Inhibition of HSP90 by AUY922 Preferentially Kills Mutant KRAS Colon Cancer Cells by Activating Bim through ER Stress.

Author Manuscript Published OnlineFirst on February 1, 2016; DOI: 10.1158/1535-7163.MCT-15-0778 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Inhibition of HSP90 by AUY922 preferentially kills mutant KRAS colon cancer cells by activating Bim through ER stress

Chun Yan Wang,1,2 Su Tang Guo,1,2 Jia Yu Wang,1 Fen Liu,1 Yuan Yuan Zhang,3 Hamed Yari,1Xu Guang Yan, 1 Lei Jin,3 Xu Dong Zhang,1,4 Chen Chen Jiang3,4

1

School of Biomedical Sciences and Pharmacy, The University of Newcastle, NSW, 2308, Australia

2

Department of Molecular Biology, Shanxi Cancer Hospital and Institute, The Affiliated Cancer

Hospital of Shanxi Medical University, Shanxi 030013, China 3

School of Medicine and Public Health, The University of Newcastle, NSW, 2308, Australia

4

Correspondence: Chen Chen Jiang or Xu Dong Zhang, LS3-49, Life Sciences Building, University of

Newcastle, Callaghan, NSW, Australia. Ph: 61 2 49218906.

Fax: 61 2 49217311.

Email: [email protected] or [email protected] Running title: HSP90 inhibition kills mutant KRAS colon cancer cells

Keywords: Colon cancer, Apoptosis, Bim, Heat Shock Protein 90, AUY922 Abbreviations: ER, endoplasmic reticulum; EGFR, epidermal growth factor receptor; UPR, unfolded protein response; ATF6, activating transcription factor 6; IRE1, inositol requiring enzyme 1; PERK, RNA-activated protein kinase-like ER kinase; SKP2, S-phase kinase-associated protein 2; SMAC/DIABLO, Second mitochondria-derived activator of caspase/Direct IAP-bind protein with low pI; GRP78, glucose-regulated protein 78; XBP-1, X-box binding protein 1; MDM2, Mouse double minute 2 homolog; 4-PBA, 4-Phenylbutyric acid; CHOP, CCAAT-enhancerbinding protein homologous protein; HER2, human epidermal growth factor receptor 2; ALK, Anaplastic lymphoma kinase; STK33, Serine/threonine kinase 33.

1 Downloaded from mct.aacrjournals.org on February 5, 2016. © 2016 American Association for Cancer Research.


Disclosure of Potential Conflicts of Interest: The authors disclose no potential conflict of interest. Word Count: 5000 Total number of figures and tables: 6 figures, 13 supplementary figures, and 3 supplementary tables



Financial Information This study was supported by Cancer Council NSW, Australia (RG 15-08), which was awarded to X.D. Zhang. C.C. Jiang and L. Jin are recipients of Cancer Institute NSW Fellowships. X.D. Zhang is supported by a Senior Research Fellowship of NHMRC.



Abstract Oncogenic mutations of KRAS pose a great challenge in the treatment of colorectal cancer. Here we report that mutant KRAS colon cancer cells are nevertheless more susceptible to apoptosis induced by the heat shock protein 90 (HSP90) inhibitor AUY922 than those carrying wild-type KRAS. Although AUY922 inhibited HSP90 activity with comparable potency in colon cancer cells irrespective of their KRAS mutational statuses, those with mutant KRAS were markedly more sensitive to AUY922-induced apoptosis. This was associated with upregulation of the BH3 only proteins Bim, Bik, and PUMA. However, only Bim appeared essential, in that knockdown of Bim abolished, whereas knockdown of Bik or PUMA only moderately attenuated, apoptosis induced by AUY922. Mechanistic investigations revealed that endoplasmic reticulum (ER) stress was responsible for AUY922-induced upregulation of Bim, which was inhibited by a chemical chaperone or overexpression of GRP78. Conversely, siRNA knockdown of GRP78 or XBP-1 enhanced AUY922-induced apoptosis. Remarkably, AUY922 inhibited the growth of mutant KRAS colon cancer xenografts through activation of Bim that was similarly associated with ER stress. Taken together, these results suggest that AUY922 is a promising drug in the treatment of mutant KRAS colon cancers, and that agents that enhance the apoptosis-inducing potential of Bim may be useful to improve the therapeutic efficacy.



