepB or if RepB physically occupies the "pocket" left by the folding of the ori( + ) is a question not yet answered. Thanks are due to J. P~rez-Martfn and P. L6pez for critical readin6of the manuscript and helpful discussions. We thank M. Kimura for determining the amino-terminal sequence of RepB. The technical assistance of M. T. Alda, the artwork by A. Hurtado and J. C. Fern£ndez and the corrections made in the manuscript (to remove "continental" English) by Wendy M. Newton are fully acknowledged. The research was supported by CICYT, grant BI088-0449.

References

Alonso, J. C., Leonhardt, H. & Stiege, C. (1988). Nucl. Acids Res. 16, 9127-9145. Baas, P. D. (1985). Biochim. Biophys. Acta, 825, 111-139 Ballester, S., LSpez, P., Alonso, J. C., Espinosa, M. & Lacks, S. A. {1986). Gene, 41, 153-163. Ballester, S., Alonso, J. C., LSpez, P. & Espinosa, M. (1990). Gene, 86, 71-79. Bergemann, A. D. & Finch, L. R. (1988). Plasmid, 19, 68-70. Bergemann, A. D., Whitley, J. C. & Finch, L. R. (1989). J. Bacter/ol. 171,593-595. Bolivar, F., Rodriguez, R. L., Greene, P. J., Betlach, M. C., Heybacker, H. L., Boyer, H. W., Crose, J. H. & Falkow, S. (1977}. Gene, 2, 95-113. Burdett, V. (1980). Antimicrob. Ag. Chemother. 18, 753-760. Burkhoff, A. M. & Tullius, T. D. (1987). Cell, 48, 935-943. Colasanti, J. & Denhart, D. T. (1987). J. Moi. Biol. 197, 47-54. del Solar, G. H., Puyet, A. & Espinosa, M. (1987a). Nucl. Acids Res. 15, 5561-5580. del Solar, G. H., Diaz, R. & Espinosa, M. (1987b). Mol. Gen. Genet. 206, 428-435. del Solar, G. H., de la Campa, A. G., P4rez-Martin, J., Choli, T. & Espinosa, M. (1989). Nud. Acids Res. 17, 2405-2420.

262

A. G. de la Campa et al.

de la Campa, A. G., Kale, P., Springhorn, S. S. & Lacks, S. A. (1987). J. Mol. Biol. 196, 457-469. Dempsey, L. A. & Dubnau, D. A. (1989). J. Bacteriol. 171, 2866-2869. Galas, D. J. & Schmitz, A. (1978). Nucl. Acids Res. 5, 3157-3170. Gellert, M. (1981). Annu. Rev. Biochem. 50, 879-910. Gennaro, M. L., Iordanescu, S., Novick, R. P., Murray, R. W., Steck, T. R. & Khan, S. (1989). J. Mol. Biol. 205, 355-362. Greenstein, D. & Horiuchi, K. (1987). J. Mol. Biol. 197, 157-174. Gros, M. F., te Riele, H. & Ehrlich, S. D. (1987). EMBO J. 6, 3863-3869. Gruss, A. D., Ross, H. F. & Novick, R. P. (1987). Proc. Nat. Acad. Sci., U.S.A. 84, 2165-2169. Horinouchi, S. & Weisblum, B. (1982a). J. Bacteriol. 150, 804-814. Horinouchi, S. & Weisblum, B. (1928b). J. Bacteriol. 150, 815-825. Iordanescu, S. {1976). Arch. Roum. Pathol. Exp. Microbiol. 35, l l l - l l 8 . Khan, S. A. & Novick, R. P. (1983). Plasmid, 10, 251-259. Khan, S. A., Carleton, S. H. & Novick, R. P. (1981). Proc. Nat. Acad. Sci., U.S.A. 78, 4902-4906. Koepsel, R. R., Murray, R. W., Rosenblum, W. D. & Khan, S. A. (1985a). Proc. Nat. Acad. Sci., U.S.A. 82, 6845-6849. Koepsel, R. R., Murray, R. W., Rosenblum, W. D. & Khan, S. A. (1985b). J. Biol. Chem. 260, 8571-8577. Koepsel, R. R., Murray, R. W. & Khan, S. A. (1986). Proc. Nat. Acad. Sci., U.S.A. 83, 5484-5488. Kornberg, A. (1980). DNA Replication, W. H. Freeman & Co., San Francisco. Lacks, S. A., LSpez, P., Greenberg, B. & Espinosa, M. (1986). J. Mol. Biol. 192, 753-765. Landschulz, W. H., Johnson, P. F. & McKnight, S. L. (1988). Science, 240, 1759-1764. Langeveld, S. A., van Mansfeld, A. D. M., Baas, P. D., Jansz, H. S., van Arkel, G. A. & Weisbeek, P . J . (1978). Nature (London), 271,417-420. Lockshon, D. & Morris, D. R. (1983). Nucl. Acids Res. 11, 2999-3017.

LSpez, P., Martlnez, S., Diaz, A., Espinosa, M. & Lacks, S. A. (1989). J. Biol. Chem. 254, 4255-4263. Maxam, A. M. & Gilbert, W. (1980). In Methods in Enzymology (Grossman, L. & Moldave, K., eds), vol. 65, pp. 499-560, Academic Press, New York. Meyer, T. F., Geider, K., Kurz, C. & Schaller, H. (1979). Nature (London), 278, 365-367. Minton, N. P., Oultram, J. D., Brehm, J. K. & Atkinson, T. (1988). Nucl. Acids Res. 16, 3101. Molin, S. & Nordstr5m, K. (1980). J. Bacteriol. 141, 111-120. Murray, R. W., Koepsel, R. R. & Khan, S. A. {1989}. J. Biol. Chem. 254, 1051-1057. Pabo, C. O. & Sauer, R. T. (1984). Annu. Rev. Bioehem. 53, 293-321. P~rez-Martin, J., del Solar, G. H., de la Campa, A. G. & Espinosa, M. {1988). Nucl. Acids Res. 16, 9113-9126. Projan, S. J. & Novick, R. P. (1988). Plasmid, 19, 203-221. Puyet, A., del Solar, G. H. & Espinosa, M. (1988). Nucl. Acids Res. 16, 115-133. Rosenberg, A. H., Lade, B. N., Chui, D.-S., Lin, S.-W., Dunn, J . J . & Studier, F . W . (1987). Gene, 56, 125-135. Scott, J. R. (1984). Microbiol. Rev. 48, 1-23. Shine, J. & Dalgarno, L. (1975). Nature (London), 254, 34-38. Studier F. W. & Moffat, B. A. (1986). J. Mol. Biol. 189, 113-130. te Riele, H., Michel, B. & Ehrlich, S. D. (1986). EMBO J. 5, 631-637. Thomas C. D., Balson, D. F. & Shaw, W. V. (1987). Biochem. Soc. Trans. 15, 907-908. Thomas C. D., Balson, D. F. & Shaw, W. V. (1988). Biochem. Soc. Trans. 16, 758-759. Thomas. C. M. (1988). Biochim. Biophys. Acta, 949, 253-263. Tullius T. D. & Dombroski, B. A. (1986). Proc. Nat. Acad. Sci., U.S.A. 83, 5469-5473. Villafane, R., Bechhofer, D. H., Narayan, C.S. & Dubnau, D. A. (1987). J. Bacteriol. 169, 4822-4829.

Edited by R. Schleif