MOLECULAR AND CELLULAR BIOLOGY, JUlY 1992, P. 3149-3154
Vol. 12, No. 7
0270-7306/92/073149-06$02.00/0
Copyright X 1992, American Society for Microbiology
Induction of the POU Domain Transcription Factor Oct-2 during T-Cell Activation by Cognate Antigen SANG-MO KANG,"2 WAYNE TSANG,3 SHARON DOLL,3 PEGGY SCHERLE,3 HON-SUM KO,3 ANNIE-CHEN TRAN,1 MICHAEL J. LENARDO,1 AND LOUIS M. STAUDT3* Laboratory of Immunology, National Institute of Allergy and Infectious Diseases,' Howard Hughes Medical Institute,2 and Metabolism Branch, National Cancer Institute,3 Bethesda, Maryland 20892 Received 23 December 1991/Accepted 23 April 1992
Oct-2 is a transcription factor that binds specifically to octamer DNA motifs in the promoters of immunoglobulin and interleukin-2 genes. All tumor cell lines from the B-cell lineage and a few from the T-cell lineage express Oct-2. To address the role of Oct-2 in the T-cell lineage, we studied the expression of Oct-2 mRNA and protein in nontransformed human and mouse T cells. Oct-2 was found in CD4+ and CD8+ T cells prepared from human peripheral blood and in mouse lymph node T cells. In a T-cell clone specific for pigeon cytochrome c in the context of I-Ek, Oct-2 was induced by antigen stimulation, with the increase in Oct-2 protein seen first at 3 h after activation and continuing for at least 24 h. Oct-2 mRNA induction during antigen-driven T-cell activation was blocked by cyclosporin A, as well as by protein synthesis inhibitors. These results suggest that Oct-2 participates in transcriptional regulation during T-cell activation. The relatively delayed kinetics of Oct-2 induction suggests that Oct-2 mediates the changes in gene expression which occur many hours or days following antigen stimulation of T lymphocytes. The octamer DNA motif (ATITIGCAT or close variants) is emerging as an important transcriptional regulatory motif in T-cell activation. Within the interleukin-2 (IL-2) promoter, an octamer motif is present in a 30-bp region, termed NF-IL-2A, that is critical for promoter activity during activation of the Jurkat T-cell line (6, 13, 23). Activation of Jurkat cells generates a DNase-hypersensitive site in the NF-IL-2A region, suggesting that transcription factors bind to this sequence in an inducible fashion (24). The NF-IL-2A region, when multimerized, functions as an inducible transcriptional enhancer that responds to signals delivered by cross-linking the T-cell antigen receptor, and this enhancer activity depends on the octamer motif (2, 4, 15, 31). The immunosuppressive agents cyclosporin A (CsA) and FK506 inhibit the transcription of a host of genes which are normally induced during T-cell activation, and both agents block the activity of the NF-IL-2A sequence (2, 4, 15, 31). Transcription factors which bind specifically to the octamer motif belong to the POU domain multigene family (12). One member of this family, Oct-1, is expressed in most cell types and is the only octamer-binding protein which is detectable in Jurkat T cells (2, 13, 14, 23, 25, 31). However, Oct-1 levels do not change during activation of Jurkat cells (2, 23, 31). It has been shown that an inducible protein interacts with Oct-1 and accounts for the inducibility of the NF-IL-2A sequence in this T-cell tumor line (13, 30, 31). Another octamer-specific POU domain protein, Oct-2, is expressed predominantly, but not exclusively, in the B-cell lineage, where it has been implicated in the transcriptional control of immunoglobulin (Ig) genes (26). However, Oct-2 is also expressed in some, but not all, T-cell tumor lines (5, 22, 25). The ELA T-lymphoma cell line expresses high levels of Oct-2, whereas Jurkat cells do not express detectable Oct-2 (25). Interestingly, transfection of Jurkat cells with an Oct-2 expression construct cooperates with phorbol myristate acetate (PMA) to induce IL-2 gene expression and substitutes *
for the phytohemagglutinin signal (13). These studies raise the interesting possibility that Oct-2 has a role in gene expression during T-cell activation. We therefore investigated the expression of Oct-2 in nontransformed T cells and demonstrate here that Oct-2 is induced in T cells in response to a cognate antigen.