Introduction Colon cancer is one of the most common and deadly malignancies (1). Despite recent advances in early diagnosis and the development of molecularly targeted therapy, the overall survival of patients with metastatic colon cancers remains disappointing (1). This is often associated with resistance of colon cancer cells to systemic therapies resulting from oncogenic mutations of KRAS which drive activation of multiple signalling pathways important for cell survival and proliferation (2). In fact, activating mutations of KRAS are found in up to 50% of colon cancers that forecast inherited resistance to antibodies against the epidermal growth factor receptor (EGFR) (2, 3). HSP90 is the most abundant molecular chaperone and is essential for folding, stabilization, and activation of a large number of proteins (4). In particular, many mutant and overexpressed oncoproteins such as EGFR, mutant BRAF, and Akt are clients of HSP90 (4). As such, targeting HSP90 appears a promising approach in the treatment of cancer (4). Intriguingly, mutant KRASdriven cancer cells have been noted to be sensitive to HSP90 inhibition (5-7), but the molecular mechanisms involved remain poorly understood. Nevertheless, multiple HSP90 inhibitors are currently in clinical studies for the treatment of cancer (4). Induction of apoptosis is a common mechanism by which therapeutic drugs kill cancer cells (8). This is frequently mediated by activation of the mitochondrial apoptotic pathway, which is regulated by the balance between pro- and anti-apoptotic Bcl-2 family proteins (8). Of note, multiple Bcl-2 family proteins are responsive to inhibition of HSP90 in a cell type and context-dependent manner (9-12). In particular, p53-dependent induction of the BH3-only protein PUMA has been shown to be responsible for apoptosis of colon cancer cells induced by the HSP90 inhibitor 17-AAG (10). Moreover, the antiapoptotic Bcl-2 family proteins, Bcl-2, Mcl-1, and Bcl-XL have all been reported to protect cells against HSP90 inhibition-induced apoptosis (9, 11-13). Another frequently observed consequence of HSP90 inhibition is endoplasmic reticulum (ER) stress, which is characterized by accumulation of unfolded and/or misfolded proteins in the ER lumen. The ER responds to ER stress by activation of a range of signaling pathways, collectively called the ER



stress response or the unfolded protein response (UPR) (14, 15). The UPR is initiated by three ER transmembrane proteins, activating transcription factor 6 (ATF6), inositol requiring enzyme 1 (IRE1), and double-stranded RNA-activated protein kinase-like ER kinase (PERK), and is essentially a cellular protective response. However, excessive UPR kills cells primarily by induction of apoptosis (14-16). Multiple mechanisms such as activation of the BH3 only proteins Bim, PUMA, and Noxa, and downregulation of anti-apoptotic Bcl-2 family proteins including Bcl-2 and Mcl-1 have been implicated in ER stress-induced apoptosis (17-19). We have examined the potency of the HSP90 inhibitor AUY922 in colon cancer cells with different mutational statuses of KRAS. We show here that AUY922 preferentially induces apoptosis in mutant compared with wild-type KRAS colon cancer cells, and that activation of Bim through ER stress is responsible for apoptosis triggered by AUY922. In addition, we demonstrate that AUY922 inhibits the growth of mutant KRAS colon cancer xenografts similarly through Bim-mediated apoptosis that is associated with ER stress.



Materials and Methods Cell culture Human colon cancer cell lines provided by Professor Gordon Burns (Faculty of Health and Medicine, University of Newcastle, Australia) were described previously (20). The normal human colon epithelial cell line FHC (ATCC® CRL-1831TM) was from ATCC, and cultured as described previously (20). Individual cell line authentication was regularly confirmed every 6 months using the AmpFISTR Identifier PCR Amplification Kit from Applied Biosystems (Mulgrave, VIC, Australia) and GeneMarker V1.91 software (SoftGenetics LLC, State College, PA). The last test was done in May 2015. Three dimensional (3D) culture 3D culture was performed using the hanging drop technique as previously described (21). Briefly, 500 cells were seeded into the Perfecta3D® hanging drop plate (3D Biomatrix, Ann Arbor, MI), and monitored with the Axiovert and Axioplan microscope (Carl Zeiss, North Ryde, NSW, Australia) for at least 5 days. Cells were then stained with calcein AM and ethidium homodimer-1 (Life Technologies, Scoresby, VIC, Australia) for 24h followed by treatment. Spheroids were harvested onto slides, and examined with a fluorescence microscope (Carl Zeiss). Antibodies (Abs) and reagents Abs and reagents used are listed in Supplementary Tables S1 and S2. Real-time PCR qPCR was performed as described previously (17). The relative abundance of target mRNA in control group was arbitrarily designated as 1. The primes are forward primers for Bim (GCCCCTACCTCCCTACAGAC), Bcl-2 (CTGCACCTGACGCCCTTCACC), Spliced XBP-1 (GCACCTGAGCCCCGAGGAGA), XBP-1 (AGCCAAGGGGAATGAAGTGAG), or β-actin (GGCACCCAGCACAATGAAG); reverse primers for Bim (ATGGTGGTGGCCATACAAAT), Bcl-



2 (CACATGACCCCACCGAACTCAAAGA). Spliced XBP-1 (TCATTCCCCTTGGCTTCCGCC), XBP-1 (CTGCAGAGGTGCACGTAGTC), or β-actin (GCCGATCCACACGGAGTACT). Plasmid vector and transfection The pCMV6-AC-GFP-Bcl-2 vector was from Origene (Australian Biosearch, WA, Australia). GRP78 cDNA cloned into pcDNA3.1 was provided by Dr. Richard C Austin (McMaster University and the Hamilton Civic Hospitals Research Centre, Hamilton, Ontario, Canada) and described elsewhere (22). siRNA and shRNA siRNA constructs are listed in Supplementary Table S3. siRNA transfection was carried out as described previously (17). MISSION® human shRNA lentiviral transduction particles Bim (SHCLNV-NM_009754) and the control particles were from Sigma-Aldrich. Colon cancer xenograft mouse model Colon cancer cells were injected subcutaneously into flanks of male athymic nude mice (Model Animal Research Centre of Nanjing University, China). Ten days after injection when xenografts were approximately 100 mm3, mice were randomly assigned into different groups (n=8). Mice were treated daily with AUY922 (50mg/kg per day in sterile PBS via i.p injection), or equivalent volumes of the vehicle (DMSO) for 10 days. Mice were examined as described previously and sacrificed at 28 days after tumour cell transplantation (23). Studies on animals were approved by the Animal Research Ethics Committee of Shanxi Cancer Hospital, China. Statistical analysis and data presentation Statistical analysis was performed using JMP Statistics Made Visual software. Student’s t test was used to assess differences between different groups. A P value less than 0.05 was considered statistically significant.



