The
n e w e ng l a n d j o u r na l
of
m e dic i n e
vided the rationale for our own study evaluating Paul K. Crane, M.D., M.P.H. longitudinal measures of renal function and de- University of Washington WA mentia risk.1 It would be very difficult to evaluate Seattle, [email protected] two time-varying exposures captured sporadically Rod Walker, M.S. in clinical care. Because we did not find a strong Eric B. Larson, M.D., M.P.H. relationship between the level of renal functionGroup Health Research Institute 1 ing and dementia risk in our cohort, we doubt Seattle, WA that the associations that we found in our cohort Since publication of their article, the authors report no furbetween glucose levels and dementia risk are ther potential conflict of interest. confounded by renal function. We agree that more 1. O’Hare AM, Walker R, Haneuse S, et al. Relationship beresearch is needed to elucidate the underlying tween longitudinal measures of renal function and onset of dementia in a community cohort of older adults. J Am Geriatr Soc causes of the association between glucose levels 2012;60:2215-22. and dementia risk. DOI: 10.1056/NEJMc1311765
Induction Regimens for ANCA-Associated Vasculitis To the Editor: In the 18-month follow-up report of the Rituximab in ANCA-Associated Vasculitis (RAVE) trial, Specks et al. (Aug. 1 issue)1 reported a noninferiority of intravenous rituximab (375 mg per square meter of body-surface area administered weekly for 4 weeks) as compared with oral cyclophosphamide (taken daily) followed by azathioprine. Complete remission was maintained in 39% of the patients in the rituximab group and in 33% of the patients in the comparison group. As compared with the results of the CYCLOPS trial, the relapse rate in the control group exceeded expectations (20.8% in the CYCLOPS trial vs. 29% in the RAVE trial), although the median follow-up in the CYCLOPS trial was 4.3 years.1,2 One explanation might be the rigorous tapering of glucocorticoids in the RAVE trial, because early discontinuation of glucocorticoids is one of the most significant risk factors for relapse.3 These differences were not discussed thoroughly, but clinical trials should address the need to prevent relapses in order to reduce treatment-related adverse events. Repeated administration of rituximab has shown encouraging results.4 Further trials that are now being conducted will reassess these preliminary data. Nonetheless, the results of the RAVE trial have disproved the hypothesis that prolonged immunosuppressive treatment is absolutely necessary in antineutrophil cytoplasmic antibody (ANCA)–associated vasculitis.
1864
Andreas Kronbichler, M.D. Julia Kerschbaum, M.D. Michael Rudnicki, M.D. Medical University Innsbruck Innsbruck, Austria [email protected] No potential conflict of interest relevant to this letter was reported. 1. Specks U, Merkel PA, Seo P, et al. Efficacy of remission-
induction regimens for ANCA-associated vasculitis. N Engl J Med 2013;369:417-27. 2. Harper L, Morgan MD, Walsh M, et al. Pulse versus daily oral cyclophosphamide for induction of remission in ANCA-associated vasculitis: long-term follow-up. Ann Rheum Dis 2012;71:955-60. 3. Walsh M, Merkel PA, Mahr AD, Jayne D. Effects of duration of glucocorticoid therapy on relapse rate in antineutrophil cytoplasmic antibody-associated vasculitis: a meta-analysis. Arthritis Care Res (Hoboken) 2010;62:1166-73. 4. Smith RM, Jones RB, Guerry MJ, et al. Rituximab for remission maintenance in relapsing antineutrophil cytoplasmic antibody-associated vasculitis. Arthritis Rheum 2012;64:3760-9. DOI: 10.1056/NEJMc1311108
To the Editor: Specks et al. report that for the treatment of severe ANCA-associated vasculitis, a single course of rituximab is noninferior to 18 months of the conventional regimen of daily cyclophosphamide followed by azathioprine. However, there are several reasons for advocating caution in using rituximab in such patients, particularly those with newly diagnosed disease. First, 20 patients (29%) in the cyclophosphamide–azathioprine group had a relapse before 18 months. The considerably higher proportion of patients
n engl j med 369;19 nejm.org november 7, 2013
The New England Journal of Medicine Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission. Copyright © 2013 Massachusetts Medical Society. All rights reserved.
