Inhibition of Aggregation of Mutant Huntingtin by Nucleic Acid Aptamers In Vitro and in a Yeast Model of Huntington's Disease.

original article

© The American Society of Gene & Cell Therapy

Inhibition of Aggregation of Mutant Huntingtin by Nucleic Acid Aptamers In Vitro and in a Yeast Model of Huntington’s Disease Rajeev K Chaudhary1, Kinjal A Patel1, Milan K Patel1, Radha H Joshi1 and Ipsita Roy1 Department of Biotechnology, National Institute of Pharmaceutical Education and Research, Punjab, India

1

Elongated polyglutamine stretch in mutant huntingtin (mhtt) correlates well with the pathology of Huntington’s disease (HD). Inhibition of aggregation of mhtt is a promising strategy to arrest disease progression. In this work, specific, high-affinity RNA aptamers were selected against monomeric mhtt (51Q-htt). Some of them inhibited its aggregation in vitro by stabilizing the monomer. They also recognized 103Q-htt but not 20Q-htt (nonpathogenic length). Inhibition of aggregation corresponded with reduced leakage of a fluorescent probe from liposomes and diminished oxidative stress in RBCs. The presence of aptamers was able to rescue the sequestration of the glycolytic enzyme glyceraldehyde3-phosphate dehydrogenase (GAPDH) by aggregated mhtt. Some of the aptamers were able to enhance the partitioning of mhtt in the soluble fraction in a yeast model of HD. They were also able to rescue endocytotic defect due to aggregation of mhtt. The beneficial effect of a combination of aptamers was enhanced with improvement in cell survival. Since HD is a monogenic autosomal dominant disorder, aptamers may be developed as a viable strategy to slow down the progress of the disease. Since they are nonimmunogenic and nontoxic, aptamers may emerge as strong candidates to reduce protein–protein interaction and hence protein aggregation in protein misfolding disorders in general. Received 16 September 2014; accepted 21 August 2015; advance online publication 13 October 2015. doi:10.1038/mt.2015.157

INTRODUCTION

Huntington’s disease (HD) is an autosomal, dominantly inherited neurodegenerative disorder caused by a CAG-trinucleotide repeat expansion (coding for a polyglutamine, polyQ, stretch) in the first exon of the gene IT15, which encodes a large (~350 kDa) protein called huntingtin (htt).1,2 Selective neuronal loss occurs primarily in the cortex and striatum. The extent of aggregation of huntingtin has been positively correlated with cytotoxicity3 although conflicting reports with striatal neurons do exist.4 Therapeutic interventions with small molecules, intracellularly expressed single chain antibodies, etc. have been designed, which either stabilize the native conformation and inhibit aggregation or enhance the clearance of mutant huntingtin protein.3,5,6

Aptamers are short, single-stranded DNA or RNA oligonucleotides, which fold into well-defined three dimensional structures7,8 and bind their target molecules (small molecules, proteins, and even whole cells) with high affinity and specificity via complementary shape interaction. They are nontoxic and nonimmunogenic molecules, which make them ideal candidates for in vivo administration.9 Aptamers have previously been selected against some amyloidogenic proteins like prions,10 α-synuclein,11 etc. and employed for in vitro applications. Aptamers can be used intracellularly (as “intramers”) to probe cellular processes through binding to specific functional groups of target molecules.12 They are, thus, potential agents which can inhibit protein–protein interaction and hence protein aggregation inside the cell. There is strong support for the hypothesis that proteolytic cleavage of the N-terminal fragment from the full-length htt protein is primarily responsible for pathogenesis.13–15 Elongation of polyQ stretch in this segment of mutant huntingtin (mhtt) shows similar kind of disruption in endocytosis as the full length protein.16 Full-length mhtt deletion mutants, lacking N-terminal domains interacting with HAP1 or dyein, show disrupted vesicular transport.17 Thus, the N-terminal huntingtin fragment containing an expanded polyglutamine stretch is sufficient to recapitulate the disease phenotype in various cell and animal models.4,18,19 In the present study, RNA aptamers were selected which bound specifically to the N-terminal fragment (harboring 51Q or 103Q) of mhtt with high affinity and were able to inhibit its aggregation in vitro and in a yeast model of HD. Aptamers were able to solubilize mhtt fragment, restore its normal functions, inhibit sequestration of essential cellular proteins, and exert beneficial effects on the functioning of the cell.

RESULTS Aggregation of mutant huntingtin protein

N-terminal fragment of human mhtt (containing 51Q-htt) was expressed under the control of the lac promoter in Escherichia coli and purified by affinity chromatography (Supplementary Figure S1a). A band at the expected position (~50 kDa) with a tail due to truncated polyglutamine products2 was seen. The formation of aggregates upon incubation was confirmed by immunoblotting with polyglutamine antibody (Figure 1a). No aggregation was seen with the wild-type protein (GST-20Q-htt) (Figure 1a) expressed and purified in the same manner as the mutant protein,2 confirming that aggregation was due to the extended

Correspondence: Ipsita Roy, Department of Biotechnology, National Institute of Pharmaceutical Education and Research, Sector 67, S.A.S. Nagar, Punjab 160062, India. E-mail: [email protected]

1912

www.moleculartherapy.org vol. 23 no. 12, 1912–1926 dec. 2015


a

Aptamers and Aggregation of Mutant Huntingtin

c

b 4°C 37°C

91 71 54

Monomer

0h

3h

6h

12 h

18 h

24 h

36 h

48 h

54 h

60 h

72 h

100 80 Intensity, %

4°C 37°C

Aggregated protein

kDa

33 29

60 polyQ

40

A11

20 20Q-htt

0

51Q-htt

0

0

30

15

60

90

30 45 Time, hours

120

60

75

150

Time, hours

d

e

f 100

−

100 %

+

23.9±0.6 % P < 0.001

−

100 %

+

93.1 ± 1.6 % P > 0.05

80 ThT fluorescence intensity, A.U.

−

Control (4°C, 144 hours

15 hours

n=3

144 hours

SDS

60 40 20 0

0

30

60

90

120

150

Time, hours

Figure 1 GST-51Q-htt forms fibrillar aggregates. (a) GST-20Q-htt and GST-51Q-htt (1 mg ml−1 each, 40 mmol/l TrisHCl buffer, pH 8.0 containing 150 mmol/l NaCl) were incubated separately at 4 and 37 °C for 144 hours and analyzed by immunoblotting using GST and polyglutamine antibodies, respectively. (b) GST-51Q-htt (1 mg ml−1, 40 mmol/l TrisHCl buffer, pH 8.0 containing 150 mmol/l NaCl) was incubated at 37 °C for different time intervals. Filter retardation assay using cellulose acetate membrane (0.2 μm) was carried out at different time intervals and the amount of aggregates retained was probed with polyglutamine antibody. Triplicate dots are shown for each time point. (c) Densitometric analysis of the intensity of the dots obtained with polyglutamine-specific or A11-specific (blot image shown in Supplementary Figure S1b) antibody was carried out separately with ImageQuant TL software (GE Healthcare). The intensity of the dot at the last point of analysis (72 hours for polyglutamine antibody and 144 hours for A11 antibody) was assigned an arbitrary value of 100%. Inset shows the expanded view of the aggregation curve for the time period of 0–72 hours. (d) The nature of aggregates formed after incubating GST-51Q-htt (1 mg ml−1, 40 mmol/l TrisHCl buffer, pH 8.0 containing 150 mmol/l NaCl) for 15 hours (exponential phase of fibrillation) and 144 hours (saturation phase) at 37 °C was observed by suspending the aggregates in 40 mmol/l TrisHCl buffer, pH 8.0 containing 150 mmol/l NaCl, with or without 2% SDS and carrying out a filter retardation assay. The cellulose acetate membrane was probed with GST antibody. Triplicate dots are shown. The intensity of the dots indicating the amount of aggregates retained on the membrane in the absence of SDS was assigned an arbitrary value of 100%. Values shown are mean ± SEM of three independent experiments. (e) Transmission electron micrograph of GST-51Q-htt incubated for 144 hours as described in the text. Bar = 200 nm; Magnification = 11,500×. (f) GST-51Q-htt (1 mg ml−1, 40 mmol/l TrisHCl buffer, pH 8.0 containing 150 mmol/l NaCl) was incubated at 37 °C and analyzed after indicated time intervals by Thioflavin T fluorescence spectroscopy. The final concentrations of the protein and the fluorophore were 1.5 and 50 μmol/l, respectively. Samples were excited at 440 nm and the emission intensity was monitored at 484 nm. Values shown are mean ± SEM of three independent experiments.

polyglutamine stretch and not due to intermolecular interaction between glutathione S-transferase (GST) tags. The formation of aggregates was also probed over time (Figure 1b). A very short lag time was observed (Figure 1c). With time, increasing aggregation was seen with the oligomer-specific A11 antibody (Supplementary Figure S1b). Polyglutamine antibody probe measured the total aggregate formed whereas A11 antibody estimated the fraction of oligomeric species. Comparison of aggregation kinetics showed that there was a distinct step when oligomers were formed, which subsequently gave rise to mature aggregates (Figure 1c). A characteristic sigmoidal plot, with a short nucleation/lag phase, was observed, as expected from the aggregation curves monitored with polyglutamine and A11 antibodies (Figure 1c). Filter retardation assay showed that the oligomeric species formed at the midpoint of fibrillation (15 hours incubation) was largely soluble (~77%) in the presence of the anionic detergent, Molecular Therapy vol. 23 no. 12 dec. 2015

sodium dodecyl sulphate (Figure 1d). The fibrillar nature of the aggregates formed at the end of the incubation process (144 hours at 37 °C) was confirmed by their detergent-insolubility (Figure 1d) and transmission electron microscopy analysis (Figure 1e). Thioflavin T (ThT) fluorescence spectroscopy showed that the aggregates finally formed had cross β-sheet structure (Figure 1f). No significant change in the fluorescence intensity of ThT was seen in case of GST-51Q-htt (1.5 μmol/l) incubated at 4 °C for the same time period (data not shown). Comparison of curve for ThT fluorescence intensity (Figure 1f) with the solubility of aggregates in sodium dodecyl sulphate (SDS) (Figure 1d) confirmed that at the mid-exponential phase (15 hours of incubation), a mixture of SDS-soluble oligomeric species and cross β-sheet fibrillar structure was formed. At the end of the incubation period, completely fibrillar, SDS-insoluble species were seen, as has been reported earlier.2–4,20 1913