Results Mutant KRAS colon cancer cells are more susceptible to killing by AUY922 HCT116 (KRASG13D), SW620 (KRASG12V), and WiDr and Caco-2 (wild-type KRAS) cells were treated with AUY922 at increasing concentrations for 48 hours. Strikingly, HCT116 and SW620 cells appeared more sensitive than WiDr and Caco-2 cells to AUY922-induced reduction in viability as measured using CellTiter-Glo assays (Fig. 1A), with the half-maximum inhibitory concentration (IC50) values ranging from 76.5nM and 82.2nM in HCT116 and SW620 cells, respectively, to >400nM in WiDr and Caco-2 cells (Figs. 1A and B). Of importance, AUY922 did not significantly affect survival of normal colon epithelial cells even when used at 400nM (Supplementary Fig. S1). The different responses of the colon cancer cells to AUY922 were also reflected in clonogenic assays and in cells grown in 3D cultures when the inhibitor was used at 80nM (the approximate IC50 value in HCT116 and SW620 cells) (Figs. 1C & D). Nevertheless, AUY922 at this concentration inhibited HSP90 activity similarly in sensitive and resistant cells, as it induced comparable degrees of downregulation of the HSP90 clients CRAF and S-phase kinase-associated protein 2 (SKP2), and upregualtion of HSP70 (Fig. 1E). Consistent with previous findings (24), AUY922 inhibited activation of ERK and Akt, which are downstream of multiple clients of HSP90, in colon cancer cells irrespective of their KRAS mutational status (Fig. 1E). The increased susceptibility of mutant KRAS colon cancer cells to AUY922 was confirmed in additional two mutant KRAS cell lines (SW480 (KRASG12V) and EB (KRASG12D)) and three wild-type KRAS colon cancer lines (Colo205, Lim1863, and Lim1215) (Fig. 1B). Of note, sensitivity of colon cancer cells to AUY922 was not associated with the expression levels of HSP90 (Supplementary Fig. S2). Nevertheless, knockdown of HSP90α and β, two major isoforms of HSP90 that are inhibited by AUY922 (25, 26), similarly inhibited survival of HCT116 and SW620 but not WiDr and Caco-2 cells (Fig. 1F). Collectively, these results indicate that, in contrast to resistance to many therapeutic drugs (2, 3), mutant KRAS colon cancer cells are vulnerable to HSP90 inhibition.



Killing of mutant KRAS colon cancer cells by AUY922 is associated with upregulation of Bim, Bik, and PUMA The general caspase inhibitor z-VAD-fmk efficiently inhibited AUY922-induced HCT116 and SW620 cell death, indicating that AUY922 kills these cells by apoptosis (Fig. 2A and Supplementary Fig. S3) (27). In support, AUY922 caused accumulation of sub-G1 DNA content, exposure of phosphatidylserine onto the cell surface, activation of caspase-3, and cleavage of its substrate PARP (Fig. 2B and Supplementary Fig. S4). Overexpression of Bcl-2 inhibited apoptosis induced by AUY922 (Fig. 2C), indicating that the mitochondrial apoptotic pathway plays an essential role. Consistently, knockdown of Bax also diminished apoptosis induced by AUY922 (Fig. 2D) (10). Moreover, AUY922 triggered reduction in the mitochondrial membrane potential, release of cytochrome c and Smac/DIABLO, and activation of caspase-9 in HCT116 and SW620 cells (Fig. 2B and Supplementary Fig. S5). As a client protein of HSP90, Bcl-2 was reduced rapidly in HCT116 and SW620 cells, but not in wild-type KRAS colon cancer cells, upon treatment with AUY922 (Fig. 2E) (9, 28). On the other hand, the expression of the other anti-apoptosis Bcl-2 family proteins Mcl-1 and Bcl-XL was not changed by AUY922 even in HCT116 and SW620 cells (Fig. 2E). Remarkably, AUY922 upregulated multiple BH3-only proteins, including Bim, Bik, and PUMA in sensitive but not in resistant colon cancer cells (Fig. 2E). There was no change in the expression of Bax and Bak, nor was there any alteration in phosphorylation (deactivation) of the BH3-only protein Bad, upon AUY922 treatment in both mutant and wild-type KRAS colon cancer cells (Fig. 2E). Bim plays an essential role in apoptosis of mutant KRAS colon cancer cells induced by AUY922 We knocked down Bim, Bik, and PUMA using two individual siRNAs in HCT116 and SW620 cells (Figs. 3A-C). Strikingly, knockdown of Bim abolished cell death induced by AUY922 (Fig. 3D), whereas knockdown of Bik also inhibited, albeit partially, AUY922-induced cell death (Fig. 3D). Consistent with the lack of upregulation of Bim in wild-type KRAS colon cancer cells by AUY922 (Fig. 2E), knockdown of Bim did not alter sensitivity of Caco-2 cells to AUY922 (Supplementary Fig.



