RESEARCH LETTER
Influence of bacteriophage P22 on the inflammatory mediator gene expression in chicken macrophage HD11 cells infected with Salmonella Typhimurium Juhee Ahn1 & Debabrata Biswas2 1
Department of Medical Biomaterials Engineering, Kangwon National University, Chuncheon, Gangwon, South Korea; and 2Department of Animal and Avian Sciences, University of Maryland, College Park, MD, USA
Correspondence: Department of Avian and Animal Sciences, University of Maryland, College Park, MD 20742, USA. Tel.: +1 301 405 3791; fax: +1 301 405 1677; e-mail: [email protected] Received 8 December 2013; revised 25 December 2013; accepted 7 January 2014. Final version published online 27 January 2014. DOI: 10.1111/1574-6968.12379
MICROBIOLOGY LETTERS
Editor: Wolfgang Schumann Keywords Salmonella Typhimurium; bacteriophage; lysogeny; macrophage; HD11 cell; inflammatory mediator.
Abstract This study was designed to evaluate the effects of bacteriophage on the intracellular survival and immune mediator gene expression in chicken macrophagelike HD11 cells. The invasive ability and intracellular survival of Salmonella Typhimurium (STP22) and lysogenic S. Typhimurium (STP22+) in HD11 cells were evaluated at 37 °C for 24 h postinfection (hpi). The expression of inflammatory mediator genes was determined in STP22- and STP22+-infected HD11 cells treated with and without bacteriophage P22 at 1 and 24 hpi using quantitative RT-PCR. The ability of STP22 and STP22+ to invade HD11 cells was significantly decreased by bacteriophage P22 at 1 hpi. The numbers of intracellular STP22 and STP22+ were significantly decreased from 2.39 to 1.62 CFU cm2 and from 3.40 to 1.72 CFU cm2 in HD11 cells treated with bacteriophage P22, respectively, at 24 hpi. The enhanced expression of inflammatory mediators was observed in STP22- and STP22+-infected HD11 cells treated with and without bacteriophage P22. These results suggest that the application of bacteriophage could be an effective way to control the intracellular infection.
Introduction As the gastrointestinal tract of poultry is a potential carrier of pathogenic bacteria, the preharvest interventions for reducing intracellular Salmonella spp. have become a leading priority in the poultry industry. In the last few decades, many preventive and therapeutic approaches such as antibiotic use, chemical acidification, and vaccination have been developed to reduce the colonization and invasion by extraintestinal pathogens (Kwon et al., 2000; Dueger et al., 2003; Zhao et al., 2011). Despite their effectiveness, there still remain adverse outcomes of using these technologies, including the emergence of new antibiotic-resistant and acid-tolerant bacteria, the imbalance of indigenous intestinal microflora, and the limited efficacy of vaccine (Bach et al., 2002; Zou et al., 2009). Therefore, continuous endeavors are necessary to develop alternative strategies over current preharvest poultry safety interventions. Recently, bacteriophage has received great attention as a promising approach for the prevention and treatment FEMS Microbiol Lett 352 (2014) 11–17
for infectious diseases due to its effectiveness against antibiotic-resistant pathogens, specificity to the target pathogen, cost-effectiveness to develop therapeutic system, and no serious side effects on eukaryotic host cells (Atterbury et al., 2007; Bardina et al., 2012). Many studies have reported the effect of lytic bacteriophage on the reduction in bacterial colonization in chickens (Atterbury et al., 2007; Hurley et al., 2008; Bardina et al., 2012). From the phage therapeutic point of view, there is an important challenging question of whether lytic phages can pass the epithelium barrier to reach the site where intracellular pathogens are located against the host immune system (G orski et al., 2006). Thus, lysogenic strain can be considered as a potential vehicle to deliver lytic phages, leading to the negative allelopathy on the intracellular pathogens (Broxmeyer et al., 2002; Paul, 2008). However, there have been relatively few studies on the potential role of lytic phage and lysogeny in reducing colonization of invading pathogens underlying the cellular and molecular immune responses. Therefore, a systematic approach toward studying the colonization and survival of invading ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
12
pathogens in the presence of bacteriophages is needed to enhance the understanding of host–pathogen interactions in the cellular immune response levels and ultimately design an effective and safe phage therapeutic strategy. The objective of this study was to evaluate the role of bacteriophage P22 in the pathogenesis of intracellular nonlysogenic and lysogenic Salmonella enterica serovar Typhimurium in HD11 cells as measured by bacterial invasiveness, intracellular survival, and inflammatory mediator gene expression.
Materials and methods Bacterial strains and culture conditions
Strains of S. enterica serovar Typhimurium ATCC 19585 (STP22) and S. Typhimurium lysogen carrying P22 prophage ATCC 23555 (STP22+) were purchased from American Type Culture Collection (ATCC, Manassas, VA). The strains were cultivated in Luria–Bertani (LB) broth (Difco, Becton, Dickinson and Co., Sparks, MD) at 37 °C for 20 h. After cultivation, cultures were collected by centrifugation at 3000 g for 20 min at 4 °C. Bacteriophage culture and plaque assay
Bacteriophage P22 (ATCC 97540) was propagated on LB broth containing STP22 to collect a bacteriophage stock. After 24-h incubation at 37 °C, the cultures were centrifuged at 10 000 g for 20 min, and the supernatant was passed through a 0.2-lm filter to remove remaining bacterial cells. The filtrates were further purified according to the cesium chloride gradient ultracentrifugation followed by dialysis (Green & Sambrook, 2012). According to bacteriophage plaque assay, phage titer was determined using a soft agar overlay method. The collected bacteriophages were serially diluted (1 : 10) with PBS buffer. The decimal dilutions (10 lL each) were mixed with 0.5% LB soft agar (45 °C) containing STP22 and pour-plated on the surface of prewarmed 1.5% LB agar. The plates were incubated for 24 h at 37 °C to enumerate free lytic phages. The purified bacteriophage stock was stored at 4 °C prior to use. Cell lines and culture conditions
Chicken macrophage-like cell line, HD11 cells, was provided by Dr. Uma S. Babu at the Immunobiology Branch, Food and Drug Administration (Laurel, MD). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 2 mM L-glutamine, 10% heat-inactivated chicken serum (Sigma-Aldrich, St. Louis, MO), and antibiotics (100 U mL1 penicillin and ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J. Ahn & D. Biswas