Selection of aptamers which inhibit aggregation of mutant huntingtin in vitro Since the purified protein was tagged with GST, the first step in the selection of nucleic acid aptamers against the target protein (mhtt) was to remove GST/matrix-specific sequences from the starting libraries by counter-selection using matrix-bound GST as the target. Two libraries (mHtt1 and mHtt2) were then subjected to iterative rounds of selection against 51Q-htt in the presence of different concentrations of Mg2+, i.e., 2, 3, and 4 mmol/l, which facilitate the folding of RNA into compact structures.21 After 10 cycles, two of the selection conditions gave rise to libraries with low binding affinities and were not used further (Supplementary Table S1; Supplementary Figure S2). Fifty monoclones from rest of the enriched libraries were incubated with GST-51Q-htt under the same conditions as used for the protein alone (Figure 1c) for 15 hours (exponential part of the curve (Figure 1c)) as the aim was to search for molecules which were able to inhibit the conversion of monomeric protein into oligomeric/fibrillar species. The aggregates retained on cellulose acetate membrane were probed with GST antibody. None of the RNA sequences from the first library (mHtt1.2, 83 nt, selected at 2 mmol/l Mg2+) was able to inhibit aggregation of GST-51Qhtt (Supplementary Figure S3). Some of the sequences caused increase in aggregation (Supplementary Figure S3). Since selection had been specifically carried out against the monomeric protein, it may be speculated that these sequences destabilize the monomer, allow greater access to non-native conformations and shift the equilibrium to an alternate route that promotes aggregation. Four sequences from mHtt2.2, five from mHtt2.3 and one from mHtt2.4, were able to inhibit aggregation of GST-51Q-htt to a significant extent (Figure 2a and Supplementary Figure S3). Inhibition of aggregation was determined by reduction in the intensity of the spot following the addition of GST antibody probe (Table 1). Since GST-binding sequences had already been removed at the counter-selection step (by recovering the nonbinder sequences to GST-agarose matrix), the binding of the antibody to the protein (Figure 2a) was not affected by the presence of these sequences. Dot blot assay was repeated with some randomly chosen aptamer sequences and the nitrocellulose membrane was probed with oligomer-specific A11 antibody. Almost similar values for reduction of aggregation were observed with A11 antibody (Figure 2b, probing oligomeric species) as with GST antibody (Figure 2a, probing total aggregates), confirming that the apta mers were able to lower the formation of oligomeric species, which are considered to be more toxic than mature aggregates.22 Characterization of RNA aptamers The binding affinity of the selected aptamers for a longer polyQ stretch (103Q) was also measured. The difference between the number of glutamine residues is quite significant (51Q versus 103Q) and >100Q usually denotes juvenile HD. With mHtt2.3.08, the dissociation constant was found to be 567.3 nmol/l (Figure 2c), whereas it was 893.3 nmol/l with mHtt2.2.47 (Figure 2d). Thus, the aptamers continued to recognize elongated polyQ stretches although the affinity seemed to decrease with longer polyQ stretches. 1914


The specificity of the selected aptamers for longer polyQ stretch was established by monitoring their affinity for GST-20Q-htt, which has a polyQ stretch in the nonpathogenic stretch. The binding affinities of mHtt2.3.08 and mHtt2.2.47 for the protein with a shorter polyQ stretch were found to be negligible (Figure 2c,d). Since 20Q-htt and 51Q-htt differ only in the lengths of their polyQ stretch and 20Q-htt and 103Q-htt differ in the lengths of polyQ stretch as well as the fusion tags (GST versus EGFP), this indicates the specificity of the high-affinity aptamers for mhtt with a longer polyQ stretch. The polyproline tract of mhtt is unable to fold back to the N17 region, i.e., the flexibility of the polyQ stretch to act as a “hinge” region is lost, beyond the threshold limit of glutamine residues (32-37Q).23 There is a conformational transition in the pathogenic stretch giving rise to a different secondary structure and possibly common “aptatope”(s) for the elongated polyQ stretch, which are recognized by the inhibitory aptamers. Earlier studies had reported selection of aptamers against oligomeric/fibrillar proteins.10,24 In order to confirm that the selected aptamers recognize and bind to the monomeric form alone, and not the aggregated species, fluorescently labeled aptamers were incubated with preaggregated GST-51Q-htt (Supplementary Figure S4) and binding was monitored. No significant difference in the binding affinities could be detected between the lowest and the highest concentrations of aggregates in the presence of mHtt2.3.08, mHtt2.3.24, or mHtt2.2.47 (Figure 2e). Since aptamers recognize and bind to specific regions of their targets, we next asked whether a combination of aptamers would show improved efficacy as compared to individual aptamers. We selected pairs of equimolar aptamers (sequences with Kd ≤ 400 nmol/l with 51Q-htt) and monitored their ability to inhibit aggregation of GST-51Q-htt (1:1, w w−1). With certain combinations of aptamers, we found significantly lower level of aggregation than the corresponding single aptamers (Figure 3a). In the presence of mHtt2.2.18/mHtt2.3.42, aggregation of GST-51Q-htt could be inhibited by more than 77 % whereas the extent of reduction was more than 70 and 64% with mHtt2.2.47/mHtt2.3.42 and mHtt2.2.18/mHtt2.3.08, respectively. Thus, individual partner of each pair exerts a strong synergistic effect, with beneficial consequences on the aggregation of GST-51Q-htt. In order to confirm if the two aptamers bind to different sites on the target protein, displacement assay was carried out. Constant amounts of monomeric mhtt (GST-51Q-htt) and fluorescently labeled aptamer were preincubated and then challenged with increasing amounts of an unlabeled aptamer. The ability of the unlabeled aptamer to displace the fluorescently labeled aptamer from the proteinRNA complex retained on a nitrocellulose membrane was taken to denote the relative binding topologies of the aptamers on the protein surface. The complex of GST-51Q-htt-labeled mHtt2.2.18 was challenged with unlabeled mHtt2.2.18. As the competition is between the same aptamer, the unlabeled aptamer should be able to displace the bound labeled aptamer. This experiment thus served as the positive control. Significant reduction of fluorescence intensity was seen even at lower amounts of the unlabeled aptamer (Figure 3b), validating the assay. When the GST-51Qhtt-labeled mHtt2.2.47 complex was challenged with unlabeled mHtt2.2.18, displacement of the bound aptamer was seen but this was not significant (Figure 3b). Even at the highest amount www.moleculartherapy.org vol. 23 no. 12 dec. 2015


a

b

120 100

Aggregation, %


*

*

80

*

*

*

** **

**

* ***

** ***

***

60 40 20 0

C

.17

2.2

c

60

100

103Q-htt 51Q-htt 20Q-htt

60 40

20

20

0 1.0

1.5

2.0

103Q-htt 51Q-htt 20Q-htt

80

40

2.5

3.0

3.5

0 1.0

RNA binding, %

80

2.3.42

2.3.21

2.3.08

e

d 100

RNA binding, %

C

.18 .2.25 .2.47 .3.08 .3.21 .3.24 .3.42 .3.43 .4.08 2 2 2 2 2 2 2 2

2.2

1.5

log [Htt], nmol/l

2.0

2.5

log [Htt], nmol/l

3.0

3.5

120 80 40 0

2.2.47 2.3.24 2.3.08

0

0.25 0.50 0.75 1.00 1.25 1.50 [51Q-htt aggregates], µmol/l

Figure 2 Inhibition of aggregation of GST-51Q-htt by RNA sequences in vitro. (a) Monoclonal RNA sequences obtained from enriched libraries were preincubated with GST-51Q-htt for 1 hour at 25 °C, followed by incubation at 37 °C for 15 hours. Aggregation was monitored by filter retardation assay using a cellulose acetate membrane which was probed with GST antibody. The intensities of protein samples incubated in the presence of RNA sequences are shown as empty bars. Intensity of the control sample (incubated without RNA sequences, c, filled bar) was assigned a value of 100% in all cases. Data represent mean ± SEM of three independent experiments. *P < 0.05, **P < 0.005, ***P < 0.001 against corresponding control. (b) Incubation of GST-51Q-htt was carried out as before (Figure 2a) and the extent of aggregation was measured with A11-specific antibody following a dot-blot assay on a nitrocellulose membrane. Intensity of the control sample (incubated without RNA sequences, c, filled bar) was assigned a value of 100% in all cases. Data represent mean ± SEM of three independent experiments. **P < 0.005, ***P < 0.001 against corresponding control (filled bar, in the absence of aptamer). Comparison of binding affinities of (c) mHtt2.3.08 and (d) mHtt2.2.47 for GST-20Q-htt, GST-51Q-htt, and 103Q-htt by dot blot assay. The fluorescence intensities of the retained Qn-htt-RNA complexes were quantified and fitted into the equation for a sigmoidal curve. The intensity of the dot for GST-51Q-htt-RNA at the highest concentration of the protein has been assigned an arbitrary value of 100% and the intensities of the other dots have been calculated with respect to this value. A representative curve from each measurement is shown. (e) The ability of aptamers to bind to preformed GST-51Q-htt aggregates was determined by incubating the aggregates (formed after incubation of GST-51Q-htt at 37 °C for 60 hours) with labeled RNA sequences at 25 °C for 1 hour and filtering the RNA-protein complex through a cellulose acetate membrane. The fluorescence intensity retained on the membrane was quantified by densitometry. The intensity of the aggregate-RNA complex at the starting point in each case was assigned a value of 100% in all cases.

Table 1 Determination of binding affinity of monoclonal RNA aptamers for GST-51Q-htt Dissociation constant (Kd), nmol/l

Binder

Aggregation inhibitor

mHtt2.2.17

673.6 ± 11.6

√

√

mHtt2.2.18

355.0 ± 30.2

√

√

mHtt2.2.25

518.6 ± 53.6

√

√

mHtt2.2.47

388.3 ± 20.0

√

√

Monoclones

mHtt2.3.07

503.9 ± 17.7

√

×

mHtt2.3.08

334.8 ± 10.1

√

√

mHtt2.3.21

414.0 ± 29.1

√

√

mHtt2.3.24

469.4 ± 12.6

√

√

mHtt2.3.42

339.9 ± 4.7

√

√

mHtt2.3.43

445.8 ± 41.6

√

√

mHtt2.4.08

450.0 ± 8.6

√

√

Values shown are mean ± SEM of three independent experiments.

Molecular Therapy vol. 23 no. 12 dec. 2015

of unlabeled RNA (mHtt2.2.18) used, only 10% of fluorescence intensity was lost. On the other hand, mHtt2.2.18 and mHtt2.3.42 were seen to bind to the same site on the protein surface, as seen by the significant loss of fluorescence intensity of GST-51Q-httmHtt2.2.18 complex when challenged with unlabeled mHtt2.3.42 (Figure 3c). This did not result in attenuated inhibitory activity of the aptamer pair (Figure 3a), probably indicating that the concentration of the aptamer is also important for its inhibitory activity. On the contrary, no displacement was seen in case of competition between mHtt2.2.47 and mHtt2.3.42 (Figure 3c), indicating that the two aptamers bind to different regions on the surface of the protein. Similarly, mHtt2.2.18 and mHtt2.3.08 probably bind to different sites on the protein surface, thus retaining the fluorescence intensity of the GST-51Q-htt-labeled mHtt2.2.18 complex on the nitrocellulose membrane (Figure 3d). We next employed dynamic light scattering to determine the step at which aptamers disrupt aggregation of GST-51Q-htt. The average sizes of the final population formed at different time points, viz. during oligomerization (15 hours) (Figure 3e) and 1915



a

Aggregation, %

120

80

40

0

C

2.2.47 2.2.18 2.3.08 2.3.42 2.2.47 2.2.47 2.2.47 2.2.18 2.2.18 2.3.08 + + + + + + 2.2.18 2.3.08 2.3.42 2.3.08 2.3.42 2.3.42

c

Intensity retained, %

b

d

120 80

Labeled 2.2.47 Labeled 2.2.18

40

Labeled 2.2.47 Labeled 2.2.18

Labeled 2.2.18

0 0

0

100 200 300 400 500 600 700

100 200 300 400 500 600 700 Unlabeled 2.3.08, ng

Unlabeled 2.3.42, ng

e

f 50

Mean intensity, %

0

100 200 300 400 500 600 700

Unlabeled 2.2.18, ng

51Q-htt, 60 hours

51Q-htt, 0 hours

30

40 51Q-htt+2.2.18+2.3.08 51Q-htt, 15 hours 51Q-htt+2.2.47+2.3.42 51Q-htt+2.2.18+2.3.42

30 20

51Q-htt+2.2.18+2.3.08

20 51Q-htt+2.2.47+2.3.42

10

10 0

51Q-htt+2.2.18+2.3.42

1

10

100

1,000

0

1

10

Size, nm

100

1,000

Size, nm

g Aggregation, %

120

2.2.47+2.3.42

2.2.18+2.3.42

80

40

0

15 hours

60 hours

15 hours

60 hours

Time of addition of aptamers

Figure 3 Inhibition of aggregation of GST-51Q-htt by a combination of RNA sequences. (a) GST-51Q-htt was incubated with one (empty bars) or two (gray bars) aptamers as indicated, at a ratio of 1:1 (w w−1, protein:aptamer) and the extent of aggregation was monitored as described in the legend to Figure 2a. Values shown are mean ± SEM of three independent experiments. ***P < 0.001, **P < 0.005, *P < 0.05 against control (incubated without RNA sequences, c, filled bar). Displacement assay was carried out to determine the overlap of binding sites of the aptamers on the surface of the polyglutamine stretch. Densitometric analysis of the retained fluorescence intensity of the RNA-protein complex was carried out using ImageQuant TL software (GE Healthcare). Results are shown for increasing amounts of unlabeled (b) 2.2.18, (c) 2.3.42, and (d) 2.3.08 aptamers, in the presence of constant amount (70 ng) of fluorescein-labeled aptamers, as indicated. The fluorescence intensity of the RNA-protein complex in the absence of any unlabeled aptamer has been arbitrarily assigned a value of 100% in each case. Measurement of mean particle size of GST-51Q-htt by dynamic light scattering after (e) 15 hours and (f) 60 hours of incubation at 37 °C in the absence and presence of different aptamers. Size represents diameter of particles. (g) The ability of aptamers to reverse aggregation was measured by adding a pair of aptamers after incubation of GST-51Q-htt for 15 and 60 hours (as indicated) at 37 °C separately. GST-51Q-htt-RNA complexes were incubated for a further 5 hours (empty bars) or 11 hours (gray bars). In case of control (filled bar), an equivalent volume of diethylpyrocarbonate water was added instead of RNA sequences. The extent of aggregation was monitored as described in the legend to Figure 2a. Intensity of the control sample (incubated without RNA sequences, c, filled bar) was assigned a value of 100% in all cases. Values shown are mean ± SEM of three independent experiments.