S6). Of interest, although PUMA and p53 have been reported to mediate killing of colon cancer cells by the other HSP90 inhibitor 17-AAG (10), knockdown of PUMA or p53 did not impinge on killing of HCT116 and SW620 cells by AUY922 (Figs. 3C&D and Supplementary Fig. S7). Nevertheless, PUMA or p53 knockdown inhibited cell death induced by the MDM2 inhibitor nutlin-3 (Supplementary Fig. S7) (29), verifying the functional efficacy of the PUMA and p53 siRNAs. AUY922-triggered ER stress is responsible for upregulation of Bim in mutant KRAS colon cancer cells Upregulation of Bim by AUY922 was associated with elevation in its mRNA levels (Supplementary Fig. S8A). This was due to a transcriptional increase rather than changes in its stability as shown in actinomycin D-chasing assays (Supplementary Figs. S8B & C) (17). Since Bim transcription is responsive to ER stress (19), we tested whether ER stress was involved in upregulation of Bim by AUY922. Indeed, treatment with AUY922 activated the ER stress response in mutant but not wildtype KRAS colon cancer cells (Figs. 4A & B). Noticeably, the expression of IRE1 and PERK that have been reported to be HSP90 clients remained unchanged after treatment with AUY922 (Fig. 4A). As CHOP is responsible for transcriptional upregulation of Bim by ER stress (19), we examined the potential role of CHOP in Bim upregulation by AUY922 in colon cancer cells. As shown in Fig. 4C, siRNA knockdown of CHOP inhibited upregulation of Bim, activation of caspase-3, cleavage of PARP, and cell death induced by the inhibitor in HCT116 and SW620 cells (Supplementary Fig. S9). In support, the chemical chaperon BGP-15 or 4-PBA attenuated killing by AUY922 (Fig. 4D) (30, 31). This was associated with reduced induction of GRP78, spliced XBP-1, CHOP, and Bim (Fig. 4E and Supplementary Fig. S10). Similarly, overexpression of GRP78 inhibited AUY922-induced upregulation of CHOP and Bim and apoptosis in HCT116 and SW620 cells (Fig. 4F and Supplementary Fig. S11). Inhibition of GRP78 or XBP-1 enhances AUY922-induced killing in colon cancer cells



We examined whether inhibition of GRP78 and XBP-1, two major pro-survival effectors of the ER stress response (14, 15), affected sensitivity of colon cancer cells to AUY922. Knockdown of either GRP78 or XBP-1 increased apoptosis induced by AUY922 in HCT116 and SW620 cells (Figs. 5A-C). Of note, it also rendered WiDr cells sensitive, albeit moderately, to AUY922-induced killing (Figs 5A-C), suggesting that resistance of wild-type KRAS colon cancer cells to AUY922 is, at least in part, due to better adaptation to ER stress. The effect of XBP-1 was further confirmed by treatment with salicylaldehyde that inhibits the IRE1 endonuclease activity thus blocking splicing (activation) of XBP-1 (Fig 5D) (32). Deficiency in Bim blocks the inhibitory effect of AUY922 on mutant KRAS colon cancer xenograft growth To test the effect of AUY922 on the growth of colon cancers in vivo, we transplanted HCT116 and WiDr cells into nu/nu mice. Administration of AUY922 inhibited established HCT116 tumour growth, but did not impinge on the growth of WiDr tumours (Figs. 6A-C). Inhibition of HCT116 tumour growth by AUY922 was associated with activation of caspase-3, upregulation of Bim, and induction of ER stress (Figs 6D & E). However, the inhibitory effect was diminished in xenografts of HCT116 cells with Bim stably knocked down, although AUY922 triggered ER stress in the tumours (Figs. 6F-H).