100 lg mL1 streptomycin) in the incubator with 5% CO2 at 37 °C. For the invasion assay, the HD11 cells were seeded at 2 9 106 cells mL1 into 25 cm2 T-flask (BD Falcon, Franklin Lakes, NJ) and allowed to proliferate up to approximately 85% confluence for 24–48 h at 37 °C. The postconfluent cultures were rinsed two times with PBS buffer and then replaced with fresh nonsupplemented DMEM for 1 h prior to bacterial infection. Cell invasion assay
The strains of STP22 and STP22+ (106 CFU mL1 each) were infected into the postconfluent HD11 cell monolayers at 37 °C for 1 h in 25 cm2 T-flask containing antibiotic and serum-free DMEM with and without bacteriophage P22 (108 PFU mL1). Noninfected HD11 cells were also incubated 37 °C for 1 h with and without bacteriophage P22 as controls. At 1 h postinfection (hpi), STP22-, STP22+-, and noninfected HD11 cells were rinsed two times with PBS buffer to remove nonadherent cells and treated with DMEM containing 100 lg mL1 of gentamicin at 37 °C for 1 h to eliminate extracellular bacteria. After gentamicin treatment, the STP22-, STP22+-, and noninfected HD11 cells were incubated in the absence or the presence of bacteriophage P22 at 37 °C for 24 h. Enumeration of intracellular bacteria
At 1 and 24 hpi, the HD11 cells treated with 100 lg mL1 of gentamicin at 37 °C for 1 h lysed with 1 mL of 1% Triton X-100 in PBS buffer for 15 min at 37 °C to release intracellular bacteria. The lysates were centrifuged at 3000 g for 10 min and resuspended in 1 mL of PBS buffer. The collected lysates were serially (1 : 10) diluted with PBS buffer, and proper dilutions were plated on LB agar. The plates were incubated for 24–48 h at 37 °C to enumerate intracellular STP22 and STP22+ cells. Quantitative RT-PCR assay
The collected HD11 cells at 1 and 24 hpi were rinsed with 2 mL of ice-cold PBS. The RNA extraction was carried out using Spin-AwayTM Filter and Zymo-SpinTM IIICG Column according to the protocol of ZR RNA MiniPrep kit (Zymo Research Corp., Irvine, CA). The cDNA synthesis was performed according to the protocol of qScript cDNA SuperMix (Quanta Biosciences, Gaithersburg, MD). The PCR mixture containing 10 lL of PerfeCTa SYBR Green FastMix (Quanta Biosciences), 3 lL of each primer (100 nM), and 4 lL of cDNA (10 ng) was amplified using an Eco Real-Time PCR system (Illumina, San Diego, CA). The oligonucleotide primers (Erofins MWG Operon, Huntsville, AL) are listed in Table 1. The PCR FEMS Microbiol Lett 352 (2014) 11–17
13
Inflammatory-mediated responses to bacteriophage
mixture was denatured at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 55 °C for 15 s, and 72 °C for 10 s. The relative expression levels of genes were estimated by the comparative method (Livak & Schmittgen, 2001). The Ct values of target genes in STP22- and STP22+-infected HD11 cells were compared with those in noninfected HD11 cells without P22 at 1 hpi. The reference gene (GAPDH mRNA) was used for normalization of inflammatory mediator gene expression. The fold changes in expression of the target genes [interleukin-1b (IL-1b), IL-6, IL-8, IL-10, LPS-induced tumor necrosis alpha factor (LITAF), and inducible nitric oxide synthase (iNOS) mRNAs] were calculated as follows: DDCt ¼ ðCt ½each target mRNA Ct ½GAPDH mRNAÞtreatment ðCt ½each target mRNA Ct ½GAPDH mRNAÞcontrol Statistical analysis
All experiments were conducted with three replicates. Data were analyzed using the Statistical Analysis System software. The general linear model and least significant difference (LSD) procedures were used to evaluate the treatment as a fixed effect. Significant mean differences were calculated by Fisher’s LSD at P < 0.05.
Results Invasive ability and intracellular survival of S. Typhimurium in HD11 cells exposed to bacteriophage P22
The ability of STP22 and STP22+ strains to invade HD11 cells was evaluated in the absence and presence of bacterio-
phage P22 at 1 hpi (Table 2). The invasive ability of STP22 and STP22+ was significantly decreased in the HD11 cells at 1 hpi when treated with bacteriophage P22. The numbers of invading STP22 and STP22+ in HD cells were 3.54 and 4.06 log CFU cm2, respectively, in the absence of bacteriophage P22, while those were 2.39 and 3.40 log CFU cm2, respectively, in the presence of bacteriophage P22. The highest invasive ability was observed in the STP22+-infected HD11 cells at 1 hpi (71%), while the least invasive ability was observed in the STP22-infected HD11 cells treated with bacteriophage P22 (41%). The intracellular survival of STP22 and STP22+ was evaluated in HD11 cells treated with and without bacteriophage P22 at 24 hpi (Table 2). Regardless of bacteriophage P22 treatment, the numbers of intracellular STP22 and STP22+ cells were decreased in HD11 treated with and without bacteriophage P22. However, noticeable reduction was observed in STP22+-infected HD11 cells treated with bacteriophage P22, showing 1.68 log reduction (Table 2). Compared with the invading numbers at 1 hpi, the intracellular STP22 and STP22+ cells remained 75% and 77%, respectively, in HD11 cells treated without bacteriophage P22 at 24 hpi, while those were decreased to 68% and 51% in HD11 cells treated with bacteriophage P22. Differential expression of inflammatory mediator genes in S. Typhimurium-infected HD11 cells exposed to bacteriophage P22
The relative expression of IL-1b, IL-6, IL-8, IL-10, LITAF, and iNOS mRNAs was estimated in STP22- and STP22+infected HD11 cells treated with and without bacteriophage P22 at 1 and 24 hpi (Fig. 1). The relative expression levels of IL-1b mRNA were highly increased up to 7.26- and 6.93-fold in STP22-infected HD11 cells treated with and without bacteriophage P22 at 1 hpi, respectively,
Table 1. Primers used in quantitative RT-PCR analysis for HD11 cells RNA target
Primer sequence
Accession number
Reference
GAPDH
F: GGTGGTGCTAAGCGTGTTAT R: ACCTCTGTCATCTCTCCACA F: GCTCTACATGTCGTGTGTGATGAG R: TGTCGATGTCCCGCATGA F: GCTCGCCGGCTTCGA R: GGTAGGCTGAAAGGCGAACAG F: GCCCTCCTCCTGGTTTCAG R: TGGCACCGCAGCTCATT F: CATGCTGCTGGGCCTGAA R: CGTCTCCTTGATCTGCTTGATG F: TGTGTATGTGCAGCAACCCGTAGT R: GGCATTGCAATTTGGACAGAAGT F: TTGGAAACCAAAGTGTGTAATATCTTG R: CCCTGGCCATGCGTACAT
K01458
Hong et al. (2006)
AJ245728
Smith et al. (2005)
AJ250838
Smith et al. (2005)
AJ009800
Hong et al. (2006)
AJ621614
Hong et al. (2006)
AY765397
Hong et al. (2006)
U46504
Hong et al. (2006)
IL-1b IL-6 IL-8 IL-10 LITAF iNOS
F and R indicate forward and reverse primers, respectively.