1916

www.moleculartherapy.org vol. 23 no. 12 dec. 2015



at the end of the aggregation period (60 hours) (Figure 3f) were measured. The mean size of monomeric GST-51Q-htt was found to be ~7.7 nm (Figure 3e). Following incubation for 15 hours, the mean size of the population increased to ~280 nm. In the presence of a mixture of mHtt2.2.18 and mHtt2.3.08, the average size of the major peak was ~12 nm after 15 hours, i.e., no significant change in the mean size of the native protein was seen. With a mixture of mHtt2.2.18 and mHtt2.3.42 or mHtt2.2.47 and mHtt2.3.42, the average size of the particles was found to be ~32 nm after 15 hours (Figure 3e). This was still significantly lower than the mean size of oligomeric species formed in the absence of any aptamer. At the end of 60 hours, the mature aggregates exhibited a mean size of ~685 nm (Figure 3f). In the presence of a mixture of mHtt2.2.18 and mHtt2.3.42, a second peak, with significant intensity (81%), appeared at ~20 nm. Even in the presence of a mixture of mHtt2.2.18 and mHtt2.3.08 or mHtt2.2.47 and mHtt2.3.42, peaks at lower mean particle sizes of ~44 nm (75%) and ~40 nm (33%), respectively, were seen. Combined with the observations with the oligomer-specific A11 antibody (Figure 2b), these results suggest that the aptamers stabilize the monomeric native state of the protein and inhibit the

formation of oligomers and higher order aggregates, thus slowing down the process of aggregation. In order to determine if the selected aptamers are able to reverse aggregation, pairs of aptamers were added to GST-51Q-htt after aggregation had commenced. No significant difference in the extent of aggregation could be seen between the control (without aptamer) and the protein to which aptamers had been added after aggregation had proceeded for 15 hours (formation of oligomers) or 60 hours (formation of mature fibrillar species) (Figure 3g), indicating the inability of the selected aptamers to dissociate preformed oligomers/aggregates. GST-51Q-htt-specific aptamers have negligible affinity for the aggregated protein, against which they have not been selected (Figure 2e). This confirms the fidelity of the selected aptamers for the monomeric protein.

Presence of aptamers reduces porosity of liposomes due to GST-51Q-htt aggregation Liposomes have been used as mimics of biological membranes to study protein-bilayer interactions. Liposomes were prepared by thin film hydration method.25 The average size (Zav) of liposomes was determined to be 164.2 nm (Nano ZS, Malvern Instruments,

200

$$$

150

@@@

$$$

$$$

***

200

@@@

100

***

***

$

*** $

**

100 0

50

Control

Oligomers+ aptamer

e

Fluorescence intensity, a.u.

c

0

Fibrils+ aptamer

100 GAPDH+aptamer/GAPDH, %

***

300

mHtt2.3.42


***

mHtt2.3.08

***

250

mHtt2.3.08

b mHtt2.3.42

a

80

3

6

9

300

*** $$$

200

*** $$$

N.S. 100

0

$$$

3

6

9

d

60

300

40

***

@@@

200

***

20 0

0

10

20 Incubation time, hours

30

40

0

@@

**

100

@

3

6

9

Incubation time, hours

Figure 4 Effect of RNA aptamers on aggregation of GST-51Q-htt. (a) Release of encapsulated fluorescein dye from liposomes was monitored in the presence of monomeric (filled bar), oligomeric (empty bars) or fibrillar (gray bars) GST-51Q-htt incubated in the absence and presence of mHtt2.3.42 (striped bars) and mHtt2.3.08 (dotted bars) for 20 minutes at 37 °C. (b) Monomeric, (c) oligomeric, and (d) fibrillar GST-51Q-htt were incubated with rat RBCs in the absence and presence of mHtt2.3.42 for different time periods at 37 °C and oxidative stress in RBCs was measured using DCFH-DA assay. Values shown are mean ± SEM of three independent experiments. ***P < 0.001, **P < 0.01 against the corresponding monomeric GST-51Q-htt, $$$P < 0.001, $P < 0.05 against oligomeric GST-51Q-htt (in the absence of aptamer), @@@P < 0.001, @@P < 0.01, @P < 0.05 against fibrillar GST-51Q-htt (in the absence of aptamer). (e) Densitometric analysis of the dots obtained (in Supplementary Figure S5c) was carried out with ImageQuantTL software (GE Healthcare). The ratio of intensities (of GAPDH-His6 sequestered by GST-51Q-htt with and without mHtt2.3.42) at the initial time point was assigned a value of 100%. The ratio of intensities at each time point is calculated with respect to this value. Values shown are mean ± SEM of three independent experiments.


1917



UK), with a polydispersity index of 0.197. The average zeta potential of the particles was found to be −39.8 mV, indicating strong repulsive forces which prevent aggregation of liposomes and keep them in suspension. When liposomes were incubated with either oligomers or mature fibrils of GST-51Q-htt, significant increase in the leakage of the encapsulated fluorescein dye was seen after 20 minutes as compared to their incubation with the monomeric protein (Figure 4a). In the presence of GST-51Q-htt preincubated with aptamers mHtt2.3.42 or mHtt2.3.08 for 15 or 60 hours, and where aggregation was reduced (Figure 2a,b), the amount of fluorescein which leached into the supernatant was reduced (Figure 4a), indicating decreased permeabilization of liposomes in the presence of both oligomeric and fibrillar GST-51Q-htt.

Presence of aptamers reduces oxidative stress in cells Mitochondrial impairment and increased intracellular oxidative stress are hallmarks of HD.14,26 Whether mitochondrial dysfunction is a cause or effect of the disease is still not clear. Elevated levels of reactive oxygen species (ROS) have been observed in HeLa cells expressing pathogenic polyglutamine tracts.26 The oligomeric species and mature fibrils were found to induce the formation of a significantly higher level of ROS in RBCs with time as compared to the monomer (Figure 4b). The level of oxidative stress was lower in

a

1

case of mature fibrils than the protofibrillar oligomeric species at all time points, correlating well with the hypothesis that the protofib rillar intermediate, rather than the fibrillar aggregates, is the more toxic species.22 When the monomeric protein was preincubated with the aptamer mHtt2.3.42 for the same period (15 hours) as that required for the formation of the oligomeric species (Figure 1d) and then incubated with RBCs, significantly lower level of oxidative stress was observed in the cells (Figure 4c) as the aptamer was able to inhibit oligomerization. In fact, at a shorter time interval (i.e., 3 hours with RBCs), the oxidative stress in the presence of the aptamer was reduced to a level which was similar to that with the monomeric protein (basal value). A similar result was seen with mature fibrils. When preincubated with the aptamer mHtt2.3.42 for 60 hours, the amyloid fibres showed significant reduction of ROS in RBCs (Figure 4d). Since the presence of aptamers inhibits the formation of pores in liposomes due to inhibition of aggregation (Figure 4a), this is likely to reduce oxidative stress in cells.

Aptamers inhibit sequestration of GAPDH by GST-51Q-htt Several proteins are sequestered by the growing aggregate of mhtt and depletion of these proteins from the cellular milieu contributes to toxicity in such cells.27,28 One such protein is the glycolytic

10

20

30

40

2.2.17 2.3.24 2.2.25 2.3.07 2.2.18 2.4.08 2.2.47 2.3.08 2.3.21 2.3.43 2.3.42 Consensus

b

1

20

10

39

30

2.2.18 2.2.47 Consensus C C

C

6

A

A

C A U A

A A

G C

3

10

20

30

39

2.3.42 2.2.47 Consensus

A

C G

50

1

60

A

A

70

C

A

A

U C

G U C

G

C C

G

G

4

C

G

A

C G C

mHtt2.2.18 (−9.67 kcal mol−1)

30

A

1

2 A C A G G A A G A U A G C A U C 10 A A A 20 U 5 G A C 40 G G U G C A G C A U C A

A

G

3′ 50

C C C

C C

6

50

C A A

A 70

1

C G 60 C C G G C A U G A A C A A C A G G U C A 2 A 3 C A G A C A G AG G C C U C A A 10 G 4 U 40 A C A G 20C C C C C G G A 5 A U U A U A A A C

5′

G A

30

mHtt2.2.47 (−4.73 kcal mol−1)

A

A

3′ U G A

G 5′

30

A

A A A

A

40

A

A A G

G G C U C C G A C

C A A

A

20

10

G

C G U C U G A C A G

A G A G A

G C A

G

G C

C C

G

C

C A A

60

A C G U C

G

A A C A

5′

U G

70 C G G

C

A G A

A

3′

mHtt2.3.42 (−6.04 kcal mol−1)

Figure 5 Analysis of sequence similarity among RNA aptamers. (a) The randomized regions of RNA aptamers were aligned using Multalin software.49 (b) Structural similarities between mHtt2.2.47, mHtt2.2.18, and mHtt2.3.42 are shown. Secondary structures of the complete sequences (variable and conserved regions) were predicted by m-fold software.30 The values in parentheses below the figures show the free energy changes of the predicted structures at 37 °C. The consensus regions obtained using Multalin are shown for comparison.

1918




enzyme, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), which was one of the first proteins identified to interact with the mutant but not normal polyQ length htt.27 We expressed and purified GAPDH-His6 as per the reported protocol29 (Supplementary Figure S5a,b). Purified GAPDH was incubated with GST-51Qhtt (preincubated with and without the RNA aptamer mHtt2.3.42 for 1 hour at 25 °C) for different time periods. In the absence of RNA aptamers, a higher fraction of GAPDH was retained on the membrane indicating its sequestration by aggregates of GST51Q-htt (Figure 4e and Supplementary Figure S5c). When GST-51Q-htt was incubated in the presence of mHtt2.3.42, lower

a

103Q+E.V.

25Q+E.V.

amount of GAPDH was retained by the membrane (Figure 4e and Supplementary Figure S5c). As the aggregation of GST-51Q-htt was reduced in the presence of aptamers (Figure 3a), depletion of GAPDH from solution was rescued. In a cellular context, this would mean that GAPDH becomes available to carry out its functions.