Discussion We have shown in this study that mutant KRAS colon cancer cells are more susceptible to apoptosis induced by the HSP90 inhibitor AUY922, consistent with the observations in other types of cancers that HSP90 inhibition has the greatest effect in tumours addicted to particular driver oncogene products, such as HER2 in breast cancer (33), mutant EGFR or ALK translocations in non-small-cell lung carcinoma (NSCLC) (34, 35), and mutant BRAF in melanoma (36). In particular, inhibition of HSP90 has been shown to have potent antitumor activity in mutant KRAS NSCLC models in vivo (37, 38). Moreover, we have demonstrated that activation of Bim though ER stress plays an essential role in AUY922-induced apoptosis of mutant KRAS colon cancer cells (Supplementary Fig S12). Although HSP90 inhibition has diverse effects on cancer cells (4), AUY922 primarily induced caspase-dependent mitochondrion-mediated apoptosis in mutant KRAS colon cancer cells. This bears important implications, in that the ultimate goal of treatment of cancer is to eradicate cancer cells. While our results showing that knockdown of Bax blocked induction of cell death consolidated the importance of the mitochondrial apoptotic pathway in AUY922-triggered killing, Bax-deficient colon cancer cells have been shown to commit to necrosis upon treatment with the other HSP90 inhibitor 17-AAG (10, 13, 39). This difference may be due to the different HSP90 inhibitors used in the individual studies. Indeed, comparative analyses have shown that there are profound differences in biological consequences of treatment of colon cancer cells with 17-AAG and AUY922 (40). In support, while p53 and PUMA are required for 17-AAG-induced apoptosis of colon cancer cells (10), they were indispensable for killing by AUY922. Regardless, our results clearly demonstrated that Bim, but not PUMA or the other BH3-only protein Bik, played a fundamental role in AUY922induced apoptosis of KRAS mutant colon cancer cells. An important finding of this study was that mutant KRAS colon cancer cells were more prone to AUY922-induced ER stress. Although ER stress has been found previously to contribute to apoptosis induced by HSP90 inhibition (41), the role of ER stress-induced Bim has not been documented. Consistent with the previous finding that ER stress activates Bim transcription through CHOP (19),



we found that knockdown of CHOP inhibited AUY922-triggered upregulation of Bim. Indeed, chemical chaperones or overexpression of GRP78, which alleviates ER stress (30), attenuated upregulation of CHOP and Bim by AUY922. On the other hand, siRNA inhibition of GRP78 or XBP-1, two well established pro-survival effectors of the UPR (14, 15), enhanced upregulation of Bim and apoptosis caused by AUY922. It seems therefore that other agents that induce ER stress may cooperate with HSP90 inhibition to induce apoptosis in mutant KRAS colon cancer cells. In support our findings in mutant KRAS colon cancer, deletion of CHOP in a mouse model of mutant KRASinduced lung cancer increases tumour incidence, suggesting that CHOP activity is a barrier to mutant KRAS-driven malignancy (42). As a HSP90 client protein (9), Bcl-2 is reduced, as anticipated, by AUY922. However, this was observed only in mutant KRAS colon cancer cells, suggesting that the chaperone effect of HSP90 on Bcl-2 is highly selective and is associated with the mutational status of KRAS in colon cancer cells. Many co-chaperones are involved in determining the selectivity of HSP90 on its clients (43-45). It is likely that signalling driven by mutant KRAS affects the activity of the co-factor needed for HSP90 to chaperone Bcl-2, thus making Bcl-2 more vulnerable to HSP90 inhibition. How does AUY922 preferentially induce ER stress in mutant KRAS colon cancer cells? It has been reported that killing of mutant KRAS cancer cells by the HSP90 inhibitor 17-AGG or PU-H71 involves degradation of the serine/threonine kinase STK33 (6). However, degradation of STK33 appeared less likely to be involved in AYU922-induced ER stress-mediated apoptosis of mutant KRAS colon cancer cells, as treatment with AUY922 did not cause any significant change in the expression of STK33 in the cells (Supplementary Fig. S13). On the other hand, oncogenic activation of KRAS may promote protein synthesis as does activating mutations of BRAF (46), which represents an underlying mechanism of chronic ER stress in cancer cells by uncoupling the ER protein folding load with the ER protein folding capacity (46). In this case, inhibition of HSP90 conceivably increases the content of proteins that cannot be properly folded and thus exacerbates the ER stress condition more markedly in mutant compared with wild-type KRAS colon cancer cells.



Previous studies have shown that HSP90 inhibition reduces activation of Akt and ERK, which are downstream of multiple clients of HSP90, contributes to induction of apoptosis (24, 47, 48). In particular, Akt itself is known to be a HSP90 client protein (49). However, we found that activation of Akt and ERK was reduced by AUY922 in both mutant and wild-type KRAS colon cancer cells, whereases the latter were markedly less sensitive to apoptosis induced by the inhibitor, suggesting that inhibition of Akt and ERK may not play a major role in AUY922-induced apoptosis in mutant KRAS colon cancer cells. Moreover, our finding that colon cancer cells that harbour mutations in both BRAF and PI3K that is responsible for activation of Akt (WiDr cells) are resistant to apoptosis induced by AUY922 further highlights the selectivity of AUY922 for mutant KRAS colon cancer cells. The cytotoxic effect of AUY922 on mutant KRAS colon cancer cells was mirrored by inhibition of the growth of mutant KRAS colon cancer xenografts, which, in accordance with the findings in colon cancer cell lines, was mediated by Bim and associated with ER stress. This suggests that clinical evaluation of the efficacy of AUY922 in patients with metastatic colon cancers carrying activating mutations of KRAS is warranted, and that agents that potentiate the apoptosis-inducing effect of Bim, such as inhibitors of the pro-survival Bcl-2 family proteins, may be considered for combination with AUY922 in the treatment colon cancer (50). As a precedent, although the HSP90 inhibitor ganetespib showed only modest clinical activity in patients with mutant KRAS NSCLC, combinations of the inhibitor and other agents have been proposed (37, 38).



References 1.

Hugen N, Brown G, Glynne-Jones R, de Wilt JH, Nagtegaal ID. Advances in the care of

patients with mucinous colorectal cancer. Nat Rev Clin Oncol. 2015;140:1-9. 2.