correspondence
who had a relapse than in previous trials1,2 could indicate suboptimal administration of the standard therapy.3 Second, the results were based on an intention-to-treat analysis; the stability of the noninferiority inference should also be reported with respect to a per-protocol analysis.3 Third, the number of patients with at least one serious adverse event or non–disease-related serious adverse event was higher in the rituximab group than in the cyclophosphamide–azathioprine group (Table S3 in the Supplementary Appendix of the article, available at NEJM.org). In addition, the cost of rituximab far exceeds that of standard treatment, thereby calling into question the ancillary benefits3,4 of the drug that would justify its use in place of the conventional regimen. Fotini B. Karassa, M.D. University of Ioannina School of Medicine Ioannina, Greece [email protected] No potential conflict of interest relevant to this letter was reported. 1. Jayne D, Rasmussen N, Andrassy K, et al. A randomized
trial of maintenance therapy for vasculitis associated with antineutrophil cytoplasmic autoantibodies. N Engl J Med 2003;349: 36-44. 2. de Groot K, Harper L, Jayne DR, et al. Pulse versus daily oral cyclophosphamide for induction of remission in antineutrophil cytoplasmic antibody-associated vasculitis: a randomized trial. Ann Intern Med 2009;150:670-80. 3. Mulla SM, Scott IA, Jackevicius CA, You JJ, Guyatt GH. How to use a noninferiority trial: users’ guides to the medical literature. JAMA 2012;308:2605-11. 4. Piaggio G, Elbourne DR, Pocock SJ, Evans SJ, Altman DG. Reporting of noninferiority and equivalence randomized trials: extension of the CONSORT 2010 statement. JAMA 2012;308:2594604. DOI: 10.1056/NEJMc1311108
The authors reply: In response to Kronbichler et al.: the relapse rate in the RAVE trial appears higher than that reported for the European Vasculitis Study Group (EUVAS) trials. 1,2 The comparability of trial results is affected by important design differences between these trials and by specific definitions underpinning the analyses. The sample size and power calculations of the RAVE trial were based on results achieved with conventional therapy in a similar patient population, the participants in the Wegener’s Granulomatosis Etanercept Trial (WGET).3,4 The results achieved with cyclophosphamide–azathioprine
in the RAVE trial were similar to those achieved in the WGET.4 In contrast to the WGET and the RAVE trial, the EUVAS trials enrolled newly diagnosed patients only. Fifty-one percent of participants in the RAVE trial had relapsing disease at baseline, resulting in a higher overall relapse rate than observed in the EUVAS trials. However, the percentage of newly diagnosed participants in the RAVE trial who remained in complete remission that was achieved with cyclophosphamide– azathioprine (Fig. S3A in the Supplementary Appendix of our article) was similar to that of patients in the CYCLOPS trial at the same time point.2 Karassa asks about the stability of the noninferiority inference in a per-protocol analysis. Only three patients had to be excluded to create the per-protocol analysis sample, and the results of the per-protocol analysis did not differ significantly from those of the corresponding intentionto-treat analyses. In the intention-to-treat analysis up to the closeout date of the trial, the number of serious adverse events was numerically, but not significantly, higher in the rituximab group than in the cyclophosphamide–azathioprine group (Table S3 in the Supplementary Appendix of our article). This analysis includes all events, many of which occurred long after the protocol-specified experimental treatment, making attribution to either rituximab or cyclophosphamide–azathioprine difficult. Therefore, we showed the clinically more meaningful safety comparison for all patients receiving the originally assigned treatment in the main body of the article (Table 2 of our article). Cost-effectiveness was not addressed by our trial. This issue requires careful consideration in the context of different reimbursement systems keeping the overall economic effect of a specific treatment, rather than isolated drug cost, in mind. Patients receiving conventional immunosuppressive therapy need regular blood monitoring to ensure their safety, resulting in considerable time away from productive activities, and the downstream costs of cyclophosphamide therapy, including fertility evaluations, surveillance cystoscopic examinations, or cancer treatments, can be substantial. The results of our subgroup analyses may provide guidance for practitioners and their
n engl j med 369;19 nejm.org november 7, 2013
1865
The New England Journal of Medicine Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission. Copyright © 2013 Massachusetts Medical Society. All rights reserved.