Sequence analysis of RNA aptamers In order to understand the reason for the difference in inhibitory effects, the RNA aptamers were sequenced (Figure 5a). Although some consensus regions were present, distinct motifs could not

b

103Q+2.2.47

1

2

3

4

5

6

7

8

9

10 11 12 13 RFP signal

RFP

10 µm

10 µm

10 µm

Fold solubilization

c

DIC 10 µm

10 µm

10 µm

**

*

*

2

* 1 0

Empty 2.2.17 2.2.18 2.2.25 2.2.47 2.3.08 2.3.21 2.3.24 2.3.42 2.3.43 2.4.08 vector

e 200

*** 100

***

100

***

40

***

300

***

*** 200

***

***

100

8 .2

.1

8 2.

2.

47

+2

.2

.1

8 2.

3.

42

+2

.2

.1

8 .1

+2

.2 21 2.

2.

160

***

120

***

***

***

80

40

.2 .1 8

18

8+ 2 3. 0

2.

2.

18 +

2.

2.

18 2.

3.

21 +

2.

2.

18 2. 2. 2.

42 + 3. 2.

2.

2. 4

7+ 2

.2 .1 8

N I+

8 .2

.1

8 2.

2.

47

+2

.2

.1

8 42 2.

3.

+2

+2

.2

2. 2.

3.

21

18 +

2.

.2 2. 2.

+2 08

.1

18

8 .1

N I I+ N

3. 2.


I

0

0

N


400

+2

.2 +2 08 3.

2.

g

500

3.

I

8

0

2.3.08 2.2.18 2.3.21 2.3.42 2.2.47

Number of viable colonies/ 1,000 cells

f

***

***

20

N I+

NI

***

***

N

0

***

.1

***

50

60

18

***

80

2.

150

Relative intensity, %

Number of viable colonies/1,000 cells

d

3

1919


be identified. The secondary structures of the sequenced aptamers were predicted using mfold30 (Supplementary Figure S6). Comparison of predicted structures of mHtt2.2.18, mHtt2.2.47, and mHtt2.3.42 showed a high degree of similarity (Figure 5b). A conserved motif of four consecutive cytosines was seen at the 3’-end of all of these sequences. This consensus region, giving rise to a loop (Figure 5b), may be important in binding to the aggregation-prone polyglutamine tract but will require further experiments. SimTree analysis confirmed the high degree of topological similarity among RNA sequences which acted as inhibitors and the lower level of similarity between such sequences and the one which acted as a noninhibitor (Supplementary Table S3). This is clear from a direct comparison of the similarity scores among the inhibitors mHtt2.2.47, mHtt2.2.18, mHtt2.3.43, and with the noninhibitor mHtt2.3.07 (Supplementary Table S2). The similarity score between the inhibitors was significantly higher than the score between the inhibitor and the noninhibitor.

Expression of “intramers” in yeast Although the cut-off threshold was rather low (≥20% inhibition of aggregation in vitro), the ability of these RNA aptamers to function as inhibitors inside the cell (“intramers”) was determined. The aptamers were expressed in Saccharomyces cerevisiae BY4742 cells. The aptamer sequences were cloned into pWHE601 vector31 (Supplementary Figure S7a). The integrity of the constructs was confirmed by specific amplification of the inserted sequence (Supplementary Figure S7b). Following transformation, expression of aptamers was confirmed by fluorescence microscopy (Supplementary Figure S7c). Intracellular RNA was subjected to reverse transcription-polymerase chain reaction (PCR) using primers designed to amplify the starting library (L2-f and L2-r) (Supplementary Figure S7d). For expression of human mhtt fragment (103Q-mRFP) under the control of CUP1 promoter, yeast cells were transformed with pRS315-CUP1-103Q-htt-mRFP and induced with Cu2+. 103Q-htt was expressed in the aggregated form as seen under a fluorescence microscope (Figure 6a). When these cells were cotransformed with an aptamer-expression vector, the protein was expressed in the soluble form (Figure 6a).


The cells were lysed and native PAGE analysis of the lysates was carried out (Figure 6b). pRS315-CUP1-103Q-htt-mRFP was also transformed in an isogenic ΔHsp104 strain where the protein harboring the elongated polyQ tract is expressed in the soluble form18 (Supplementary Figure S8a). This acts as a marker for the position of soluble monomeric 103Q-htt. Significant increase in the intensities of the bands for the soluble monomeric 103Qhtt was seen in the case of cells transformed with plasmids expressing mHtt2.2.47, mHtt2.3.08, mHtt2.3.21, and mHtt2.3.42 (Figure 6b,c). Thus, aggregation of 103Q-htt could be inhibited significantly and the fraction of soluble 103Q-htt increased by two- to threefold as compared to cells expressing 103Q-htt alone (without aptamer). Thus, although the primary selection was carried out against a GST-tagged protein, and the affinity of the selected aptamers was lower for 103Q-htt as compared to 51Qhtt (Figure 2c,d), the selected aptamers recognized the elongated polyQ stretch efficiently enough to inhibit aggregation inside yeast cells. When yeast cells cotransformed with pRS315-25Q/103Q-httmRFP and empty vector/RNA aptamers were plated on raffinose alone (only the aptamer was expressed), maximum growth was seen (Supplementary Figure S8b). On expression of 25Q-httmRFP (in the presence of CuSO4, along with empty vector), cell viability decreased marginally. On expression of 103Q-htt-mRFP (along with empty vector), the viability of yeast cells decreased (Supplementary Figure S8b), correlating with aggregation of the protein observed in these cells. When coexpressed with aptamers, however, the viability of cells expressing 103Q-htt-mRFP improved, with more colonies being observed at the lowest dilution as compared to the cells transformed with 103Q-htt and empty vector (Supplementary Figure S8b). This corresponded well with the higher solubility of the protein in the presence of aptamers (Figure 6c) and confirmed the beneficial effect of increased solubilization on cell survival. The increased viability of cells was quantified by counting the number of single colonies formed when yeast cells coexpressed 103Q-htt and aptamers. Minimum growth was seen in the case where 103Q-htt was coexpressed with a noninhibitor sequence (NI, mHtt2.3.07), i.e., where 103Q-htt formed aggregates.

Figure 6 Effect of intramers on solubility of 103Q-htt-mRFP in yeast cells. (a) Yeast cells were contransformed with constructs for expression of 103Q-htt-mRFP and aptamers as described in Methods section. Aggregation pattern was monitored by fluorescence microscopy. Cells expressing either 25Q-htt-mRFP or 103Q-htt-mRFP and empty vector pWHE601 (E.V.) or aptamers were analysed by fluorescence microscopy. Representative result with one RNA aptamer (mHtt2.2.47) is shown. Bar = 10 μm. (b) Native PAGE analysis of 103Q-htt-mRFP expressed in the presence of RNA aptamers in yeast cells (intramers). The gel was scanned with an image scanner (Typhoon Trio, GE Healthcare), using ex = 532 nm, em = 610 nm. 103Q-htt-mRFP expressed in the presence of Lane 1: alone; Lane 2: mHtt2.2.17; Lane 3: mHtt2.2.18; Lane 4: mHtt2.2.25; Lane 5: mHtt2.2.47; Lane 6: mHtt2.3.08; Lane 7: mHtt2.3.21; Lane 8: mHtt2.3.24; Lane 9: mHtt2.3.42; Lane 10: mHtt2.3.43; Lane 11: mHtt2.4.08; Lane 12: empty vector (pWHE601); Lane 13: Saccharomyces cerevisiae BY4742 ∆Hsp104 strain. (c) The intensities of the bands for 103Q-htt-mRFP on native PAGE were quantified by densitometry (Image Quant TL, GE Healthcare). An arbitrary value of 1 was assigned to the band intensity for 103Q-htt-mRFP coexpressed with the empty vector. Values shown are mean ± SEM of three independent experiments. **P < 0.01, *P < 0.05 against the intensity of the band in cells coexpressing 103Q-htt-mRFP and empty vector (pWHE601). (d) Viability of yeast cells coexpressing 103Q-htt and noninhibitor (NI) or the indicated aptamer was determined by comparing colony forming units in each case. Values shown are mean ± SEM of three independent experiments. ***P < 0.001 against cells coexpressing 103Q-htt and NI. (e) Extent of aggregation in cells coexpressing 103Q-htt and a pair of noninhibitors (NI+NI) or aptamers, as indicated, was monitored by solubilization with formic acid. Cell pellets were incubated in 100% formic acid for 30 minutes at 37 °C and diluted (1:150) in lysis buffer. Samples were centrifuged and supernatants obtained were filtered through a nitrocellulose membrane. The blot was probed with anti-polyglutamine antibody. A representative blot is shown. An arbitrary value of 100% was assigned to the intensity of dot obtained for 103Q-htt-EGFP coexpressed with a pair of noninhibitors (NI+NI). Values shown are mean ± SEM of three independent experiments. ***P < 0.001 against cells coexpressing 103Q-htt and a pair of noninhibitors (NI+NI). (f) Measurement of oxidative stress in cells coexpressing 103Q-htt and a pair of noninhibitors (NI+NI) or aptamers, as indicated, using DCFH-DA. Values shown are mean ± SEM of three independent experiments. **P < 0.005, ***P < 0.001 against cells coexpressing 103Q-htt and a pair of noninhibitors (NI+NI). (g) Viability of yeast cells coexpressing 103Q-htt and a pair of noninhibitors (NI+NI) or aptamers, as indicated, was determined by comparing colony forming units in each case. Values shown are mean ± SEM of three independent experiments. ***P < 0.001 against cells coexpressing 103Q-htt and a pair of noninhibitors (NI+NI).

1920



b

FM4-64

EGFP

FM4-64

103Q-htt

25Q-htt

EGFP

103Q-htt+2.3.07 103Q-htt

25Q-htt+2.2.47 103Q-htt+2.3.07 (non-inhibitor)

103Q-htt+2.2.47

103Q-htt+2.3.07

103Q-htt

20 minutes


a

10 minutes

c Fraction of htt-positive cells showing internalization of FM4-64

Increased solubilization in the presence of aptamers (Figure 6c) was accompanied by significant increase in cell viability in the presence of aptamers (Figure 6d). Expression of aptamers alone had no effect on yeast cell viability (data not shown). Although no direct correlation was found between increased solubility and cell viability with individual aptamer(s), indicating that factors other than protein aggregation may be involved in determining growth/ viability of cells expressing mutant huntingtin fragment,32 the beneficial effect of the presence of aptamers is obvious. Next, the effect of a combination of aptamers on aggregation of mhtt in yeast cells was studied. Similar to results obtained in vitro, significant decrease in aggregation of 103Q-htt was observed with different combinations of aptamers, using formic acid solubilization assay (Figure 6e). This reduction in protein aggregation was accompanied by reduction in intracellular oxidative stress (Figure 6f). Compared to the control cells expressing 103Q-htt and a pair of noninhibitor sequences (NI+NI) where aggregation was the highest (Figure 6e), the presence of aptamers rsulted in significant decrease in the level of ROS, confirming increased solubilization of 103Q-htt. Significant increase in viability of yeast cells was also observed upon solubilization of 103Q-htt with all combinations of aptamers (Figure 6g) except when the aptamer sequence 2.2.18 was expressed from two different expression plasmids. This decrease in viability was not due to reduced solubilization of 103Q-htt (Figure 6e). It was also not due to the high level expression of short RNA sequences as the same constructs were used to express other pairs of aptamer sequences. Thus, it seems likely, as has been briefly referred to above,32 that the survival of cells expressing mutant huntingtin may be a result of features other than proteotoxic aggregates alone. In order to determine if expression of 103Q-htt in the soluble form had any physiological relevance, the effect of the aptamer on cellular function was monitored. Huntingtin is a putative partner of the cellular protein trafficking machinery.33 Interaction of mutant huntingtin with the phospholipid bilayer disrupts vesicular transport.34 As liposome leakage studies had shown that aptamers are able to partially reverse the deleterious effects of aggregation of mhtt (Figure 4a), the lipophilic styryl dye FM4-64 was used to monitor defects in cellular trafficking due to aggregation of mhtt.19 Endocytosis was delayed in cells expressing aggregates of 103Q-htt. While cells expressing 25Q-htt showed internalization of the dye within 5 minutes of addition, the same was not observed in cells expressing 103Q-htt (Figure 7a). In the case of the latter, the dye was internalized only after 20 minutes of incubation (Figure 7b), indicating a defect in the mechanism of endocytosis in the presence of protein aggregates. In cells coexpressing 103Q-htt and RNA aptamers, endocytosis of the dye occurred within 5 minutes of incubation (Figure 7a). The presence of RNA aptamer alone does not interfere with trafficking within the cell as the process of endocytosis was not affected in the case of cells coexpressing 25Q-htt and inhibitor RNA aptamer (Figure 7a,c). Importantly, this also confirmed that the activity of the normal protein (in a heterozygous system) is not affected by the presence of the RNA aptamer, which is specific in its recognition of the elongated polyglutamine stretch of mhtt. That the beneficial effect is due to solubilization of 103Q-htt was clear from the fact that in the presence of a noninhibitor sequence where the protein was expressed in the aggregated form, endocytosis continued to be delayed.