Misale S, Yaeger R, Hobor S, Scala E, Janakiraman M, Liska D, et al. Emergence of KRAS

mutations and acquired resistance to anti-EGFR therapy in colorectal cancer. Nature. 2012;486:532-6. 3.

Wheeler DL, Dunn EF, Harari PM. Understanding resistance to EGFR inhibitors-impact on

future treatment strategies. Nat Rev Clin Oncol. 2010;7:493-507. 4.

Solit DB, Rosen N. Hsp90: a novel target for cancer therapy. Curr Top Med Chem.

2006;6:1205-14. 5.

Qi X, Xie C, Hou S, Li G, Yin N, Dong L, et al. Identification of a ternary protein-complex as

a therapeutic target for K-Ras-dependent colon cancer. Oncotarget. 2014;5:4269-82. 6.

Azoitei N, Hoffmann CM, Ellegast JM, Ball CR, Obermayer K, Gossele U, et al. Targeting of

KRAS mutant tumors by HSP90 inhibitors involves degradation of STK33. J Exp Med. 2012;209:697-711. 7.

Cercek A, Shia J, Gollub M, Chou JF, Capanu M, Raasch P, et al. Ganetespib, a novel Hsp90

inhibitor in patients with KRAS mutated and wild type, refractory metastatic colorectal cancer. Clin Colorectal Cancer. 2014;13:207-12. 8.

Sellers WR, Fisher DE. Apoptosis and cancer drug targeting. J Clin Invest. 1999;104:1655-

61. 9.

Cohen-Saidon C, Carmi I, Keren A, Razin E. Antiapoptotic function of Bcl-2 in mast cells is

dependent on its association with heat shock protein 90beta. Blood. 2006;107:1413-20. 10.

He K, Zheng X, Zhang L, Yu J. Hsp90 inhibitors promote p53-dependent apoptosis through

PUMA and Bax. Mol Cancer Ther. 2013;12:2559-68.



11.

Busacca S, Law EW, Powley IR, Proia DA, Sequeira M, Le Quesne J, et al. Resistance to

HSP90 inhibition involving loss of MCL1 addiction. Oncogene. 2015;213:1-10. 12.

Lee DH, Sung KS, Bartlett DL, Kwon YT, Lee YJ. HSP90 inhibitor NVP-AUY922 enhances

TRAIL-induced apoptosis by suppressing the JAK2-STAT3-Mcl-1 signal transduction pathway in colorectal cancer cells. Cell Signal. 2015;27:293-305. 13.

Kim YJ, Lee SA, Myung SC, Kim W, Lee CS. Radicicol, an inhibitor of Hsp90, enhances

TRAIL-induced apoptosis in human epithelial ovarian carcinoma cells by promoting activation of apoptosis-related proteins. Mol Cell Biochem. 2012;359:33-43. 14.

Harding HP, Calfon M, Urano F, Novoa I, Ron D. Transcriptional and translational control in

the Mammalian unfolded protein response. Annu Rev Cell Dev Biol. 2002;18:575-99. 15.

Zhang K, Kaufman RJ. Signaling the unfolded protein response from the endoplasmic

reticulum. J Biol Chem. 2004;279:25935-8. 16.

Schroder M, Kaufman RJ. The mammalian unfolded protein response. Annu Rev Biochem.

2005;74:739-89. 17.

Jiang CC, Lucas K, Avery-Kiejda KA, Wade M, deBock CE, Thorne RF, et al. Up-regulation

of Mcl-1 is critical for survival of human melanoma cells upon endoplasmic reticulum stress. Cancer Res. 2008;68:6708-17. 18.

Li J, Lee B, Lee AS. Endoplasmic reticulum stress-induced apoptosis: multiple pathways and

activation of p53-up-regulated modulator of apoptosis (PUMA) and NOXA by p53. J Biol Chem. 2006;281:7260-70. 19.

Puthalakath H, O'Reilly LA, Gunn P, Lee L, Kelly PN, Huntington ND, et al. ER stress

triggers apoptosis by activating BH3-only protein Bim. Cell. 2007;129:1337-49.



20.

Guo ST, Chi MN, Yang RH, Guo XY, Zan LK, Wang CY, et al. INPP4B is an oncogenic

regulator in human colon cancer. Oncogene. 2015;361:1-13. 21.

Tay KH, Liu X, Chi M, Jin L, Jiang CC, Guo ST, et al. Involvement of vacuolar H(+ -ATPase

in killing of human melanoma cells by the sphingosine kinase analogue FTY720. Pigment Cell Melanoma Res. 2015;28:171-83. 22.

Werstuck GH, Lentz SR, Dayal S, Hossain GS, Sood SK, Shi YY, et al. Homocysteine-

induced endoplasmic reticulum stress causes dysregulation of the cholesterol and triglyceride biosynthetic pathways. J Clin Invest. 2001;107:1263-73. 23.

Lai F, Guo ST, Jin L, Jiang CC, Wang CY, Croft A, et al. Cotargeting histone deacetylases

and oncogenic BRAF synergistically kills human melanoma cells by necrosis independently of RIPK1 and RIPK3. Cell Death Dis. 2013;4:e655. 24.