The
n e w e ng l a n d j o u r na l
patients when making individual treatment decisions, which certainly should include economic considerations. Ulrich Specks, M.D. Mayo Clinic Rochester, MN
David Ikle, Ph.D. Rho Chapel Hill, NC
John H. Stone, M.D., M.P.H. Massachusetts General Hospital Boston, MA Since publication of their article, the authors report no further potential conflict of interest.
of
m e dic i n e
1. Jayne D, Rasmussen N, Andrassy K, et al. A randomized
trial of maintenance therapy for vasculitis associated with antineutrophil cytoplasmic autoantibodies. N Engl J Med 2003;349: 36-44. 2. Harper L, Morgan MD, Walsh M, et al. Pulse versus daily oral cyclophosphamide for induction of remission in ANCAassociated vasculitis: long-term follow-up. Ann Rheum Dis 2012; 71:955-60. 3. Specks U, Merkel PA, Hoffman GS. Design of the Rituximab in ANCA-associated Vasculitis (RAVE) Trial. Open Arthritis J 2011; 4:1-18 (http://benthamscience.com/open/toarthj/articles/V004/ 1TOARTHJ.pdf). 4. Wegener’s Granulomatosis Etanercept Trial (WGET) Research Group. Etanercept plus standard therapy for Wegener’s granulomatosis. N Engl J Med 2005;352:351-61. DOI: 10.1056/NEJMc1311108
Bradyrhizobium enterica in Cord Colitis Syndrome To the Editor: A 48-year-old woman presented with nonbloody diarrhea 9 months after cordblood transplantation. Her condition was caused by colitis and met the criteria for cord colitis syndrome.1 Two courses of metronidazole were administered and were followed by clinical and en-
doscopically confirmed remission. Colonoscopy was performed during active colitis and at the end of antibiotic therapy. Colonic biopsies were performed on both occasions, and specimens were frozen and were analyzed by means of 16S rDNA–based microbial community profiling with
Table 1. Relative Counts of the 10 Most Abundant Bacteria in Mucosa Samples Obtained from a Patient with Cord Colitis Syndrome during Active Disease and during Remission.* Organism
Active Disease
Remission
Count in Ascending Colon Count in Sigmoid Colon (N = 3823) (N = 1458)
Count in Sigmoid Colon (N = 2418)
percent Bacteroides fragilis (OTU240)†
35.21
41.29
0.62
Clostridium species (OTU92)†
9.73
5.35
1.24
Ruminococcus species
8.32
4.05
0.00
Escherichia coli
8.03
9.88
18.53
Blautia species (OTU28)†
5.60
1.71
0.58
Veillonella dispar
4.29
1.17
0.04
Fusobacterium species
3.61
0.07
0
B. fragilis (OTU140)†
2.30
3.57
0
Blautia species (OTU529)†
2.17
0.69
0.17
Clostridium species (OTU430)†
2.04
1.71
0
Bradyrhizobium enterica
0
0
0
* Biopsy specimens were obtained during active cord colitis syndrome (336 days after hematopoietic stem-cell transplantation [HSCT]) and after antibiotic therapy (408 days after HSCT). Specimens were analyzed by means of micro bial community profiling with the use of the 16S rDNA gene primers 8F (AGAGTTTGATCCTGGCTCAG) and 534R (ATTACCGCGGCTGCTGG), which are known to capture B. enterica. Organisms are listed according to their abundance in the ascending colon during active disease. † Two different phylotypes of B. fragilis were identified (operational taxonomic units [OTUs] 240 and 140), and they did not cluster when a cutoff of 97% sequence similarity was used for the annotation of 16S rDNA reads. They may represent different strains of B. fragilis. This finding also applies to clostridium species and blautia species.