N.S.

N.S.

100

### N.S.

80 60 40 N.S.

20 0

*** –I

+I

– NI

+ NI

+I

5 minutes

– NI

+ NI

20 minutes

Incubation with FM4-64

Figure 7 Aptamers rescue defect in endocytosis in yeast cells expressing 103Q-htt. Yeast cells were induced to express either 25Q-htt-EGFP or 103Q-htt-EGFP. (a) Endocytosis was monitored by internalization of the lipophilic dye FM4-64 after 5 minutes of incubation of the induced cells with the dye, as described in the Methods section. Internalization of the dye was monitored in cells expressing 25Q-htt or 103Q-htt-EGFP or in cells coexpressing 25Q-htt or 103Q-htt-EGFP and mHtt2.2.47 (inhibitor) or 103Q-htt and mHtt2.3.07 (noninhibitor); λex = BP 510–560 nm, λem = BA 590 nm for FM4-64. Bar = 10 μm. (b) Endocytosis was monitored by internalization of the lipophilic dye FM4-64 by yeast cells coexpressing 103Q-htt and mHtt2.3.07 (noninhibitor) after 10 (upper two panels) or 20 (lower two panels) minutes of incubation of the induced cells with the dye. (c) Comparison of internalization of FM4-64 in yeast cells expressing 25Q-htt-EGFP (empty bars) or 103Q-htt-EGFP (filled bars) in the presence or absence of inhibitor (I, mHtt2.2.47) or noninhibitor (NI, mHtt2.3.07) sequences after incubation for 5 or 20 minutes. 100% value on y-axis assumes that all the cells expressing either 25Q-htt or 103Q-htt-EGFP have internalized FM4-64. Twenty fields, each containing 40–50 cells, were counted in each case. Values represent mean ± SEM of three independent experiments. ***P < 0.001 against cells expressing 25Q-htt-EGFP (without RNA sequence) incubated with the dye for the same time period; ###P < 0.001 against cells expressing 103Q-htt-EGFP (without RNA sequence) incubated with the dye for the same time period; N.S., nonsignificant.

DISCUSSION

Our work shows that some RNA aptamers which bound to the elongated polyglutamine stretch of huntingtin with high affinity were able to inhibit the aggregation of the protein in vitro. 1921


The aptamers succeeded in decreasing membrane permeabilization with concomitant reduction in intracellular oxidative stress. They were also able to inhibit sequestration of an essential cellular enzyme, viz. GAPDH. When expressed in yeast cells, some of these RNA intramers were able to inhibit aggregation of 103Qhtt. This led to the enrichment of the target protein in the soluble fraction of the lysate and was beneficial in restoring cellular function. Unlike some other neurodegenerative diseases, HD is a monogenic, autosomal dominant disorder wherein a single copy of the mutant allele is sufficient to predict the onset of the disease and to precipitate symptoms. Hence aptamers are a logical tool to slow down the progress of the disease by inhibiting the primary aggregation step. It is difficult to pinpoint the genesis of HD. While some reports have indicated that the altered conformation of the monomeric mutant huntingtin fragment into a β-sheet-rich toxic species is responsible for the disease,35 others have implicated nucleation or formation of oligomeric “seed” as the rate determining step of aggregation.36 Still others have shown that the downstream effects of aggregation, including a compromised proteostasis machinery,27,28 resulted in deleterious effects and attenuated cellular response. Oligomeric intermediates of many proteins form annular structures and are inserted into the lipid bilayer of the cell membrane, leading to cell death by allowing seepage of cytosolic components.22 Polyglutamine tracts of disease-causing length (40Q) have been shown to form selective ion channels in an artificial planar lipid bilayer membrane in vitro whereas a shorter (29Q) stretch had no effect.37 Since pathology of protein misfolding diseases is associated with increased porosity of cell membrane,22 reduced porosity in the presence of aptamers indicates beneficial effect of the aptamer(s) on the aggregation of mutant huntingtin protein fragment. Increased membrane permeabilization by the annular oligomeric species is also responsible for intercellular transmission mutant huntingtin aggregates,38 a mechanism which has been observed in other protein misfolding-associated neurodegenerative diseases.39 The partial solubilization of elongated polyQ stretch in the presence of the RNA aptamer was able to rescue the defect in endocytotic machinery seen due to aggregation of 103Q-htt. A similar defect in endocytosis has been seen in cultured mammalian cells (HEK293) expressing 103Q (same construct as used here, under the constitutive CMV promoter).19 Thus, the rescue of endocytosis in the presence of aptamers described here is relevant to the mammalian system as well. Any strategy that can retain the monomeric form of the native protein should be able to preserve cellular homeostasis and ameliorate cytotoxicity. Monoclonal antibodies have been proposed to stabilize the native conformation of the protein and inhibit its fibrillation.3,5 For example, the mAb 1C2, which specifically recognizes the expanded polyQ stretch in mutant huntingtin, was shown to inhibit its aggregation in a dose-dependent manner.5 It has been proposed that elongation of the polyQ tract beyond the normal threshold results in an ordering of the random coils to H-bonded hairpin structure, which go on to form the cross β-sheet fibrillar structure.40 This conformational change upon expansion of polyQ tract has also been seen by FRET studies.23 Since 1C2 was able to bind to the polyQ stretch of 51Q-htt but not amyloid fibrils, it was suggested that the mAb stabilizes the native conformation of 1922


huntingtin and inhibits its aggregation.5 The selected aptamers in the present case also recognize and bind to the longer homopolymeric stretch of the mutant protein and not to the amyloid fibrils. Combined with the observations using dynamic light scattering, our results provide support for the above hypothesis. As HD is caused by a single mutation at a well-defined locus,1 it is a particularly attractive target for gene-modifying approaches. Intrastriatal infusion of cholesterol-conjugated siRNA targeting huntingtin in a mouse model of HD led to amelioration of certain disease symptoms.41 Some instances of cytotoxicity due to viral transfection of siRNA have been reported which could be circumvented using miRNA.42 Allele-selective suppression of mhtt expression has also been attempted by RNase H-active antisense oligonucleotides (ASOs) targeting a single nucleotide polymorphism associated with CAG expansion (rs7685686_A in intron 42 of huntingtin gene).43 Dose-dependent downregulation of mRNA and protein levels of mhtt was achieved in patient-derived fibroblasts as well as Hu97/18 transgenic mice. Behavioural studies were not presented. Unlike other nucleic acid-based therapeutics which rely on sequence complementarity, aptamers recognize and bind to their targets via shape/ structural complementarity. As such, a direct comparison of the two strategies is difficult as the former creates a non-natural milieu in which the celllar protein is not translated at all, and protein aggregation, a major determinant of pathogenicity, is not observed. In HD, the cleaved N-terminal fragments of huntingtin form intranuclear as well as cytoplasmic aggregates.44 The distribution delineates the functional aberrations associated with the disease. Our results show aptamer-induced inhibition of formation of cytoplasmic inclusions. Delivery of aptamers to intracellular targets is challenging, especially inside the nucleus. A few studies have reported such attempts. For example, the expression of RNA aptamers has been directed to the nucleus by expressing them under the control of the U6 snRNA promoter and its transcriptional terminator.45 Polysaccharides like arabinogalactan have been used to target nuclear vimentin in an adenocarcinoma mouse model,46 where it induced apoptosis in ascites adenocarcinoma cells and suppressed carcinoma growth. Inhibition of polyglutamine repeat-induced aggregation by nucleic acid aptamers, whether cytoplasmic or nuclear, could provide a treatment strategy for Huntington’s disease.

MATERIALS AND METHODS

Materials. Saccharomyces cerevisiae BY4742 strain (MATα his3Δ1 leu2Δ0

lys2Δ0 ura3Δ0, [RNQ1+]), a product of Open Biosystems, was purchased from Saf Labs Pvt. Ltd., Mumbai, India. Taq DNA polymerase, Moloney murine leukemia virus reverse transcriptase (M-MLVRT), Wizard SV Gel and PCR Clean-Up System and pGEM-T vector kit were purchased from Promega Corporation, Madison, WI. RNase-free DNase I, T7 RNA polymerase, and inorganic pyrophosphatase (from yeast) were purchased from Fermentas, MD. Oligomer-specific A11 polyclonal antibody, FM4-64, and RNaseOUT (recombinant ribonuclease inhibitor) were purchased from Invitrogen Corporation, CA. Fluorescein RNA labeling mix was purchased from Roche Applied Science, Penzberg, Germany. Nitrocellulose membrane (0.45 μm) was purchased from Bio-Rad Laboratories Pvt. Ltd., Gurgaon, India. Cellulose acetate membrane (0.2 μm) was purchased from Sartorius Stedim Biotech GmbH, Goettingen, Germany. Cholesterol was purchased from SRL Pvt. Ltd., Mumbai, India. Soy lecithin was obtained as a gift from Cargill (Malaysia) Sdn Bhd, Kuala Lumpur, Malaysia. Mouse polyglutamine www.moleculartherapy.org vol. 23 no. 12 dec. 2015


antibody (polyglutamine-expansion disease marker monoclonal antibody 1C2, MAB1574) was a product of Chemicon International, and was purchased from Millipore (India) Pvt. Ltd., New Delhi, India. fluorescein isothiocyanate (FITC)-conjugated GST monoclonal antibody was purchased from Santa Cruz Biotechnology (Dallas, TX). Dichlorodihydrofluorescein diacetate (DCFH-DA) was purchased from Cayman Chemical Company (Ann Arbor, MI). Formic acid and amino acids for amino acid dropout mixture were purchased from Sisco Research Laboratory (SRL) Pvt. Ltd., Mumbai, India. Anti-FLAG M2 affinity gel, FITC-conjugated mouse antibody His6 antibody, and fluorescein sodium were purchased from Sigma-Aldrich, Bangalore, India. Goat anti-mouse horseradish peroxidase-conjugated antibody and tetramethylbenzidine/hydrogen peroxide substrate were obtained from Bangalore Genei, Bangalore, India. pRSII423 was a gift from Prof. Steven Haase (Addgene plasmid # 35464). All solutions were prepared in diethylpyrocarbonate (DEPC)-treated water unless stated otherwise. Methods Expression and purification of GST-51Q-htt. Competent E. coli BL21