Koga F, Xu W, Karpova TS, McNally JG, Baron R, Neckers L. Hsp90 inhibition transiently

activates Src kinase and promotes Src-dependent Akt and Erk activation. Proc Natl Acad Sci U S A. 2006;103:11318-22. 25.

Eccles SA, Massey A, Raynaud FI, Sharp SY, Box G, Valenti M, et al. NVP-AUY922: a

novel heat shock protein 90 inhibitor active against xenograft tumor growth, angiogenesis, and metastasis. Cancer Res. 2008;68:2850-60. 26.

Garon EB, Finn RS, Hamidi H, Dering J, Pitts S, Kamranpour N, et al. The HSP90 inhibitor

NVP-AUY922 potently inhibits non-small cell lung cancer growth. Mol Cancer Ther. 2013;12:890900. 27.

Jiang CC, Chen LH, Gillespie S, Wang YF, Kiejda KA, Zhang XD, et al. Inhibition of MEK

sensitizes human melanoma cells to endoplasmic reticulum stress-induced apoptosis. Cancer Res. 2007;67:9750-61.



28.

Gallerne C, Prola A, Lemaire C. Hsp90 inhibition by PU-H71 induces apoptosis through

endoplasmic reticulum stress and mitochondrial pathway in cancer cells and overcomes the resistance conferred by Bcl-2. Biochim Biophys Acta. 2013;1833:1356-66. 29.

Tseng HY, Jiang CC, Croft A, Tay KH, Thorne RF, Yang F, et al. Contrasting effects of

nutlin-3 on TRAIL- and docetaxel-induced apoptosis due to upregulation of TRAIL-R2 and Mcl-1 in human melanoma cells. Mol Cancer Ther. 2010;9:3363-74. 30.

Wu LL, Russell DL, Wong SL, Chen M, Tsai TS, St John JC, et al. Mitochondrial

dysfunction in oocytes of obese mothers: transmission to offspring and reversal by pharmacological endoplasmic reticulum stress inhibitors. Development. 2015;142:681-91. 31.

Asahi J, Kamo H, Baba R, Doi Y, Yamashita A, Murakami D, et al. Bisphenol A induces

endoplasmic reticulum stress-associated apoptosis in mouse non-parenchymal hepatocytes. Life Sci. 2010;87:431-8. 32.

Volkmann K, Lucas JL, Vuga D, Wang X, Brumm D, Stiles C, et al. Potent and selective

inhibitors of the inositol-requiring enzyme 1 endoribonuclease. J Biol Chem. 2011;286:12743-55. 33.

Desale SS, Raja SM, Kim JO, Mohapatra B, Soni KS, Luan H, et al. Polypeptide-based

nanogels co-encapsulating a synergistic combination of doxorubicin with 17-AAG show potent antitumor activity in ErbB2-driven breast cancer models. J Control Release. 2015;208:59-66. 34.

Tanimoto A, Yamada T, Nanjo S, Takeuchi S, Ebi H, Kita K, et al. Receptor ligand-triggered

resistance to alectinib and its circumvention by Hsp90 inhibition in EML4-ALK lung cancer cells. Oncotarget. 2014;5:4920-8.

35.

Hong YS, Jang WJ, Chun KS, Jeong CH. Hsp90 inhibition by WK88-1 potently suppresses

the growth of gefitinib-resistant H1975 cells harboring the T790M mutation in EGFR. Oncol Rep. 2014;31:2619-24.



36.

Smyth T, Paraiso KH, Hearn K, Rodriguez-Lopez AM, Munck JM, Haarberg HE, et al.

Inhibition of HSP90 by AT13387 delays the emergence of resistance to BRAF inhibitors and overcomes resistance to dual BRAF and MEK inhibition in melanoma models. Mol Cancer Ther. 2014;13:2793-804. 37.

Socinski MA, Goldman J, El-Hariry I, Koczywas M, Vukovic V, Horn L, et al. A multicenter

phase II study of ganetespib monotherapy in patients with genotypically defined advanced non-small cell lung cancer. Clin Cancer Res. 2013;19:3068-77. 38.

Acquaviva J, Smith DL, Sang J, Friedland JC, He S, Sequeira M, et al. Targeting KRAS-

mutant non-small cell lung cancer with the Hsp90 inhibitor ganetespib. Mol Cancer Ther. 2012;11:2633-43. 39.

Powers MV, Valenti M, Miranda S, Maloney A, Eccles SA, Thomas G, et al. Mode of cell

death induced by the HSP90 inhibitor 17-AAG (tanespimycin) is dependent on the expression of proapoptotic BAX. Oncotarget. 2013;4:1963-75. 40.

Mayor-Lopez L, Tristante E, Carballo-Santana M, Carrasco-Garcia E, Grasso S, Garcia-

Morales P, et al. Comparative Study of 17-AAG and NVP-AUY922 in Pancreatic and Colorectal Cancer Cells: Are There Common Determinants of Sensitivity? Transl Oncol. 2014;7:590-604. 41.

Davenport EL, Moore HE, Dunlop AS, Sharp SY, Workman P, Morgan GJ, et al. Heat shock

protein inhibition is associated with activation of the unfolded protein response pathway in myeloma plasma cells. Blood. 2007;110:2641-9. 42.