1866
n engl j med 369;19 nejm.org november 7, 2013
The New England Journal of Medicine Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission. Copyright © 2013 Massachusetts Medical Society. All rights reserved.
n e w e ng l a n d j o u r na l
of
m e dic i n e
vided the rationale for our own study evaluating Paul K. Crane, M.D., M.P.H. longitudinal measures of renal function and de- University of Washington WA mentia risk.1 It would be very difficult to evaluate Seattle, [email protected] two time-varying exposures captured sporadically Rod Walker, M.S. in clinical care. Because we did not find a strong Eric B. Larson, M.D., M.P.H. relationship between the level of renal functionGroup Health Research Institute 1 ing and dementia risk in our cohort, we doubt Seattle, WA that the associations that we found in our cohort Since publication of their article, the authors report no furbetween glucose levels and dementia risk are ther potential conflict of interest. confounded by renal function. We agree that more 1. O’Hare AM, Walker R, Haneuse S, et al. Relationship beresearch is needed to elucidate the underlying tween longitudinal measures of renal function and onset of dementia in a community cohort of older adults. J Am Geriatr Soc causes of the association between glucose levels 2012;60:2215-22. and dementia risk. DOI: 10.1056/NEJMc1311765
Induction Regimens for ANCA-Associated Vasculitis To the Editor: In the 18-month follow-up report of the Rituximab in ANCA-Associated Vasculitis (RAVE) trial, Specks et al. (Aug. 1 issue)1 reported a noninferiority of intravenous rituximab (375 mg per square meter of body-surface area administered weekly for 4 weeks) as compared with oral cyclophosphamide (taken daily) followed by azathioprine. Complete remission was maintained in 39% of the patients in the rituximab group and in 33% of the patients in the comparison group. As compared with the results of the CYCLOPS trial, the relapse rate in the control group exceeded expectations (20.8% in the CYCLOPS trial vs. 29% in the RAVE trial), although the median follow-up in the CYCLOPS trial was 4.3 years.1,2 One explanation might be the rigorous tapering of glucocorticoids in the RAVE trial, because early discontinuation of glucocorticoids is one of the most significant risk factors for relapse.3 These differences were not discussed thoroughly, but clinical trials should address the need to prevent relapses in order to reduce treatment-related adverse events. Repeated administration of rituximab has shown encouraging results.4 Further trials that are now being conducted will reassess these preliminary data. Nonetheless, the results of the RAVE trial have disproved the hypothesis that prolonged immunosuppressive treatment is absolutely necessary in antineutrophil cytoplasmic antibody (ANCA)–associated vasculitis.
1864
Andreas Kronbichler, M.D. Julia Kerschbaum, M.D. Michael Rudnicki, M.D. Medical University Innsbruck Innsbruck, Austria [email protected] No potential conflict of interest relevant to this letter was reported. 1. Specks U, Merkel PA, Seo P, et al. Efficacy of remission-
induction regimens for ANCA-associated vasculitis. N Engl J Med 2013;369:417-27. 2. Harper L, Morgan MD, Walsh M, et al. Pulse versus daily oral cyclophosphamide for induction of remission in ANCA-associated vasculitis: long-term follow-up. Ann Rheum Dis 2012;71:955-60. 3. Walsh M, Merkel PA, Mahr AD, Jayne D. Effects of duration of glucocorticoid therapy on relapse rate in antineutrophil cytoplasmic antibody-associated vasculitis: a meta-analysis. Arthritis Care Res (Hoboken) 2010;62:1166-73. 4. Smith RM, Jones RB, Guerry MJ, et al. Rituximab for remission maintenance in relapsing antineutrophil cytoplasmic antibody-associated vasculitis. Arthritis Rheum 2012;64:3760-9. DOI: 10.1056/NEJMc1311108
To the Editor: Specks et al. report that for the treatment of severe ANCA-associated vasculitis, a single course of rituximab is noninferior to 18 months of the conventional regimen of daily cyclophosphamide followed by azathioprine. However, there are several reasons for advocating caution in using rituximab in such patients, particularly those with newly diagnosed disease. First, 20 patients (29%) in the cyclophosphamide–azathioprine group had a relapse before 18 months. The considerably higher proportion of patients
n engl j med 369;19 nejm.org november 7, 2013
The New England Journal of Medicine Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission. Copyright © 2013 Massachusetts Medical Society. All rights reserved.