FEMS Microbiol Lett 352 (2014) 11–17
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
14
J. Ahn & D. Biswas
Table 2. Invasive ability and intracellular survival of Salmonella Typhimurium (STP22) and S. Typhimurium lysogen carrying P22 prophage (STP22+) in chicken macrophage HD11 cells S. Typhimurium (log CFU cm2) Treatment
0 hpi
1 hpi
STP22
5.75 0.09A
STP22 + P22
5.78 0.11A
STP22+
5.73 0.18A
STP22+ + P22
5.69 0.21A
3.54 (62)* 2.39 (41) 4.06 (71) 3.40 (60)
24 hpi 0.26A 0.16B 0.23A 0.31A,B
2.64 (75)† 1.62 (68) 3.12 (77) 1.72 (51)
0.18A 0.27B 0.20A 0.15B
Means with different letters (A and B) within a column are significantly different at P < 0.05. *Invasion ability (%) is estimated by [(cell number at 1 hpi)/(cell number at 0 hpi) 9 100]. † Intracellular survival (%) is estimated by [(cell number at 24 hpi)/(cell number at 1 hpi) 9 100].
which were significantly decreased at 24 hpi (P < 0.05). The highest level of IL-1b mRNA transcripts (5.96-fold) was observed in STP22+-infected HD11 cells treated without bacteriophage P22, followed by noninfected HD11 cells treated with bacteriophage P22 (5.44-fold). The IL-6 transcript level was increased by 4.02-fold in STP22infected HD11 cells treated without bacteriophage P22. Compared with the 1 hpi (1.15-fold), the relative expression of IL-6 in STP22+-infected HD11 cells treated without bacteriophage P22 was significantly increased to 2.98-fold at 24 hpi. The highest expression levels of IL-8 mRNA were observed in STP22-infected HD11 cells treated with bacteriophage P22 at 1 and 24 hpi, showing 6.59- and 6.92-fold, respectively. The IL-8 mRNA transcripts at 1 hpi were significantly increased to 7.14- and 7.75-fold in STP22+-infected HD11 cells treated without and with P22, respectively, at 24 hpi. The IL-10 transcript levels were not significantly different in all treatments at 1 hpi. The high expression levels of LITAF were observed in STP22-infected HD11 cells treated without bacteriophage P22 at 1 hpi (2.50-fold) and STP22+-infected HD11 cells treated with bacteriophage P22 at 24 hpi (2.04-fold). The relative expression levels of iNOS mRNA were increased by more than fourfold in STP22- and STP22+-infected HD11 cells treated with and without bacteriophage P22 at 1 and 24 hpi.
Discussion The invasive ability of STP22 and STP22+ strains was significantly decreased in bacteriophage P22-treated HD11 cells at 1 hpi (Table 2). The results suggest that bacteriophage P22 can interact with STP22 and HD11 ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
cells, leading to lytic phage activity and activated macrophage (Kurzez pa et al., 2009). The specific receptors on the surface of invading STP22 cells may allow the adsorption of bacteriophage P22, resulting in the considerable reduction in STP22 in the bacteriophage P22-treated HD cells (Park et al., 2013). The high survival rates of STP22 and STP22+ cells were observed in HD11 cells treated without bacteriophage P22 at 24 hpi, indicating increased resistance to macrophage-associated immune system (Table 2). In general, the intracellular S. Typhimurium can evolve dynamic survival processes such as SPI-1 and SPI-2 systems, resulting in severe systemic infection (Flannagan et al., 2009). The number of viable intracellular STP22+ was higher than that of STP22 in HD11 cells, suggesting that prophages can contribute to the enhanced survival of lysogeny in the host cell lines (Stanley et al., 2000; Wang et al., 2010). The increased intracellular survival of STP22+ may result in a competitive advantage of avoiding the host immune response (Wang et al., 2010). Prophage induction was not occurred in HD11 cells infected with STP22+, showing no free bacteriophages were observed at 24 hpi (data not shown). This implies that the intracellular STP22+ in HD11 cells maintains the lysogenic state as a survival strategy in low number of phage-sensitive bacteria (Weinbauer & Suttle, 1996). However, the intracellular STP22 and STP22+ in HD11 cells were effectively inactivated in the presence of bacteriophage P22 at 24 hpi (Table 2), suggesting that bacteriophage P22 can induce host immune responses. The mononuclear phagocytic cells are a primary immune system against invading pathogens. The activated macrophages can secret a series of inflammatory factors, including nitrogen species, chemokines, proinflammatory, and anti-inflammatory cytokines (Smith et al., 2005; Flannagan et al., 2009; Lee et al., 2010). The inflammatory mediator expression in HD11 cells varied with treatments, including the types of infected strains, the absence and presence of bacteriophage P22, and the stages of bacterial infections (Fig. 1). The inflammatory factors may require early immune mediators, which are produced from other immune cell lines such as granulocytic, T, B, or NK cells, to initiate the cascade regulation of cytokine and chemokine production. IFN-c stimulates NO synthesis in a dose-dependent manner (He et al., 2011) and also induces TNF-a production, which is directly involved in the bactericidal activity in HD11 cells (Smith et al., 2005). IL-10 and IL-8 are produced primarily by CD4+ TH2, dendritic, B, or CD8+ T cells (He et al., 2011). Compared with the noninfected HD11 cells, the expression of IL-1b and IL-6 mRNA was increased by STP22 and STP22+ at 1 and 24 hpi (Fig. 1). This is in accordance with previous reports that proinflammatory cytokines FEMS Microbiol Lett 352 (2014) 11–17
15
Inflammatory-mediated responses to bacteriophage
10
(a)
Control Control + P22
9
*
A a
7 Fold change
STP22– STP22– + P22
A * a A a
8
STP22+ STP22+ + P22
A A b b
A b
6 B a
5
BC c
A c
4
A a B a
B bc
B b
BC c
2
*
C ab
C a
B d
C b
D c
C bc
1 0
10
IL-1β
IL-6
IL-10
IL-8
A ab
* A ab
*
Fold change
7
iNOS
*
* B b
AB bc
5
B c
*
AB ab B b
B ab
C c
D CD C CD a a ab ab
3
C ab BC b
A c
* D a
C B ab b
2
C a
* B a B ab
*
4
C * B ab D D b D ab ab b
C d
B c
C c
IL-1β
(IL-1b and IL-6) were produced at high levels after bacterial infection by pathogen-associated molecular patterns (Smith et al., 2005; Hong et al., 2006). However, IL-6 is also known as anti-inflammatory cytokine and produced by other than bacterial invasion (Lee et al., 2010). IL-1b and IL-6 can stimulate B-lymphocytes and T cells, leading to the production of antibiotics and enhancement of adaptive immune responses (Lee et al., 2010). IL-10 is known as the inhibitor of IFN-c synthesis, NO, and TNF-a production (He et al., 2011), which were not agreed to the STP22- and STP22+-infected HD11 cells. The induction of inflammatory cytokines, chemokines, FEMS Microbiol Lett 352 (2014) 11–17
LITAF
B a
A ab A b
BC a
B ab
*
A a
6
0
D C c c
*
8
1
C b
(b)
9
Fig. 1. Relative expression of IL-1b, IL-6, IL-8, IL-10, LITAF, and iNOS mRNA in Salmonella Typhimurium-infected HD11 cells treated with and without bacteriophage P22 at 1 hpi (a) and 24 hpi (b). Means with different letters within each inflammatory mediator gene (a–d) and each treatment (A–D) are significantly different at P < 0.05. *Significant difference between 1 and 24 hpi at P < 0.05.