(DE3) cells were transformed with plasmid pGEX-5X1-HDex1-CAG20 or pGEX-5X1-HDex1-CAG51 for expression of GST-fused wild-type (20Q-htt) or mutant (51Q-htt) huntingtin fragment (exon1), respectively. Expression and purification of proteins was carried out as described before.2 The purified protein was dialyzed against 0.04 M TrisHCl buffer, pH 8.0 containing 150 mmol/l NaCl to remove reduced glutathione. Filter retardation assay. Mutant huntingtin protein (51Q-htt, 1 mg ml−1)

was incubated at 37 °C. Aliquots (30 μg each) were withdrawn at regular intervals, vacuum-filtered through a prewetted cellulose acetate or nitrocellulose membrane and probed with either polyglutamine monoclonal antibody or oligomer-specific A11 polyclonal antibody, respectively. The membrane was scanned on an image scanner (Typhoon Trio, GE Healthcare, Uppsala, Sweden) operated in the fluorescence mode. The intensity of dots, indicating retention of aggregates on the cellulose actetate membrane or retention of oligomers on the nitrocellulose membrane, was quantified using Image Quant TL software (GE Healthcare, Uppsala, Sweden). The values were fitted into the equation for a sigmoidal curve (Boltzmann function) using the equation,47

y = y i + mx i +

y f + mx f x − x0 1+ e τ

where yi + mxi is the initial line, yf + mxf is the final line and x0 is the midpoint of maximum signal. Western blotting. Samples were run on 12% crosslinked polyacrylamide gel and transferred electrophoretically to a nitrocellulose membrane. The presence of 20Q-htt or aggregation of 51Q-htt was confirmed using fluorescein isothiocyanate (FITC)-conjugated GST (1:500) or polyglutamine antibody (1:5,000), respectively, as the primary antibody. For the latter, goat anti-mouse HRP-conjugated antibody (1:2,500) was used as the secondary antibody. Thioflavin T fluorescence spectroscopy. Thioflavin T fluorescence assay was performed by mixing 50 μmol/l dye (stock solution of 1 mmol/l in dialysis buffer) and 1.5 μmol/l 51Q-htt (1.0 mg ml−1, 40 mmol/l TrisHCl buffer, pH 8.0, 150 mmol/l NaCl) in a reaction volume of 400 μl. Fluorescence intensity of the dye was measured by excitation at 440 nm (slit width 5 nm) and emission at 484 nm (slit width 5 nm). Transmission electron microscopy. Transmission electron microscopy

images were acquired using a transmission electron microscope (TF20, FEI) at 120 kV excitation voltage. Protein solution (6 μl) was placed on a formvar and carbon-coated grid and blotted off after 3 minutes. After staining with 2% uranyl acetate (3 μl), samples were dried and their morphology was observed.



Selection of RNA aptamers against mutant huntingtin protein. Two DNA libraries, 83 nt (designated as mHtt1) and 97 nt (designated as mHtt2) long were used, with 5' constant regions of 40 nt each and 3' constant regions of 23 nt (mHtt1) and 20 nt (mHtt2), respectively. The DNA library mHtt1 (83 nt) had a variable region of 20 nt while mHtt2 (97 nt) had a variable region of 37 nt. The libraries were designed in the laboratory and synthesized commercially (Sigma-Aldrich, Bengaluru, India). The DNA library, designated as mHtt1, (5′GATAATACGACTCACTATA GGGATAGGATCCACATCTACG(N)20AAGCTTCGTCAAGTCTGCAG TAA3′) was amplified by PCR using primers L1-f (5′GATAATACGACTCACTATAGGGATAGGATCCACATCTACG3′) and L1-r (5′TTACTG CAGACTTGACGAAGCTT3′). The DNA library, designated as mHtt2, (5′AATGCTAATACGACTCACTATAGGGAGAGAGAGACAGTC T(N)37AAGCAACGTCAACTCCAGAA3′) was amplified by PCR using primers L2-f (5′AATGC TAATACGACTCACTATAGGGAGAGAGAGACAGTCT3′) and L2-r (5′TTCTGGAGTT GACGTTGCTT3′). The amplified products of each DNA library were transcribed in vitro and resolved by 8% (w v−1) denaturing (8.3 M urea) polyacrylamide gel electrophoresis. RNA was extracted, precipitated by addition of cold 70 % (v v−1) ethanol and quantified spectrophotometrically at 260 nm. Gel purified RNA (40 pmol, from each of the starting libraries) was incubated with 25 μl of GST-coupled glutathione-agarose matrix (1:1 slurry with 40 pmol of immobilized protein) in 100 μl of selection buffer containing 2, 3, or 4 mmol/l MgCl2 in 50 mmol/l phosphate buffer, 150 mmol/l NaCl, pH 7.4, separately for 30 minutes (counter selection step) at room temperature. After centrifugation (1,000 g for 5 minutes), the supernatant containing RNA sequences which did not bind to GST/matrix was further incubated at room temperature with 15 μl of GST-51Q-htt-coupled glutathione agarose matrix (1:1 slurry with 40 pmol of immobilized target protein) for 30 minutes (positive selection). This suspension was centrifuged at 1,000 g for 5 minutes. The matrix was washed four times with the respective selection buffer. Finally, the matrix was incubated in 55 μl of deionized diethylpyrocarbonate-treated autoclaved water at 80 °C for 3 minutes to elute the target protein-specific RNA sequences. These were reverse transcribed to cDNA, amplified by PCR, subjected to in vitro transcription and purified as before. RNA (40 pmol each) from each library was used for the next four rounds of selection as described above (counter selection followed by positive selection). After the fifth round of selection, counter selection was carried out before the eighth round which was followed by two more rounds of positive selection. Determination of binding affinity. Enriched RNA libraries obtained above were reverse transcribed. Amplified products of the tenth round of selection were used as template DNA for in vitro transcription to generate the corresponding fluorescein-labeled RNA libraries using fluorescein RNA labeling mix according to manufacturer’s protocol. For determination of dissociation constant (Kd), fluorescein-labeled RNA was incubated with different concentrations of 103Q-htt-mRFP, GST-51Q-htt, or GST-20Q-htt in the respective binding buffer (50 mmol/l sodium phosphate, 150 mmol/l NaCl, pH 7.4, containing 2, 3, or 4 mmol/l MgCl2) in dark and vacuum filtered through a prewetted nitrocellulose membrane (which binds nonspecifically to all proteins). The intensity of dots on the blot was measured using Image Quant TL software (GE Healthcare, Uppsala, Sweden) and the values were fitted into a sigmoidal function as described before. The midpoint of the exponential portion of the sigmoidal curve (x0) was used to determine the dissociation constant, Kd. For determination of binding affinity with the aggregated protein, different concentrations of GST-51Qhtt, preincubated at 37 °C for 60 hours, were incubated with fluorescein labeled RNA at 25 °C for 1 hour and filtered as above through a cellulose acetate membrane (which filters proteins on the basis of size, allowing only aggregates to be retained on the membrane). Effect of monoclonal RNA sequences on aggregation of GST-51Q-htt in vitro. The enriched pools of RNA molecules obtained after tenth cycle

of selection were amplified by reverse transcription-PCR. The products

1923


obtained were ligated into pGEM-T vector using the protocol described by the manufacturer and transformed into chemically competent E. coli DH5α cells. Recombinant plasmids were isolated from monoclones (50 from each condition, 200 in total) and monoclonal RNA sequences were obtained from these plasmids by in vitro transcription. Affinity purified GST-51Q-htt was incubated in the presence of different RNA sequences (1:1, w w−1) for 15 hours at 37 °C in 30 μl of 0.04 M TrisHCl buffer, pH 8.0 containing 150 mmol/l NaCl and 2, 3, or 4 mmol/l MgCl2. For combinatorial effect, a mixture of equal amount of RNA sequences was incubated with GST-51Q-htt such that the ratio of RNA to protein (w w−1) remained the same as before (i.e., 1:1, w w−1). Inhibition of aggregation of mutant huntingtin was monitored by filter retardation assay on a cellulose acetate membrane (which filters proteins on the basis of size, allowing only aggregates to be retained on the membrane), with FITC-conjugated GST monoclonal antibody (1:500), using the same protocol as described above, after preincubating the protein in the presence of aptamers for 1 hour at 25 °C. To study the effect of aptamers on reversal of aggregation, RNA sequences were added at different time points (15 hours (oligomeric species) and 60 hours (mature fibrils)) after initiation of aggregation and the progress of aggregation was monitored as above. Displacement studies. GST-51Q-htt (300 nmol/l) was added in the SELEX buffer (50 mmol/l phosphate buffer, pH 7.4 containing 150 mmol/l NaCl and 2 or 3 mmol/l MgCl2). A constant amount (70 ng) of fluoresceinlabeled and increasing amounts of unlabeled RNA were incubated in a reaction volume of 50 μl for 1 hour at 25 °C. Samples were filtered through a prewetted nitrocellulose membrane (0.45 μm) using a 96-well vacuum filtration manifold (Whatman-Biometra, Goettingen, Germany). The membrane was washed with SELEX buffer and dried between folds of filter papers. Fluorescence intensity of the retained RNA-protein complex was measured using an image scanner (Typhoon Trio, GE Healthcare) in the fluorescence mode. Dynamic light scattering studies. Particle size distribution of GST-51Q-

htt (30 μg), incubated in the absence and presence of a mixture of aptamers (1:1, w w−1) for 15 or 60 hours at 37 °C, was measured by a zetasizer (Malvern Instruments). Peaks less than 0.1 nm and more than 1,000 nm were excluded from analysis. Effect of RNA aptamers on porosity of liposomes due to GST-51Q-htt aggregation. Chloroform and methanol ((1:1) v v−1) were added to a

mixture of soy lecithin and cholesterol (1:1 molar ratio) to make a clear phospholipid solution.25 The thin film formed after vacuum evaporation was hydrated in the presence of fluorescein dye. Monomeric GST-51Q-htt was preincubated in the absence and presence of aptamers for 15 hours (time required to form oligomers in the absence of aptamers) (Figure 1c,f) or 60 hours (time required to form mature aggregates in the absence of aptamers) (Figure 1c,f). The release of the encapsulated dye from the liposomes in the presence of monomeric, oligomeric and mature fibrillar GST51Q-htt was measured in the presence and absence of RNA aptamers after incubation with liposomes for 20 minutes at 37 °C by spectrofluorimetry at excitation and emission wavelengths of 490 and 514 nm, respectively.

Effect of RNA aptamers on intracellular oxidative stress due to GST-51Qhtt. Blood (200 μl) was withdrawn from female SD rats from retro-orbital

plexus under ketamine hydrochloride anaesthesia (experiments were performed in accordance with regulations specified by the Institutional Animal Ethics Committee and prior approval was obtained (IAEC/14/29)), collected in heparinized microcentrifuge tubes and centrifuged at 3,000 g for 5 minutes at 4 °C. RBCs were washed thrice with isotonic phosphatebuffered saline (PBS), pH 7.4. Cells were counted using a hemocytometer, diluted up to 7 × 106 cells per ml and incubated with monomeric, oligomeric and mature fibrillar GST-51Q-htt (30 μg each) in the absence and presence of RNA aptamers at 37 °C and 15 rpm for different time periods. Cells were washed with PBS and measurement of intracellular ROS

1924


was done following incubation with 20 μmol/l dichlorodihydrofluorescein diacetate (DCFH-DA) (10 mmol/l stock solution in dimethyl sulphoxide) and 1 mmol/l H2O2 for 1 hour at 30 °C.48 The emission intensity of dichlorofluorescein was recorded using excitation and emission wavelengths of 504 and 519 nm, respectively. Effect of RNA aptamers on interaction between GST-51Q-htt and GAPDH. GAPDH-His6 was purified as per the reported protocol.29 GST-

51Q-htt (1 mg ml−1, preincubated in the absence or presence of the RNA aptamer mHtt2.3.42 for 1 hour at 25 °C) and GAPDH (1 mg ml−1) were coincubated at 37 °C. Aliquots were withdrawn at different time periods and filtered through a cellulose acetate membrane. The membrane was probed with His6 primary antibody and anti-mouse secondary antibody. Sequence analysis of selected monoclonal RNA aptamers. RNA apta

mers which were able to inhibit aggregation of GST-51Q-htt were identified and the corresponding monoclones were sequenced (Eurofins MWG Operon, Bengaluru, India). These sequences were used for multiple sequence alignment to determine the consensus sequences in the variable regions using Multalin (version 5.4.1).49 Secondary structures of different RNA aptamers were predicted using mfold software.30 RNA folding was carried out at 37 °C. Expression of aptamers in yeast cells (intramers). For expression of