Huber AL, Lebeau J, Guillaumot P, Petrilli V, Malek M, Chilloux J, et al. p58(IPK)-mediated

attenuation of the proapoptotic PERK-CHOP pathway allows malignant progression upon low glucose. Mol Cell. 2013;49:1049-59. 43.

Li J, Soroka J, Buchner J. The Hsp90 chaperone machinery: conformational dynamics and

regulation by co-chaperones. Biochim Biophys Acta. 2012;1823:624-35.



44.

Li J, Buchner J. Structure, function and regulation of the hsp90 machinery. Biomed J.

2013;36:106-17. 45.

Walton-Diaz A, Khan S, Bourboulia D, Trepel JB, Neckers L, Mollapour M. Contributions of

co-chaperones and post-translational modifications towards Hsp90 drug sensitivity. Future Med Chem. 2013;5:1059-71. 46.

Croft A, Tay KH, Boyd SC, Guo ST, Jiang CC, Lai F, et al. Oncogenic activation of

MEK/ERK primes melanoma cells for adaptation to endoplasmic reticulum stress. J Invest Dermatol. 2014;134:488-97. 47.

Luo H, Yang Y, Duan J, Wu P, Jiang Q, Xu C. PTEN-regulated AKT/FoxO3a/Bim signaling

contributes to reactive oxygen species-mediated apoptosis in selenite-treated colorectal cancer cells. Cell Death Dis. 2013;4:e481. 48.

Shinjyo T, Kuribara R, Inukai T, Hosoi H, Kinoshita T, Miyajima A, et al. Downregulation of

Bim, a proapoptotic relative of Bcl-2, is a pivotal step in cytokine-initiated survival signaling in murine hematopoietic progenitors. Mol Cell Biol. 2001;21:854-64. 49.

Basso AD, Solit DB, Chiosis G, Giri B, Tsichlis P, Rosen N. Akt forms an intracellular

complex with heat shock protein 90 (Hsp90) and Cdc37 and is destabilized by inhibitors of Hsp90 function. J Biol Chem. 2002;277:39858-66. 50.

Lessene G, Czabotar PE, Colman PM. BCL-2 family antagonists for cancer therapy. Nat Rev

Drug Discov. 2008;7:989-1000.



Figure Legends: Figure 1 – Mutant KRAS colon cancer cells are more sensitive to killing by AUY922 A.

Colon cancer cells were treated with AUY922 for 48 hours. Cell viability was quantitated using CellTiter-Glo assays. Data are mean ± SE, n=3. **P

Vitamin C selectively kills KRAS and BRAF mutant colorectal cancer cells by targeting GAPDH.

Reactivation of ERK and Akt confers resistance of mutant BRAF colon cancer cells to the HSP90 inhibitor AUY922.

Methylisoindigo preferentially kills cancer stem cells by interfering cell metabolism via inhibition of LKB1 and activation of AMPK in PDACs.

Suppression of KRas-mutant cancer through the combined inhibition of KRAS with PLK1 and ROCK.

Intrinsic resistance to MEK inhibition in KRAS mutant lung and colon cancer through transcriptional induction of ERBB3.

Oncolytic reovirus preferentially induces apoptosis in KRAS mutant colorectal cancer cells, and synergizes with irinotecan.

Non-thermal atmospheric pressure plasma preferentially induces apoptosis in p53-mutated cancer cells by activating ROS stress-response pathways.

Copper chelation selectively kills colon cancer cells through redox cycling and generation of reactive oxygen species.

Selective targeting of KRAS-mutant cells by miR-126 through repression of multiple genes essential for the survival of KRAS-mutant cells.

Role of ATF3 in synergistic cancer cell killing by a combination of HDAC inhibitors and agonistic anti-DR5 antibody through ER stress in human colon cancer cells.

Thymoquinone chemosensitizes colon cancer cells through inhibition of NF-κB.

Differential reprogramming of isogenic colorectal cancer cells by distinct activating KRAS mutations.

5-Fluorouracil preferentially sensitizes mutant KRAS non-small cell lung carcinoma cells to TRAIL-induced apoptosis.

HSP90 inhibitor AUY922 can reverse Fulvestrant induced feedback reaction in human breast cancer cells.

KRAS and cancer stem cells in APC-mutant colorectal cancer.

HSP90 inhibition enhances cancer immunotherapy by upregulating interferon response genes.

Inhibition of endoplasmic reticulum (ER) stress sensors sensitizes cancer stem-like cells to ER stress-mediated apoptosis.

ER stress signaling in ARPE-19 cells after inhibition of protein kinase CK2 by CX-4945.

RAF suppression synergizes with MEK inhibition in KRAS mutant cancer cells.

Colon Cancer Tumorigenesis Initiated by the H1047R Mutant PI3K.

Gambogenic acid kills lung cancer cells through aberrant autophagy.

Inhibition of FAK kinase activity preferentially targets cancer stem cells.

ER Stress in Dendritic Cells Promotes Cancer.

17-DMCHAG, a new geldanamycin derivative, inhibits prostate cancer cells through Hsp90 inhibition and survivin downregulation.