B B a a
B ab
B ab
B b
C bc
3
B a
IL-6
IL-8
IL-10
LITAF
iNOS
and anti-inflammatory cytokines is a complex phenomenon involved in the interactions of the host cells with bacteria and phages (Kurzez pa et al., 2009). NO production is used as an indicator of innate immunity in macrophages against bacterial infection (Crippen, 2006; Lee et al., 2010). The expression of iNOS mRNA was consistently high in STP22- and STP22+-infected HD11 cells, confirming that the NO production stimulated by SPI-1 effector protein (SopB) was occurred in infection process (Drecktrah et al., 2005). Salmonella effector proteins such as SipA and SpvB are mainly involved in the inhibition of proinflammatory cytokine production, which are reguª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
16
lated by TNF-a (Ma et al., 2010). The enhanced inflammatory mediator expression can stimulate the antimicrobial activity of macrophage against intracellular pathogens (Withanage et al., 2005), leading to the reduction in intracellular STP22 and STP22+ in HD11 cells. However, the mRNA expression levels did not always correlate with the protein expression levels due to the various post-transcriptional modifications (Park et al., 2013). In conclusion, this study focused on a potentially new concept to control the intracellular STP22 and STP22+ in HD11 cells. Macrophages play an essential role in innate and adapted immune responses to bacterial infection. However, the intracellular S. Typhimurium can circumvent the immune system and even replicate within macrophages. This study found that the phagocytosis of intracellular STP22 and STP22+ by HD11 cells was affected by bacteriophage P22. The significant reductions in intracellular STP22 and STP22+ were observed in the HD11 cells treated with bacteriophage P22. The bacteriophage P22treated HD11 cells resulted in the noticeable reduction in invading ability of STP22 and STP22+. The HD11 cells infected with STP22 and STP22+ enhanced the expression levels of inflammatory mediator genes regardless of bacteriophage P22. Bacteriophage P22 enhanced protective immunity against intracellular S. Typhimurium. Therefore, bacteriophages can be used for controlling the intracellular pathogen and modulating macrophage-associated immune mediator production. This study would provide a great insight into the bacteriophage–host interactions and help to design an effective and safe phage therapeutic strategy.
Acknowledgements We like to thank Dr. Uma Babu, FDA, Laurel, MD for providing the cell lines used in this study. This work was supported by a grant from Maryland Agricultural Experimental Station (MAES). This study was also supported by Kangwon National University (2012).
References Atterbury RJ, Van Bergen MA, Ortiz F, Lovell MA, Harris JA, De Boer A, Wagenaar JA, Allen VM & Barrow PA (2007) Bacteriophage therapy to reduce Salmonella colonization of broiler chickens. Appl Environ Microbiol 73: 4543–4549. Bach SJ, McAllister TA, Veira DM, Gannon VPJ & Holley RA (2002) Transmission and control of Escherichia coli O157: H7. Can J Anim Sci 82: 475–490. Bardina C, Spricigo DA, Cortes P & Llagostera M (2012) Significance of the bacteriophage treatment schedule in reducing Salmonella colonization of poultry. Appl Environ Microbiol 78: 6600–6607.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J. Ahn & D. Biswas
Broxmeyer L, Sosnowska D, Miltner E, Chac on O, Wagner D, McGarvey J, Barletta RG & Bermudez LE (2002) Killing of Mycobacterium avium and Mycobacterium tuberculosis by a mycobacteriophage delivered by a nonvirulent Mycobacterium: a model for phage therapy of intracellular bacterial pathogens. J Infect Dis 186: 1155–1160. Crippen TL (2006) The selective inhibition of nitric oxide production in the avian macrophage cell line HD11. Vet Immunol Immunopathol 109: 127–137. Drecktrah D, Knodler LA, Galbraith K & Steele-Mortimer O (2005) The Salmonella SPI1 effector SopB stimulates nitric oxide production long after invasion. Cell Microbiol 7: 105–113. Dueger EL, House JK, Heithoff DM & Mahan MJ (2003) Salmonella DNA adenine methylase mutants prevent colonization of newly hatched chickens by homologous and heterologous serovars. Int J Food Microbiol 80: 153–159. Flannagan RS, Cosio G & Grinstein S (2009) Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nat Rev Microbiol 7: 355–366. G orski A, Wa_zna E, Daz browska B-W, Daz browska K, Switała-Jele n K & Miez dzybrodzki R (2006) Bacteriophage translocation. FEMS Immunol Med Microbiol 46: 313–319. Green MR & Sambrook J (2012) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. He H, Genovese KJ & Kogut MH (2011) Modulation of chicken macrophage effector function by TH1/TH2 cytokines. Cytokine 53: 363–369. Hong YH, Lillehoj HS, Lee SH, Dalloul RA & Lillehoj EP (2006) Analysis of chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria tenella infections. Vet Immunol Immunopathol 114: 209–223. Hurley A, Maurer JJ & Lee MD (2008) Using bacteriophages to modulate Salmonella colonization of the chicken’s gastrointestinal tract: lessons learned from in silico and in vitro modeling. Avian Dis 52: 599–607. Kurzez pa A, Daz browska K, Skaradzi nski G & G orski A (2009) Bacteriophage interactions with phagocytes and their potential significance in experimental therapy. Clin Exp Med 9: 93–100. Kwon YM, Woodward CL, Corrier DE, Byrd JA, Pillai SD & Ricke SC (2000) Recovery of a marker strain of Salmonella typhimurium in litter and aerosols from isolation rooms containing infected chickens. J Environ Sci Health 35: 517–525. Lee SH, Lillehoj HS, Hong YH, Jang SI, Lillehoj EP, Ionescu C, Mazuranok & Bravo D (2010) In vitro effects of plant and mushroom extracts on immunological function of chicken lymphocytes and macrophages. Br Poult Sci 51: 213–221. Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2ΔΔCT method. Methods 25: 402–408. Ma J, Zhang Y-G, Xia Y & Sun J (2010) The inflammatory cytokine tumor necrosis factor modulates the expression
FEMS Microbiol Lett 352 (2014) 11–17
Inflammatory-mediated responses to bacteriophage
of Salmonella typhimurium effector proteins. J Inflamm 7: 42. Park SH, Biswas D, Lingbeck J, Koo OK & Ricke SC (2013) Enhancement of chicken macrophage cytokine response to Salmonella Typhimurium when combined with bacteriophage P22. FEMS Microbiol Lett 339: 137–144. Paul JH (2008) Prophages in marine bacteria: dangerous molecular time bombs or the key to survival in the seas? ISME J 2: 579–589. Smith CK, Kaiser P, Rothwell L, Humphrey T, Barrow PA & Jones MA (2005) Campylobacter jejuni-induced cytokine responses in avian cells. Infect Immun 73: 2094–2100. Stanley TL, Ellermeier CD & Slauch JM (2000) Tissue-specific gene expression identifies a gene in the lysogenic phage gifsy-1 that affects Salmonella enterica Serovar Typhimurium survival in peyer’s patches. J Bacteriol 182: 4406–4413.
FEMS Microbiol Lett 352 (2014) 11–17
17
Wang X, Kim Y, Ma Q, Hong SH, Pokusaeva K, Sturino JM & Wood TK (2010) Cryptic prophages help bacteria cope with adverse environments. Nat Commun 1: 147. Weinbauer MG & Suttle CA (1996) Potential significance of lysogeny to bacteriophage production and bacterial mortality in coastal waters of the gulf of Mexico. Appl Environ Microbiol 62: 4374–4380. Withanage GSK, Mastroeni P, Brooks HJ, Maskell DJ & McConnell I (2005) Oxidative and nitrosative responses of the chicken macrophage cell line MQ-NCSU to experimental Salmonella infection. Br Poult Sci 46: 261–267. Zhao T, Zhao P, Cannon JL & Doyle MP (2011) Inactivation of Salmonella in biofilms and on chicken cages and preharvest poultry by levulinic acid and sodium dodecyl sulfate. J Food Prot 74: 2024–2030. Zou W, Frye JG, Chang CW, Liu J, Cerniglia CE & Nayak R (2009) Microarray analysis of antimicrobial resistance genes in Salmonella enterica from preharvest poultry environment. J Appl Microbiol 107: 906–914.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Influence of bacteriophage P22 on the inflammatory mediator gene expression in chicken macrophage HD11 cells infected with Salmonella Typhimurium Juhee Ahn1 & Debabrata Biswas2 1
Department of Medical Biomaterials Engineering, Kangwon National University, Chuncheon, Gangwon, South Korea; and 2Department of Animal and Avian Sciences, University of Maryland, College Park, MD, USA
Correspondence: Department of Avian and Animal Sciences, University of Maryland, College Park, MD 20742, USA. Tel.: +1 301 405 3791; fax: +1 301 405 1677; e-mail: [email protected] Received 8 December 2013; revised 25 December 2013; accepted 7 January 2014. Final version published online 27 January 2014. DOI: 10.1111/1574-6968.12379
MICROBIOLOGY LETTERS
Editor: Wolfgang Schumann Keywords Salmonella Typhimurium; bacteriophage; lysogeny; macrophage; HD11 cell; inflammatory mediator.