correspondence
who had a relapse than in previous trials1,2 could indicate suboptimal administration of the standard therapy.3 Second, the results were based on an intention-to-treat analysis; the stability of the noninferiority inference should also be reported with respect to a per-protocol analysis.3 Third, the number of patients with at least one serious adverse event or non–disease-related serious adverse event was higher in the rituximab group than in the cyclophosphamide–azathioprine group (Table S3 in the Supplementary Appendix of the article, available at NEJM.org). In addition, the cost of rituximab far exceeds that of standard treatment, thereby calling into question the ancillary benefits3,4 of the drug that would justify its use in place of the conventional regimen. Fotini B. Karassa, M.D. University of Ioannina School of Medicine Ioannina, Greece [email protected] No potential conflict of interest relevant to this letter was reported. 1. Jayne D, Rasmussen N, Andrassy K, et al. A randomized
trial of maintenance therapy for vasculitis associated with antineutrophil cytoplasmic autoantibodies. N Engl J Med 2003;349: 36-44. 2. de Groot K, Harper L, Jayne DR, et al. Pulse versus daily oral cyclophosphamide for induction of remission in antineutrophil cytoplasmic antibody-associated vasculitis: a randomized trial. Ann Intern Med 2009;150:670-80. 3. Mulla SM, Scott IA, Jackevicius CA, You JJ, Guyatt GH. How to use a noninferiority trial: users’ guides to the medical literature. JAMA 2012;308:2605-11. 4. Piaggio G, Elbourne DR, Pocock SJ, Evans SJ, Altman DG. Reporting of noninferiority and equivalence randomized trials: extension of the CONSORT 2010 statement. JAMA 2012;308:2594604. DOI: 10.1056/NEJMc1311108
The authors reply: In response to Kronbichler et al.: the relapse rate in the RAVE trial appears higher than that reported for the European Vasculitis Study Group (EUVAS) trials. 1,2 The comparability of trial results is affected by important design differences between these trials and by specific definitions underpinning the analyses. The sample size and power calculations of the RAVE trial were based on results achieved with conventional therapy in a similar patient population, the participants in the Wegener’s Granulomatosis Etanercept Trial (WGET).3,4 The results achieved with cyclophosphamide–azathioprine
in the RAVE trial were similar to those achieved in the WGET.4 In contrast to the WGET and the RAVE trial, the EUVAS trials enrolled newly diagnosed patients only. Fifty-one percent of participants in the RAVE trial had relapsing disease at baseline, resulting in a higher overall relapse rate than observed in the EUVAS trials. However, the percentage of newly diagnosed participants in the RAVE trial who remained in complete remission that was achieved with cyclophosphamide– azathioprine (Fig. S3A in the Supplementary Appendix of our article) was similar to that of patients in the CYCLOPS trial at the same time point.2 Karassa asks about the stability of the noninferiority inference in a per-protocol analysis. Only three patients had to be excluded to create the per-protocol analysis sample, and the results of the per-protocol analysis did not differ significantly from those of the corresponding intentionto-treat analyses. In the intention-to-treat analysis up to the closeout date of the trial, the number of serious adverse events was numerically, but not significantly, higher in the rituximab group than in the cyclophosphamide–azathioprine group (Table S3 in the Supplementary Appendix of our article). This analysis includes all events, many of which occurred long after the protocol-specified experimental treatment, making attribution to either rituximab or cyclophosphamide–azathioprine difficult. Therefore, we showed the clinically more meaningful safety comparison for all patients receiving the originally assigned treatment in the main body of the article (Table 2 of our article). Cost-effectiveness was not addressed by our trial. This issue requires careful consideration in the context of different reimbursement systems keeping the overall economic effect of a specific treatment, rather than isolated drug cost, in mind. Patients receiving conventional immunosuppressive therapy need regular blood monitoring to ensure their safety, resulting in considerable time away from productive activities, and the downstream costs of cyclophosphamide therapy, including fertility evaluations, surveillance cystoscopic examinations, or cancer treatments, can be substantial. The results of our subgroup analyses may provide guidance for practitioners and their
n engl j med 369;19 nejm.org november 7, 2013
1865
The New England Journal of Medicine Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission. Copyright © 2013 Massachusetts Medical Society. All rights reserved.