RNA aptamers in yeast cells, the plasmid pWHE601 (ref. 31) was digested with AflII and NheI. Respective restriction sites were inserted in aptamer sequences by PCR mutagenesis in the cDNA sequences using primers I-f (5′GATGATCTTAAGAATGCTAATACGACTCACTATAGGGAGA GAG3′) and I-r (5′GATGATGCTAGCCATTTTTTCTGGAGTTGAC GTTGCTT3′). The start codon that was deleted from the vector after AflIINheI digestion was attached 3' to the aptamer sequence together with an optimized Kozak sequence for yeast.31 Bold sequences in forward (I-f) and reverse (I-r) primers denote restriction sites for AflII and NheI, respectively, and underlined sequences anneal with the constant regions of aptamers. RNA aptamers were expressed under ADH1 constitutive promoter. The insertion of sites at the correct position was confirmed by specific amplification of the inserted sequence, followed by agarose gel electrophoresis. Yeast cells (Saccharomyces cerevisiae BY4742) were transformed with individual pWHE601-aptamer plasmids by lithium-acetate method50 and grown in SC-URA media. The presence of the vector was monitored by green fluorescence due to constitutive expression of GFP in the plasmid. Expression of RNA aptamers was monitored by reverse transcriptionPCR of the isolated intracellular RNA, using primers for amplification of the initial library (L2-f and L2-r). For coexpression of the second aptamer in the yeast HD system, pRSII423 (ref. 51) was digested with EcoRI and BamHI. Respective restriction sites were inserted in the ADHI promoter-aptamer constructs of pWHE601 recombinant vector by PCR mutagenesis using the forward primer (5′GATGATGAATTCAATGCTAATACGACTCACTATAGGGAGAGAG3′) and the reverse primer (5′GATGATGGATCCTTCTGGAGTTGACGTTGCTT3′). Bold sequences in forward and reverse primers denote restriction sites for EcoRI and BamHI, respectively, and underlined sequences anneal with ADH1 promoter and apta mer. The aptamers were expressed under ADH1 constitutive promoter and HIS3 as a selection marker. Effect of RNA aptamers on aggregation of mutant huntingtin in yeast cells. Yeast cells (Saccharomyces cerevisiae BY4742) were cotransformed

with pRS315-CUP1-FLAG-Htt-103Q-mRFP (expressing 103Q-htt of exon1 fused to mRFP under the control of CUP1 promoter and LEU2 selection marker) and individual pWHE601-aptamer plasmids. Cells were grown in SC-LEU-URA (2 % dextrose) media at 30 °C till OD600 0.8–1.0 (mid-logarithmic phase). Expression of 103Q-htt was induced with 500 μmol/l CuSO4 for 10 hours. The aggregation profile of 103Q-htt-mRFP was monitored under a fluorescence microscope (Model E600, Nikon, Japan; www.moleculartherapy.org vol. 23 no. 12 dec. 2015


excitation at BP 510–560 nm, emission at BA 590 nm) using 100× objective lens. When using a combination of two aptamers, transformed yeast cells were grown in SC-LEU-URA-HIS media. Yeast cells were lysed by glass beads method.52 The lysate was centrifuged at 16,000 g for 15 minutes at 4 °C. Samples were analyzed by 12% native PAGE. The gel was first scanned on an image scanner (Typhoon Trio, GE Healthcare, Uppsala, Sweden) operated in the fluorescence mode and then stained with Coomassie blue. Purification of 103Q-htt-mRFP. 103Q-htt-mRFP was expressed in yeast

cells as above. Induced cells were lysed. The cell lysate was incubated with anti-FLAG affinity matrix. The FLAG-tagged protein was purified as per manufacturer’s instructions. Purification was confirmed by SDS PAGE and western blotting. All in vitro studies with 103Q-htt were carried out with this protein. Formic acid solubilization assay. Quantification of aggregates was carried

out by dot blot assay. The pellet (containing aggregates) obtained after cell lysis was dissolved in formic acid (100%), followed by incubation at 37 °C for 30 minutes.53 The sample was centrifuged at 12,000 g for 40 minutes, the supernatant was diluted (1:150) in yeast lysis buffer and filtered through a nitrocellulose membrane (0.45 µm), pre-equilibrated with Trisbuffered saline. The membrane was probed with anti-polyglutamine antibody (1:5,000) as the primary antibody and FITC-conjugated anti-mouse (1:5,000) antibody as the secondary antibody.

Effect of RNA aptamers on intracellular oxidative stress in yeast cells expressing 103Q-htt. Yeast cells were pelleted down and resuspended

in 10 mmol/l phosphate buffer, pH 7.4. Cells (1 × 107 each) were incubated with DCFH-DA and H2O2 and oxidative stress was measured48 as described above. Cell viability assay. Yeast cells (3 × 103) were serially diluted threefold and

plated on appropriate selection plates. Cell growth was monitored for 2–3 days at 30 °C.

Endocytosis of FM4-64. For internalization studies with FM4-64, mRFP

tag of 103Q-htt-mRFP from the plasmid pRS315-CUP1-FLAG-Htt103Q-mRFP was replaced with EGFP tag (from pYES2-FLAG-Htt-103QEGFP) by PCR mutagenesis and cloning. GFP gene was deleted from all pWHE601-aptamer vectors by digesting these plasmids with NheI and PstI and ligation with a linker sequence flanked by appropriate restriction sites. Removal of GFP tag from RNA aptamer-expressing cells was confirmed by fluorescence microscopy (no signal for GFP) and reverse transcriptionPCR (presence of RNA aptamers). Yeast cells coexpressing either normal (25Q-htt-EGFP) or mutant (103Q-htt-EGFP) huntingtin proteins and aptamers were grown as above. Cell pellets were obtained by centrifugation. These were resuspended in 1 ml phosphate buffered saline, pH 7.4, and incubated with 8 μmol/l FM4-64 dye (12 mmol/l stock solution in dimethyl sulphoxide) for different time periods.19 Endocytosis of the dye was monitored using a fluorescence microscope (Model E600, Nikon, Japan; excitation at BP 510–560 nm, emission BA 590 nm). Twenty fields, each containing 40–50 cells, were counted in each case. Cells which exhibited both GFP and FM4-64 fluorescence were counted as positive cells.

SUPPLEMENTARY MATERIAL Figure S1. Purification and aggregation of GST-51Q-htt. Figure S2. Estimation of dissociation constants (Kd) for the enriched RNA libraries by dot blot assay. Figure S3. Inhibition of aggregation of GST-51Q-htt by RNA sequences in vitro. Figure S4. Estimation of binding affinity of aptamers for aggregated GST-51Q-htt. Figure S5. Purification and aggregation of GAPDH-His6. Figure S6. Prediction of secondary structures of RNA aptamers. Figure S7. Construction of an RNA aptamer expression system in yeast. Figure S8. Aggregation of 103Q-htt and its effect on cell viability. Molecular Therapy vol. 23 no. 12 dec. 2015


Table S1. Dissociation constants of enriched libraries with GST-51Qhtt selected at different concentrations of MgCl2. Table S2. Comparative normalized similarity scores for various sequences (inhibitors versus inhibitors) determined by SimTree analysis. Table S3. Comparative normalized similarity scores for various sequences (inhibitors versus non-inhibitors) determined by SimTree analysis.

ACKNOWLEDGMENTS The authors are thankful to E. Wanker, Max-Delbrück-Centrum für Molekulare Medizin (MDC), Berlin, Germany, for the gift of pGEX-5X1HDex1-CAG20, pGEX-5X1-HDex1-CAG51 and pQE30N-GAPDH, M. Y. Sherman, Boston University School of Medicine, Boston, Massachusetts, USA, for the gift of pYES2-25Q-htt-EGFP and pYES2-103Q-htt-EGFP, D. M. Cyr, School of Medicine, University of North Carolina, Chapel Hill, North Carolina, USA for the gift of pRS315-CUP1-RNQ1-mRFP, and B. Suess, Friedrich-Alexander-Universität Erlangen-Nürnberg, Erlangen, Germany, for the gift of the RNA expression vector pWHE601. The authors are thankful to K. Tikoo (NIPER, S.A.S. Nagar) for the use of transmission electron microscopy facility and to S. Jain (NIPER, S.A.S. Nagar) for extending the use of laboratory facilities. The constructs pRS315-CUP1-103Q-htt-mRFP and pRS315-CUP1-25Q/103Q-htt-EGFP were synthesized by Aliabbas Saleh and Ankan Kumar Bhadra, respectively, in the lab. Technical help extended by Jay Kardani is acknowledged. The work was supported by a research grant from Department of Biotechnology. R.K.C. and K.A.P. acknowledge the award of senior research fellowships by Indian Council of Medical Research and Department of Biotechnology, respectively. The authors declare no conflict of interest.

References

1. The Huntington’s Disease Collaborative Research Group (1993). A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington’s disease chromosome. Cell 72: 971–983. 2. Scherzinger, E, Lurz, R, Turmaine, M, Mangiarini, L, Hollenbach, B, Hasenbank, R et al. (1997). Huntingtin-encoded polyglutamine expansions form amyloid-like protein aggregates in vitro and in vivo. Cell 90: 549–558. 3. Colby, DW, Chu, Y, Cassady, JP, Duennwald, M, Zazulak, H, Webster, JM et al. (2004). Potent inhibition of huntingtin aggregation and cytotoxicity by a disulfide bond-free single-domain intracellular antibody. Proc Natl Acad Sci USA 101: 17616–17621. 4. Arrasate, M, Mitra, S, Schweitzer, ES, Segal, MR and Finkbeiner, S (2004). Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death. Nature 431: 805–810. 5. Heiser, V, Scherzinger, E, Boeddrich, A, Nordhoff, E, Lurz, R, Schugardt, N et al. (2000). Inhibition of huntingtin fibrillogenesis by specific antibodies and small molecules: implications for Huntington’s disease therapy. Proc Natl Acad Sci USA 97: 6739–6744. 6. Tanaka, M, Machida, Y, Niu, S, Ikeda, T, Jana, NR, Doi, H et al. (2004). Trehalose alleviates polyglutamine-mediated pathology in a mouse model of Huntington disease. Nat Med 10: 148–154. 7. Hermann, T and Patel, DJ (2000). Adaptive recognition by nucleic acid aptamers. Science 287: 820–825. 8. Kaur, G and Roy, I (2008). Therapeutic applications of aptamers. Expert Opin Investig Drugs 17: 43–60. 9. Keefe, AD, Pai, S and Ellington, A (2010). Aptamers as therapeutics. Nat Rev Drug Discov 9: 537–550. 10. Rhie, A, Kirby, L, Sayer, N, Wellesley, R, Disterer, P, Sylvester, I et al. (2003). Characterization of 2’-fluoro-RNA aptamers that bind preferentially to disease-associated conformations of prion protein and inhibit conversion. J Biol Chem 278: 39697–39705. 11. Tsukakoshi, K, Harada, R, Sode, K and Ikebukuro, K (2010). Screening of DNA aptamer which binds to alpha-synuclein. Biotechnol Lett 32: 643–648. 12. Ausländer, D, Wieland, M, Ausländer, S, Tigges, M and Fussenegger, M (2011). Rational design of a small molecule-responsive intramer controlling transgene expression in mammalian cells. Nucleic Acids Res 39: e155. 13. Davies, SW, Turmaine, M, Cozens, BA, DiFiglia, M, Sharp, AH, Ross, CA et al. (1997). Formation of neuronal intranuclear inclusions underlies the neurological dysfunction in mice transgenic for the HD mutation. Cell 90: 537–548. 14. Schilling, G, Becher, MW, Sharp, AH, Jinnah, HA, Duan, K, Kotzuk, JA et al. (1999). Intranuclear inclusions and neuritic aggregates in transgenic mice expressing a mutant N-terminal fragment of huntingtin. Hum Mol Genet 8: 397–407. 15. Damiano, M, Diguet, E, Malgorn, C, D’Aurelio, M, Galvan, L, Petit, F et al. (2013). A role of mitochondrial complex II defects in genetic models of Huntington’s disease expressing N-terminal fragments of mutant huntingtin. Hum Mol Genet 22: 3869–3882. 16. Colin, E, Zala, D, Liot, G, Rangone, H, Borrell-Pagès, M, Li, XJ et al. (2008). Huntingtin phosphorylation acts as a molecular switch for anterograde/retrograde transport in neurons. EMBO J 27: 2124–2134. 17. Pardo, R, Molina-Calavita, M, Poizat, G, Keryer, G, Humbert, S and Saudou, F (2010). pARIS-htt: an optimised expression platform to study huntingtin reveals functional domains required for vesicular trafficking. Mol Brain 3: 17. 18. Krobitsch, S and Lindquist, S (2000). Aggregation of huntingtin in yeast varies with the length of the polyglutamine expansion and the expression of chaperone proteins. Proc Natl Acad Sci USA 97: 1589–1594.