Abstract This study was designed to evaluate the effects of bacteriophage on the intracellular survival and immune mediator gene expression in chicken macrophagelike HD11 cells. The invasive ability and intracellular survival of Salmonella Typhimurium (STP22) and lysogenic S. Typhimurium (STP22+) in HD11 cells were evaluated at 37 °C for 24 h postinfection (hpi). The expression of inflammatory mediator genes was determined in STP22- and STP22+-infected HD11 cells treated with and without bacteriophage P22 at 1 and 24 hpi using quantitative RT-PCR. The ability of STP22 and STP22+ to invade HD11 cells was significantly decreased by bacteriophage P22 at 1 hpi. The numbers of intracellular STP22 and STP22+ were significantly decreased from 2.39 to 1.62 CFU cm2 and from 3.40 to 1.72 CFU cm2 in HD11 cells treated with bacteriophage P22, respectively, at 24 hpi. The enhanced expression of inflammatory mediators was observed in STP22- and STP22+-infected HD11 cells treated with and without bacteriophage P22. These results suggest that the application of bacteriophage could be an effective way to control the intracellular infection.
Introduction As the gastrointestinal tract of poultry is a potential carrier of pathogenic bacteria, the preharvest interventions for reducing intracellular Salmonella spp. have become a leading priority in the poultry industry. In the last few decades, many preventive and therapeutic approaches such as antibiotic use, chemical acidification, and vaccination have been developed to reduce the colonization and invasion by extraintestinal pathogens (Kwon et al., 2000; Dueger et al., 2003; Zhao et al., 2011). Despite their effectiveness, there still remain adverse outcomes of using these technologies, including the emergence of new antibiotic-resistant and acid-tolerant bacteria, the imbalance of indigenous intestinal microflora, and the limited efficacy of vaccine (Bach et al., 2002; Zou et al., 2009). Therefore, continuous endeavors are necessary to develop alternative strategies over current preharvest poultry safety interventions. Recently, bacteriophage has received great attention as a promising approach for the prevention and treatment FEMS Microbiol Lett 352 (2014) 11–17
for infectious diseases due to its effectiveness against antibiotic-resistant pathogens, specificity to the target pathogen, cost-effectiveness to develop therapeutic system, and no serious side effects on eukaryotic host cells (Atterbury et al., 2007; Bardina et al., 2012). Many studies have reported the effect of lytic bacteriophage on the reduction in bacterial colonization in chickens (Atterbury et al., 2007; Hurley et al., 2008; Bardina et al., 2012). From the phage therapeutic point of view, there is an important challenging question of whether lytic phages can pass the epithelium barrier to reach the site where intracellular pathogens are located against the host immune system (G orski et al., 2006). Thus, lysogenic strain can be considered as a potential vehicle to deliver lytic phages, leading to the negative allelopathy on the intracellular pathogens (Broxmeyer et al., 2002; Paul, 2008). However, there have been relatively few studies on the potential role of lytic phage and lysogeny in reducing colonization of invading pathogens underlying the cellular and molecular immune responses. Therefore, a systematic approach toward studying the colonization and survival of invading ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
12
pathogens in the presence of bacteriophages is needed to enhance the understanding of host–pathogen interactions in the cellular immune response levels and ultimately design an effective and safe phage therapeutic strategy. The objective of this study was to evaluate the role of bacteriophage P22 in the pathogenesis of intracellular nonlysogenic and lysogenic Salmonella enterica serovar Typhimurium in HD11 cells as measured by bacterial invasiveness, intracellular survival, and inflammatory mediator gene expression.
Materials and methods Bacterial strains and culture conditions
Strains of S. enterica serovar Typhimurium ATCC 19585 (STP22) and S. Typhimurium lysogen carrying P22 prophage ATCC 23555 (STP22+) were purchased from American Type Culture Collection (ATCC, Manassas, VA). The strains were cultivated in Luria–Bertani (LB) broth (Difco, Becton, Dickinson and Co., Sparks, MD) at 37 °C for 20 h. After cultivation, cultures were collected by centrifugation at 3000 g for 20 min at 4 °C. Bacteriophage culture and plaque assay
Bacteriophage P22 (ATCC 97540) was propagated on LB broth containing STP22 to collect a bacteriophage stock. After 24-h incubation at 37 °C, the cultures were centrifuged at 10 000 g for 20 min, and the supernatant was passed through a 0.2-lm filter to remove remaining bacterial cells. The filtrates were further purified according to the cesium chloride gradient ultracentrifugation followed by dialysis (Green & Sambrook, 2012). According to bacteriophage plaque assay, phage titer was determined using a soft agar overlay method. The collected bacteriophages were serially diluted (1 : 10) with PBS buffer. The decimal dilutions (10 lL each) were mixed with 0.5% LB soft agar (45 °C) containing STP22 and pour-plated on the surface of prewarmed 1.5% LB agar. The plates were incubated for 24 h at 37 °C to enumerate free lytic phages. The purified bacteriophage stock was stored at 4 °C prior to use. Cell lines and culture conditions
Chicken macrophage-like cell line, HD11 cells, was provided by Dr. Uma S. Babu at the Immunobiology Branch, Food and Drug Administration (Laurel, MD). The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 2 mM L-glutamine, 10% heat-inactivated chicken serum (Sigma-Aldrich, St. Louis, MO), and antibiotics (100 U mL1 penicillin and ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J. Ahn & D. Biswas
100 lg mL1 streptomycin) in the incubator with 5% CO2 at 37 °C. For the invasion assay, the HD11 cells were seeded at 2 9 106 cells mL1 into 25 cm2 T-flask (BD Falcon, Franklin Lakes, NJ) and allowed to proliferate up to approximately 85% confluence for 24–48 h at 37 °C. The postconfluent cultures were rinsed two times with PBS buffer and then replaced with fresh nonsupplemented DMEM for 1 h prior to bacterial infection. Cell invasion assay