The
n e w e ng l a n d j o u r na l
patients when making individual treatment decisions, which certainly should include economic considerations. Ulrich Specks, M.D. Mayo Clinic Rochester, MN
David Ikle, Ph.D. Rho Chapel Hill, NC
John H. Stone, M.D., M.P.H. Massachusetts General Hospital Boston, MA Since publication of their article, the authors report no further potential conflict of interest.
of
m e dic i n e
1. Jayne D, Rasmussen N, Andrassy K, et al. A randomized
trial of maintenance therapy for vasculitis associated with antineutrophil cytoplasmic autoantibodies. N Engl J Med 2003;349: 36-44. 2. Harper L, Morgan MD, Walsh M, et al. Pulse versus daily oral cyclophosphamide for induction of remission in ANCAassociated vasculitis: long-term follow-up. Ann Rheum Dis 2012; 71:955-60. 3. Specks U, Merkel PA, Hoffman GS. Design of the Rituximab in ANCA-associated Vasculitis (RAVE) Trial. Open Arthritis J 2011; 4:1-18 (http://benthamscience.com/open/toarthj/articles/V004/ 1TOARTHJ.pdf). 4. Wegener’s Granulomatosis Etanercept Trial (WGET) Research Group. Etanercept plus standard therapy for Wegener’s granulomatosis. N Engl J Med 2005;352:351-61. DOI: 10.1056/NEJMc1311108
Bradyrhizobium enterica in Cord Colitis Syndrome To the Editor: A 48-year-old woman presented with nonbloody diarrhea 9 months after cordblood transplantation. Her condition was caused by colitis and met the criteria for cord colitis syndrome.1 Two courses of metronidazole were administered and were followed by clinical and en-
doscopically confirmed remission. Colonoscopy was performed during active colitis and at the end of antibiotic therapy. Colonic biopsies were performed on both occasions, and specimens were frozen and were analyzed by means of 16S rDNA–based microbial community profiling with
Table 1. Relative Counts of the 10 Most Abundant Bacteria in Mucosa Samples Obtained from a Patient with Cord Colitis Syndrome during Active Disease and during Remission.* Organism
Active Disease
Remission
Count in Ascending Colon Count in Sigmoid Colon (N = 3823) (N = 1458)
Count in Sigmoid Colon (N = 2418)
percent Bacteroides fragilis (OTU240)†
35.21
41.29
0.62
Clostridium species (OTU92)†
9.73
5.35
1.24
Ruminococcus species
8.32
4.05
0.00
Escherichia coli
8.03
9.88
18.53
Blautia species (OTU28)†
5.60
1.71
0.58
Veillonella dispar
4.29
1.17
0.04
Fusobacterium species
3.61
0.07
0
B. fragilis (OTU140)†
2.30
3.57
0
Blautia species (OTU529)†
2.17
0.69
0.17
Clostridium species (OTU430)†
2.04
1.71
0
Bradyrhizobium enterica
0
0
0
* Biopsy specimens were obtained during active cord colitis syndrome (336 days after hematopoietic stem-cell transplantation [HSCT]) and after antibiotic therapy (408 days after HSCT). Specimens were analyzed by means of micro bial community profiling with the use of the 16S rDNA gene primers 8F (AGAGTTTGATCCTGGCTCAG) and 534R (ATTACCGCGGCTGCTGG), which are known to capture B. enterica. Organisms are listed according to their abundance in the ascending colon during active disease. † Two different phylotypes of B. fragilis were identified (operational taxonomic units [OTUs] 240 and 140), and they did not cluster when a cutoff of 97% sequence similarity was used for the annotation of 16S rDNA reads. They may represent different strains of B. fragilis. This finding also applies to clostridium species and blautia species.
1866
n engl j med 369;19 nejm.org november 7, 2013
The New England Journal of Medicine Downloaded from nejm.org at UNIVERSITY OF PITTSBURGH - MAIN on August 10, 2015. For personal use only. No other uses without permission. Copyright © 2013 Massachusetts Medical Society. All rights reserved.