1925


19. Meriin, AB, Zhang, X, Miliaras, NB, Kazantsev, A, Chernoff, YO, McCaffery, JM et al. (2003). Aggregation of expanded polyglutamine domain in yeast leads to defects in endocytosis. Mol Cell Biol 23: 7554–7565. 20. Vachharajani, SN, Chaudhary, RK, Prasad, S and Roy, I (2012). Length of polyglutamine tract affects secondary and tertiary structures of huntingtin protein. Int J Biol Macromol 51: 920–925. 21. Misra, VK and Draper, DE (2002). The linkage between magnesium binding and RNA folding. J Mol Biol 317: 507–521. 22. Lashuel, HA and Lansbury, PT Jr (2006). Are amyloid diseases caused by protein aggregates that mimic bacterial pore-forming toxins? Q Rev Biophys 39: 167–201. 23. Caron, NS, Desmond, CR, Xia, J and Truant, R (2013). Polyglutamine domain flexibility mediates the proximity between flanking sequences in huntingtin. Proc Natl Acad Sci USA 110: 14610–14615. 24. Rahimi, F, Murakami, K, Summers, JL, Chen, CH and Bitan, G (2009). RNA aptamers generated against oligomeric Abeta40 recognize common amyloid aptatopes with low specificity but high sensitivity. PLoS One 4: e7694. 25. Jain, S, Kumar, D, Swarnakar, NK and Thanki, K (2012). Polyelectrolyte stabilized multilayered liposomes for oral delivery of paclitaxel. Biomaterials 33: 6758–6768. 26. Hands, S, Sajjad, MU, Newton, MJ and Wyttenbach, A (2011). In vitro and in vivo aggregation of a fragment of huntingtin protein directly causes free radical production. J Biol Chem 286: 44512–44520. 27. Burke, JR, Enghild, JJ, Martin, ME, Jou, YS, Myers, RM, Roses, AD et al. (1996). Huntingtin and DRPLA proteins selectively interact with the enzyme GAPDH. Nat Med 2: 347–350. 28. Yamanaka, T, Miyazaki, H, Oyama, F, Kurosawa, M, Washizu, C, Doi, H et al. (2008). Mutant Huntingtin reduces HSP70 expression through the sequestration of NF-Y transcription factor. EMBO J 27: 827–839. 29. Engel, M, Seifert, M, Theisinger, B, Seyfert, U and Welter, C (1998). Glyceraldehyde3-phosphate dehydrogenase and Nm23-H1/nucleoside diphosphate kinase A. Two old enzymes combine for the novel Nm23 protein phosphotransferase function. J Biol Chem 273: 20058–20065. 30. Zuker, M (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31: 3406–3415. 31. Suess, B, Hanson, S, Berens, C, Fink, B, Schroeder, R and Hillen, W (2003). Conditional gene expression by controlling translation with tetracycline-binding aptamers. Nucleic Acids Res 31: 1853–1858. 32. Kovtun, IV and McMurray, CT (2008). Features of trinucleotide repeat instability in vivo. Cell Res 18: 198–213. 33. Trushina, E, Dyer, RB, Badger, JD 2nd, Ure, D, Eide, L, Tran, DD et al. (2004). Mutant huntingtin impairs axonal trafficking in mammalian neurons in vivo and in vitro. Mol Cell Biol 24: 8195–8209. 34. Kegel, KB, Sapp, E, Alexander, J, Valencia, A, Reeves, P, Li, X et al. (2009). Polyglutamine expansion in huntingtin alters its interaction with phospholipids. J Neurochem 110: 1585–1597. 35. Nagai, Y, Inui, T, Popiel, HA, Fujikake, N, Hasegawa, K, Urade, Y et al. (2007). A toxic monomeric conformer of the polyglutamine protein. Nat Struct Mol Biol 14: 332–340. 36. Sánchez, I, Mahlke, C and Yuan, J (2003). Pivotal role of oligomerization in expanded polyglutamine neurodegenerative disorders. Nature 421: 373–379.

1926


37. Monoi, H, Futaki, S, Kugimiya, S, Minakata, H and Yoshihara, K (2000). Poly-Lglutamine forms cation channels: relevance to the pathogenesis of the polyglutamine diseases. Biophys J 78: 2892–2899. 38. Costanzo, M, Abounit, S, Marzo, L, Danckaert, A, Chamoun, Z, Roux, P et al. (2013). Transfer of polyglutamine aggregates in neuronal cells occurs in tunneling nanotubes. J Cell Sci 126(Pt 16): 3678–3685. 39. Aguzzi, A and Rajendran, L (2009). The transcellular spread of cytosolic amyloids, prions, and prionoids. Neuron 64: 783–790. 40. Perutz, MF, Johnson, T, Suzuki, M and Finch, JT (1994). Glutamine repeats as polar zippers: their possible role in inherited neurodegenerative diseases. Proc Natl Acad Sci USA 91: 5355–5358. 41. DiFiglia, M, Sena-Esteves, M, Chase, K, Sapp, E, Pfister, E, Sass, M et al. (2007). Therapeutic silencing of mutant huntingtin with siRNA attenuates striatal and cortical neuropathology and behavioral deficits. Proc Natl Acad Sci USA 104: 17204–17209. 42. McBride, JL, Boudreau, RL, Harper, SQ, Staber, PD, Monteys, AM, Martins, I et al. (2008). Artificial miRNAs mitigate shRNA-mediated toxicity in the brain: implications for the therapeutic development of RNAi. Proc Natl Acad Sci USA 105: 5868–5873. 43. Østergaard, ME, Southwell, AL, Kordasiewicz, H, Watt, AT, Skotte, NH, Doty, CN et al. (2013). Rational design of antisense oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective suppression of mutant Huntingtin in the CNS. Nucleic Acids Res 41: 9634–9650. 44. Lunkes, A, Lindenberg, KS, Ben-Haïem, L, Weber, C, Devys, D, Landwehrmeyer, GB et al. (2002). Proteases acting on mutant huntingtin generate cleaved products that differentially build up cytoplasmic and nuclear inclusions. Mol Cell 10: 259–269. 45. Jian, Y, Gao, Z, Sun, J, Shen, Q, Feng, F, Jing, Y et al. (2009). RNA aptamers interfering with nucleophosmin oligomerization induce apoptosis of cancer cells. Oncogene 28: 4201–4211. 46. Zamay, TN, Kolovskaya, OS, Glazyrin, YE, Zamay, GS, Kuznetsova, SA, Spivak, EA et al. (2014). DNA-aptamer targeting vimentin for tumor therapy in vivo. Nucleic Acid Ther 24: 160–170. 47. Jethva, PN, Kardani, JR and Roy, I (2011). Modulation of α-synuclein aggregation by dopamine in the presence of MPTP and its metabolite. FEBS J 278: 1688–1698. 48. Wong, CM, Zhou, Y, Ng, RW, Kung Hf, HF and Jin, DY (2002). Cooperation of yeast peroxiredoxins Tsa1p and Tsa2p in the cellular defense against oxidative and nitrosative stress. J Biol Chem 277: 5385–5394. 49. Corpet, F (1988). Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16: 10881–10890. 50. Gietz, D, St Jean, A, Woods, RA and Schiestl, RH (1992). Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res 20: 1425. 51. Chee, MK and Haase, SB (2012). New and Redesigned pRS Plasmid Shuttle Vectors for Genetic Manipulation of Saccharomycescerevisiae. G3 (Bethesda) 2: 515–526. 52. Einhauer, A, Schuster, M, Wasserbauer, E and Jungbauer, A (2002). Expression and purification of homogenous proteins in Saccharomyces cerevisiae based on ubiquitinFLAG fusion. Protein Expr Purif 24: 497–504. 53. Hazeki, N, Tukamoto, T, Goto, J and Kanazawa, I (2000). Formic acid dissolves aggregates of an N-terminal huntingtin fragment containing an expanded polyglutamine tract: applying to quantification of protein components of the aggregates. Biochem Biophys Res Commun 277: 386–393.


Deciphering the roles of trehalose and Hsp104 in the inhibition of aggregation of mutant huntingtin in a yeast model of Huntington's disease.

Nucleic acid aptamers: research tools in disease diagnostics and therapeutics.

In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies.

Inhibition of mitochondrial protein import by mutant huntingtin.

Gpd1 Regulates the Activity of Tcp-1 and Heat Shock Response in Yeast Cells: Effect on Aggregation of Mutant Huntingtin.

Cytotoxicity of mutant huntingtin fragment in yeast can be modulated by the expression level of wild type huntingtin fragment.

Differential effects on allele selective silencing of mutant huntingtin by two stereoisomers of α,β-constrained nucleic acid.

CRISPR-Cas9 Mediated Gene-Silencing of the Mutant Huntingtin Gene in an In Vitro Model of Huntington's Disease.

Nucleic acid aptamers for living cell analysis.

Allele-selective inhibition of expression of huntingtin and ataxin-3 by RNA duplexes containing unlocked nucleic acid substitutions.

In Vitro Selection of Cell-Internalizing DNA Aptamers in a Model System of Inflammatory Kidney Disease.

Inhibition of adenosine diphosphate-induced platelet aggregation by alpha-lipoic acid and dihydroquercetin in vitro.

Erratum: Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity.

Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity.

A new Caenorhabditis elegans model of human huntingtin 513 aggregation and toxicity in body wall muscles.

Xyloketal-derived small molecules show protective effect by decreasing mutant Huntingtin protein aggregates in Caenorhabditis elegans model of Huntington's disease.

Large-scale RNA interference screening in mammalian cells identifies novel regulators of mutant huntingtin aggregation.

An enhanced Q175 knock-in mouse model of Huntington disease with higher mutant huntingtin levels and accelerated disease phenotypes.

Cortical efferents lacking mutant huntingtin improve striatal neuronal activity and behavior in a conditional mouse model of Huntington's disease.

Metabolic and behavioral effects of mutant huntingtin deletion in Sim1 neurons in the BACHD mouse model of Huntington's disease.

Selective Targeting to Glioma with Nucleic Acid Aptamers.

Inhibition of transglutaminase exacerbates polyglutamine-induced neurotoxicity by increasing the aggregation of mutant ataxin-3 in an SCA3 Drosophila model.

Structural Mechanisms of Mutant Huntingtin Aggregation Suppression by the Synthetic Chaperonin-like CCT5 Complex Explained by Cryoelectron Tomography.

Inhibition of Mutant αB Crystallin-Induced Protein Aggregation by a Molecular Tweezer.