The strains of STP22 and STP22+ (106 CFU mL1 each) were infected into the postconfluent HD11 cell monolayers at 37 °C for 1 h in 25 cm2 T-flask containing antibiotic and serum-free DMEM with and without bacteriophage P22 (108 PFU mL1). Noninfected HD11 cells were also incubated 37 °C for 1 h with and without bacteriophage P22 as controls. At 1 h postinfection (hpi), STP22-, STP22+-, and noninfected HD11 cells were rinsed two times with PBS buffer to remove nonadherent cells and treated with DMEM containing 100 lg mL1 of gentamicin at 37 °C for 1 h to eliminate extracellular bacteria. After gentamicin treatment, the STP22-, STP22+-, and noninfected HD11 cells were incubated in the absence or the presence of bacteriophage P22 at 37 °C for 24 h. Enumeration of intracellular bacteria
At 1 and 24 hpi, the HD11 cells treated with 100 lg mL1 of gentamicin at 37 °C for 1 h lysed with 1 mL of 1% Triton X-100 in PBS buffer for 15 min at 37 °C to release intracellular bacteria. The lysates were centrifuged at 3000 g for 10 min and resuspended in 1 mL of PBS buffer. The collected lysates were serially (1 : 10) diluted with PBS buffer, and proper dilutions were plated on LB agar. The plates were incubated for 24–48 h at 37 °C to enumerate intracellular STP22 and STP22+ cells. Quantitative RT-PCR assay
The collected HD11 cells at 1 and 24 hpi were rinsed with 2 mL of ice-cold PBS. The RNA extraction was carried out using Spin-AwayTM Filter and Zymo-SpinTM IIICG Column according to the protocol of ZR RNA MiniPrep kit (Zymo Research Corp., Irvine, CA). The cDNA synthesis was performed according to the protocol of qScript cDNA SuperMix (Quanta Biosciences, Gaithersburg, MD). The PCR mixture containing 10 lL of PerfeCTa SYBR Green FastMix (Quanta Biosciences), 3 lL of each primer (100 nM), and 4 lL of cDNA (10 ng) was amplified using an Eco Real-Time PCR system (Illumina, San Diego, CA). The oligonucleotide primers (Erofins MWG Operon, Huntsville, AL) are listed in Table 1. The PCR FEMS Microbiol Lett 352 (2014) 11–17
13
Inflammatory-mediated responses to bacteriophage
mixture was denatured at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, 55 °C for 15 s, and 72 °C for 10 s. The relative expression levels of genes were estimated by the comparative method (Livak & Schmittgen, 2001). The Ct values of target genes in STP22- and STP22+-infected HD11 cells were compared with those in noninfected HD11 cells without P22 at 1 hpi. The reference gene (GAPDH mRNA) was used for normalization of inflammatory mediator gene expression. The fold changes in expression of the target genes [interleukin-1b (IL-1b), IL-6, IL-8, IL-10, LPS-induced tumor necrosis alpha factor (LITAF), and inducible nitric oxide synthase (iNOS) mRNAs] were calculated as follows: DDCt ¼ ðCt ½each target mRNA Ct ½GAPDH mRNAÞtreatment ðCt ½each target mRNA Ct ½GAPDH mRNAÞcontrol Statistical analysis
All experiments were conducted with three replicates. Data were analyzed using the Statistical Analysis System software. The general linear model and least significant difference (LSD) procedures were used to evaluate the treatment as a fixed effect. Significant mean differences were calculated by Fisher’s LSD at P < 0.05.
Results Invasive ability and intracellular survival of S. Typhimurium in HD11 cells exposed to bacteriophage P22
The ability of STP22 and STP22+ strains to invade HD11 cells was evaluated in the absence and presence of bacterio-
phage P22 at 1 hpi (Table 2). The invasive ability of STP22 and STP22+ was significantly decreased in the HD11 cells at 1 hpi when treated with bacteriophage P22. The numbers of invading STP22 and STP22+ in HD cells were 3.54 and 4.06 log CFU cm2, respectively, in the absence of bacteriophage P22, while those were 2.39 and 3.40 log CFU cm2, respectively, in the presence of bacteriophage P22. The highest invasive ability was observed in the STP22+-infected HD11 cells at 1 hpi (71%), while the least invasive ability was observed in the STP22-infected HD11 cells treated with bacteriophage P22 (41%). The intracellular survival of STP22 and STP22+ was evaluated in HD11 cells treated with and without bacteriophage P22 at 24 hpi (Table 2). Regardless of bacteriophage P22 treatment, the numbers of intracellular STP22 and STP22+ cells were decreased in HD11 treated with and without bacteriophage P22. However, noticeable reduction was observed in STP22+-infected HD11 cells treated with bacteriophage P22, showing 1.68 log reduction (Table 2). Compared with the invading numbers at 1 hpi, the intracellular STP22 and STP22+ cells remained 75% and 77%, respectively, in HD11 cells treated without bacteriophage P22 at 24 hpi, while those were decreased to 68% and 51% in HD11 cells treated with bacteriophage P22. Differential expression of inflammatory mediator genes in S. Typhimurium-infected HD11 cells exposed to bacteriophage P22
The relative expression of IL-1b, IL-6, IL-8, IL-10, LITAF, and iNOS mRNAs was estimated in STP22- and STP22+infected HD11 cells treated with and without bacteriophage P22 at 1 and 24 hpi (Fig. 1). The relative expression levels of IL-1b mRNA were highly increased up to 7.26- and 6.93-fold in STP22-infected HD11 cells treated with and without bacteriophage P22 at 1 hpi, respectively,
Table 1. Primers used in quantitative RT-PCR analysis for HD11 cells RNA target
Primer sequence
Accession number
Reference
GAPDH
F: GGTGGTGCTAAGCGTGTTAT R: ACCTCTGTCATCTCTCCACA F: GCTCTACATGTCGTGTGTGATGAG R: TGTCGATGTCCCGCATGA F: GCTCGCCGGCTTCGA R: GGTAGGCTGAAAGGCGAACAG F: GCCCTCCTCCTGGTTTCAG R: TGGCACCGCAGCTCATT F: CATGCTGCTGGGCCTGAA R: CGTCTCCTTGATCTGCTTGATG F: TGTGTATGTGCAGCAACCCGTAGT R: GGCATTGCAATTTGGACAGAAGT F: TTGGAAACCAAAGTGTGTAATATCTTG R: CCCTGGCCATGCGTACAT
K01458
Hong et al. (2006)
AJ245728
Smith et al. (2005)
AJ250838
Smith et al. (2005)
AJ009800
Hong et al. (2006)
AJ621614
Hong et al. (2006)
AY765397
Hong et al. (2006)
U46504
Hong et al. (2006)
IL-1b IL-6 IL-8 IL-10 LITAF iNOS
F and R indicate forward and reverse primers, respectively.
FEMS Microbiol Lett 352 (2014) 11–17
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
14
J. Ahn & D. Biswas
Table 2. Invasive ability and intracellular survival of Salmonella Typhimurium (STP22) and S. Typhimurium lysogen carrying P22 prophage (STP22+) in chicken macrophage HD11 cells S. Typhimurium (log CFU cm2) Treatment
0 hpi
1 hpi
STP22
5.75 0.09A
STP22 + P22
5.78 0.11A
STP22+
5.73 0.18A
STP22+ + P22
5.69 0.21A
3.54 (62)* 2.39 (41) 4.06 (71) 3.40 (60)
24 hpi 0.26A 0.16B 0.23A 0.31A,B
2.64 (75)† 1.62 (68) 3.12 (77) 1.72 (51)
0.18A 0.27B 0.20A 0.15B
Means with different letters (A and B) within a column are significantly different at P < 0.05. *Invasion ability (%) is estimated by [(cell number at 1 hpi)/(cell number at 0 hpi) 9 100]. † Intracellular survival (%) is estimated by [(cell number at 24 hpi)/(cell number at 1 hpi) 9 100].
which were significantly decreased at 24 hpi (P < 0.05). The highest level of IL-1b mRNA transcripts (5.96-fold) was observed in STP22+-infected HD11 cells treated without bacteriophage P22, followed by noninfected HD11 cells treated with bacteriophage P22 (5.44-fold). The IL-6 transcript level was increased by 4.02-fold in STP22infected HD11 cells treated without bacteriophage P22. Compared with the 1 hpi (1.15-fold), the relative expression of IL-6 in STP22+-infected HD11 cells treated without bacteriophage P22 was significantly increased to 2.98-fold at 24 hpi. The highest expression levels of IL-8 mRNA were observed in STP22-infected HD11 cells treated with bacteriophage P22 at 1 and 24 hpi, showing 6.59- and 6.92-fold, respectively. The IL-8 mRNA transcripts at 1 hpi were significantly increased to 7.14- and 7.75-fold in STP22+-infected HD11 cells treated without and with P22, respectively, at 24 hpi. The IL-10 transcript levels were not significantly different in all treatments at 1 hpi. The high expression levels of LITAF were observed in STP22-infected HD11 cells treated without bacteriophage P22 at 1 hpi (2.50-fold) and STP22+-infected HD11 cells treated with bacteriophage P22 at 24 hpi (2.04-fold). The relative expression levels of iNOS mRNA were increased by more than fourfold in STP22- and STP22+-infected HD11 cells treated with and without bacteriophage P22 at 1 and 24 hpi.
Discussion The invasive ability of STP22 and STP22+ strains was significantly decreased in bacteriophage P22-treated HD11 cells at 1 hpi (Table 2). The results suggest that bacteriophage P22 can interact with STP22 and HD11 ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
cells, leading to lytic phage activity and activated macrophage (Kurzez pa et al., 2009). The specific receptors on the surface of invading STP22 cells may allow the adsorption of bacteriophage P22, resulting in the considerable reduction in STP22 in the bacteriophage P22-treated HD cells (Park et al., 2013). The high survival rates of STP22 and STP22+ cells were observed in HD11 cells treated without bacteriophage P22 at 24 hpi, indicating increased resistance to macrophage-associated immune system (Table 2). In general, the intracellular S. Typhimurium can evolve dynamic survival processes such as SPI-1 and SPI-2 systems, resulting in severe systemic infection (Flannagan et al., 2009). The number of viable intracellular STP22+ was higher than that of STP22 in HD11 cells, suggesting that prophages can contribute to the enhanced survival of lysogeny in the host cell lines (Stanley et al., 2000; Wang et al., 2010). The increased intracellular survival of STP22+ may result in a competitive advantage of avoiding the host immune response (Wang et al., 2010). Prophage induction was not occurred in HD11 cells infected with STP22+, showing no free bacteriophages were observed at 24 hpi (data not shown). This implies that the intracellular STP22+ in HD11 cells maintains the lysogenic state as a survival strategy in low number of phage-sensitive bacteria (Weinbauer & Suttle, 1996). However, the intracellular STP22 and STP22+ in HD11 cells were effectively inactivated in the presence of bacteriophage P22 at 24 hpi (Table 2), suggesting that bacteriophage P22 can induce host immune responses. The mononuclear phagocytic cells are a primary immune system against invading pathogens. The activated macrophages can secret a series of inflammatory factors, including nitrogen species, chemokines, proinflammatory, and anti-inflammatory cytokines (Smith et al., 2005; Flannagan et al., 2009; Lee et al., 2010). The inflammatory mediator expression in HD11 cells varied with treatments, including the types of infected strains, the absence and presence of bacteriophage P22, and the stages of bacterial infections (Fig. 1). The inflammatory factors may require early immune mediators, which are produced from other immune cell lines such as granulocytic, T, B, or NK cells, to initiate the cascade regulation of cytokine and chemokine production. IFN-c stimulates NO synthesis in a dose-dependent manner (He et al., 2011) and also induces TNF-a production, which is directly involved in the bactericidal activity in HD11 cells (Smith et al., 2005). IL-10 and IL-8 are produced primarily by CD4+ TH2, dendritic, B, or CD8+ T cells (He et al., 2011). Compared with the noninfected HD11 cells, the expression of IL-1b and IL-6 mRNA was increased by STP22 and STP22+ at 1 and 24 hpi (Fig. 1). This is in accordance with previous reports that proinflammatory cytokines FEMS Microbiol Lett 352 (2014) 11–17
15
Inflammatory-mediated responses to bacteriophage
10
(a)
Control Control + P22
9
*
A a
7 Fold change
STP22– STP22– + P22
A * a A a
8
STP22+ STP22+ + P22
A A b b
A b
6 B a
5
BC c
A c
4
A a B a
B bc
B b
BC c
2
*
C ab
C a
B d
C b
D c
C bc
1 0
10
IL-1β
IL-6
IL-10
IL-8
A ab
* A ab
*
Fold change
7
iNOS
*
* B b
AB bc
5
B c
*
AB ab B b
B ab
C c
D CD C CD a a ab ab
3
C ab BC b
A c
* D a
C B ab b
2
C a
* B a B ab
*
4
C * B ab D D b D ab ab b
C d
B c
C c
IL-1β
(IL-1b and IL-6) were produced at high levels after bacterial infection by pathogen-associated molecular patterns (Smith et al., 2005; Hong et al., 2006). However, IL-6 is also known as anti-inflammatory cytokine and produced by other than bacterial invasion (Lee et al., 2010). IL-1b and IL-6 can stimulate B-lymphocytes and T cells, leading to the production of antibiotics and enhancement of adaptive immune responses (Lee et al., 2010). IL-10 is known as the inhibitor of IFN-c synthesis, NO, and TNF-a production (He et al., 2011), which were not agreed to the STP22- and STP22+-infected HD11 cells. The induction of inflammatory cytokines, chemokines, FEMS Microbiol Lett 352 (2014) 11–17
LITAF
B a
A ab A b
BC a
B ab
*
A a
6
0
D C c c
*
8
1
C b
(b)
9
Fig. 1. Relative expression of IL-1b, IL-6, IL-8, IL-10, LITAF, and iNOS mRNA in Salmonella Typhimurium-infected HD11 cells treated with and without bacteriophage P22 at 1 hpi (a) and 24 hpi (b). Means with different letters within each inflammatory mediator gene (a–d) and each treatment (A–D) are significantly different at P < 0.05. *Significant difference between 1 and 24 hpi at P < 0.05.
B B a a
B ab
B ab
B b
C bc
3
B a
IL-6
IL-8
IL-10
LITAF
iNOS
and anti-inflammatory cytokines is a complex phenomenon involved in the interactions of the host cells with bacteria and phages (Kurzez pa et al., 2009). NO production is used as an indicator of innate immunity in macrophages against bacterial infection (Crippen, 2006; Lee et al., 2010). The expression of iNOS mRNA was consistently high in STP22- and STP22+-infected HD11 cells, confirming that the NO production stimulated by SPI-1 effector protein (SopB) was occurred in infection process (Drecktrah et al., 2005). Salmonella effector proteins such as SipA and SpvB are mainly involved in the inhibition of proinflammatory cytokine production, which are reguª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
16
lated by TNF-a (Ma et al., 2010). The enhanced inflammatory mediator expression can stimulate the antimicrobial activity of macrophage against intracellular pathogens (Withanage et al., 2005), leading to the reduction in intracellular STP22 and STP22+ in HD11 cells. However, the mRNA expression levels did not always correlate with the protein expression levels due to the various post-transcriptional modifications (Park et al., 2013). In conclusion, this study focused on a potentially new concept to control the intracellular STP22 and STP22+ in HD11 cells. Macrophages play an essential role in innate and adapted immune responses to bacterial infection. However, the intracellular S. Typhimurium can circumvent the immune system and even replicate within macrophages. This study found that the phagocytosis of intracellular STP22 and STP22+ by HD11 cells was affected by bacteriophage P22. The significant reductions in intracellular STP22 and STP22+ were observed in the HD11 cells treated with bacteriophage P22. The bacteriophage P22treated HD11 cells resulted in the noticeable reduction in invading ability of STP22 and STP22+. The HD11 cells infected with STP22 and STP22+ enhanced the expression levels of inflammatory mediator genes regardless of bacteriophage P22. Bacteriophage P22 enhanced protective immunity against intracellular S. Typhimurium. Therefore, bacteriophages can be used for controlling the intracellular pathogen and modulating macrophage-associated immune mediator production. This study would provide a great insight into the bacteriophage–host interactions and help to design an effective and safe phage therapeutic strategy.
Acknowledgements We like to thank Dr. Uma Babu, FDA, Laurel, MD for providing the cell lines used in this study. This work was supported by a grant from Maryland Agricultural Experimental Station (MAES). This study was also supported by Kangwon National University (2012).
References Atterbury RJ, Van Bergen MA, Ortiz F, Lovell MA, Harris JA, De Boer A, Wagenaar JA, Allen VM & Barrow PA (2007) Bacteriophage therapy to reduce Salmonella colonization of broiler chickens. Appl Environ Microbiol 73: 4543–4549. Bach SJ, McAllister TA, Veira DM, Gannon VPJ & Holley RA (2002) Transmission and control of Escherichia coli O157: H7. Can J Anim Sci 82: 475–490. Bardina C, Spricigo DA, Cortes P & Llagostera M (2012) Significance of the bacteriophage treatment schedule in reducing Salmonella colonization of poultry. Appl Environ Microbiol 78: 6600–6607.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
J. Ahn & D. Biswas
Broxmeyer L, Sosnowska D, Miltner E, Chac on O, Wagner D, McGarvey J, Barletta RG & Bermudez LE (2002) Killing of Mycobacterium avium and Mycobacterium tuberculosis by a mycobacteriophage delivered by a nonvirulent Mycobacterium: a model for phage therapy of intracellular bacterial pathogens. J Infect Dis 186: 1155–1160. Crippen TL (2006) The selective inhibition of nitric oxide production in the avian macrophage cell line HD11. Vet Immunol Immunopathol 109: 127–137. Drecktrah D, Knodler LA, Galbraith K & Steele-Mortimer O (2005) The Salmonella SPI1 effector SopB stimulates nitric oxide production long after invasion. Cell Microbiol 7: 105–113. Dueger EL, House JK, Heithoff DM & Mahan MJ (2003) Salmonella DNA adenine methylase mutants prevent colonization of newly hatched chickens by homologous and heterologous serovars. Int J Food Microbiol 80: 153–159. Flannagan RS, Cosio G & Grinstein S (2009) Antimicrobial mechanisms of phagocytes and bacterial evasion strategies. Nat Rev Microbiol 7: 355–366. G orski A, Wa_zna E, Daz browska B-W, Daz browska K, Switała-Jele n K & Miez dzybrodzki R (2006) Bacteriophage translocation. FEMS Immunol Med Microbiol 46: 313–319. Green MR & Sambrook J (2012) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, New York. He H, Genovese KJ & Kogut MH (2011) Modulation of chicken macrophage effector function by TH1/TH2 cytokines. Cytokine 53: 363–369. Hong YH, Lillehoj HS, Lee SH, Dalloul RA & Lillehoj EP (2006) Analysis of chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria tenella infections. Vet Immunol Immunopathol 114: 209–223. Hurley A, Maurer JJ & Lee MD (2008) Using bacteriophages to modulate Salmonella colonization of the chicken’s gastrointestinal tract: lessons learned from in silico and in vitro modeling. Avian Dis 52: 599–607. Kurzez pa A, Daz browska K, Skaradzi nski G & G orski A (2009) Bacteriophage interactions with phagocytes and their potential significance in experimental therapy. Clin Exp Med 9: 93–100. Kwon YM, Woodward CL, Corrier DE, Byrd JA, Pillai SD & Ricke SC (2000) Recovery of a marker strain of Salmonella typhimurium in litter and aerosols from isolation rooms containing infected chickens. J Environ Sci Health 35: 517–525. Lee SH, Lillehoj HS, Hong YH, Jang SI, Lillehoj EP, Ionescu C, Mazuranok & Bravo D (2010) In vitro effects of plant and mushroom extracts on immunological function of chicken lymphocytes and macrophages. Br Poult Sci 51: 213–221. Livak KJ & Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2ΔΔCT method. Methods 25: 402–408. Ma J, Zhang Y-G, Xia Y & Sun J (2010) The inflammatory cytokine tumor necrosis factor modulates the expression
FEMS Microbiol Lett 352 (2014) 11–17
Inflammatory-mediated responses to bacteriophage
of Salmonella typhimurium effector proteins. J Inflamm 7: 42. Park SH, Biswas D, Lingbeck J, Koo OK & Ricke SC (2013) Enhancement of chicken macrophage cytokine response to Salmonella Typhimurium when combined with bacteriophage P22. FEMS Microbiol Lett 339: 137–144. Paul JH (2008) Prophages in marine bacteria: dangerous molecular time bombs or the key to survival in the seas? ISME J 2: 579–589. Smith CK, Kaiser P, Rothwell L, Humphrey T, Barrow PA & Jones MA (2005) Campylobacter jejuni-induced cytokine responses in avian cells. Infect Immun 73: 2094–2100. Stanley TL, Ellermeier CD & Slauch JM (2000) Tissue-specific gene expression identifies a gene in the lysogenic phage gifsy-1 that affects Salmonella enterica Serovar Typhimurium survival in peyer’s patches. J Bacteriol 182: 4406–4413.
FEMS Microbiol Lett 352 (2014) 11–17
17
Wang X, Kim Y, Ma Q, Hong SH, Pokusaeva K, Sturino JM & Wood TK (2010) Cryptic prophages help bacteria cope with adverse environments. Nat Commun 1: 147. Weinbauer MG & Suttle CA (1996) Potential significance of lysogeny to bacteriophage production and bacterial mortality in coastal waters of the gulf of Mexico. Appl Environ Microbiol 62: 4374–4380. Withanage GSK, Mastroeni P, Brooks HJ, Maskell DJ & McConnell I (2005) Oxidative and nitrosative responses of the chicken macrophage cell line MQ-NCSU to experimental Salmonella infection. Br Poult Sci 46: 261–267. Zhao T, Zhao P, Cannon JL & Doyle MP (2011) Inactivation of Salmonella in biofilms and on chicken cages and preharvest poultry by levulinic acid and sodium dodecyl sulfate. J Food Prot 74: 2024–2030. Zou W, Frye JG, Chang CW, Liu J, Cerniglia CE & Nayak R (2009) Microarray analysis of antimicrobial resistance genes in Salmonella enterica from preharvest poultry environment. J Appl Microbiol 107: 906–914.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