MATERIALS AND METHODS Cells. A.E7 is a nontransformed TH1 T-cell clone derived from a B10.A mouse immunized with pigeon cytochrome c (11). A.E7 cells are responsive to pigeon cytochrome c, cyanogen bromide fragment 81-104, in the context of I-Ek. A.E7 produces IL-2, gamma interferon, tumor necrosis factor alpha, lymphotoxin, granulocyte macrophage colonystimulating factor, and IL-3 upon antigenic stimulation and was maintained essentially as previously described (11). Briefly, cells were stimulated for 2 days in 24-well tissue culture plates (Costar, Cambridge, Mass.) at a concentration of 106 A.E7 cells per well and 5 x 106 B10.A irradiated (3,000 rads) spleen cells per well in 2 ml of A.E7 medium (EHAA medium [Biofluids, Rockville, Md.] supplemented with 10% fetal calf serum [Biofluids], 2 mM glutamine, 100 mg of streptomycin per ml, 100 U of penicillin per ml, and 50 mM 2-mercaptoethanol). The cells were then expanded into 200-cm2 flasks (Nunc, Roskilde, Denmark) in A.E7 medium supplemented with 1% conditioned supernatant from the MLA-144 cell line, which provides approximately 15 U of IL-2 per ml. The cells were then allowed to rest for 14 to 21 days before use. DCEK is a transfected fibroblast line which expresses I-Ek and can present antigen to A.E7 cells (kindly provided by Ron Germain, National Institutes of Health, Bethesda, Md.). DCEK cells were grown in Dulbecco modified Eagle medium (Biofluids) supplemented with 10% fetal calf serum (Biofluids), 2 mM glutamine, 100 mg of streptomycin per ml, 100 U of penicillin per ml, and 50 mM 2-mercaptoethanol. Human CD4+ T cells and CD8+ T cells (a gift of Ivan Horak, Metabolism Branch, National Cancer Institute, Be-
Corresponding author. 3149
3150
MOL. CELL. BIOL.
KANG ET AL.
thesda, Md.) were prepared from peripheral blood as previously described (29). Mouse T cells (a gift of Toshio Tanaka, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, Bethesda, Md.) were prepared from mesenteric lymph nodes as previously described (28). Both cell populations consisted of >99% T cells as determined by staining with anti-CD4 or anti-CD8 antibodies (human T cells) or a mixture of anti-Thyl.2, anti-CD3, anti-CD4, and anti-CD8 antibodies (mouse T cells) followed by flow cytometry on a FACScan (Becton Dickinson & Co., Mountain View, Calif.). Cell stimulation. To selectively assay changes in Oct-2 expression in A.E7 T cells from cultures containing DCEK antigen-producing cells (APCs), a method of removing APCs was developed (13a). Briefly, DCEK cells were loaded with magnetic beads (Dynal, Great Neck, N.Y.), isolated by using a magnet (Advanced Magnetics Inc., Cambridge, Mass.), and irradiated with 3,000 rads. A.E7 cells (50 x 106) were then incubated with 25 x 106 bead-loaded DCEK cells and 10 ,uM pigeon cytochrome c (CNBr fragment 81-104) in 20 ml of A.E7 medium in an upright 80-cm2 flask (Nunc). The cells were harvested, pipetted vigorously to obtain a singlecell suspension, and fractionated by using a magnet which yielded a cell population that consisted of >99% A.E7 cells. Treatment with ionomycin (2 F.M) and/or PMA (20 ng/ml) was done in the same manner as the antigen treatments, except that no DCEK cells were used. CsA (a gift of Sandoz Pharmaceuticals) was used at 200 ng/ml. Treatment with anisomycin (10 ,uM) was begun 30 min prior to antigen stimulation. EMSA. Electrophoretic mobility shift assays (EMSAs) were performed as previously described (27), by using 2 p,g of nuclear extract (16) or whole-cell extract (19) prepared as previously described. The radiolabelled oligonucleotide probes used were derived from an IgK promoter, either wild type or mutated in all base pairs of the octamer motif (19), or the mouse IL-2 promoter NF-IL-2A region with the following sequence:
5'TCGAGAAAATATGTGTAATATGTAAAACATCGT3' 3'CTTTTATACACATTATACATTTTGTAGCAAGCT5' Rabbit anti-Oct-2 serum was prepared by immunizing rabbits with the peptide EAEKQGLDSPSEHTDTERN (derived from the amino terminus of human Oct-2, outside of the POU domain) coupled to thyroglobulin. One microliter of undiluted antiserum was premixed with extract and incubated at 4°C for 30 min. The remaining components of the binding reaction were then added, and the mixture was incubated at room temperature for 15 min prior to loading on a nondenaturing polyacrylamide gel as previously described (27). RNA analysis. Total RNA was prepared by using RNAzol (Cinna/Biotexc, Friendswood, Tex.) in accordance with the manufacturer's protocols and analyzed on Northern (RNA) blots (20) or by RNase protection assay (1) as previously described. Northern blots were hybridized with mouse actin cDNA probes radiolabelled by the random-hexanucleotide priming method (1). The plasmid template used to prepare the radiolabelled RNA probe for the Oct-2 RNase protection assay was constructed by blunting the 360-bp TthIII1HindIII fragment of mouse Oct-2 cDNA (9) and ligating it into the SmaI site of pGEM3Z (Promega, Madison, Wis.). The template was linearized with HindIII and transcribed by using T7 RNA polymerase (Promega) in accordance with the manufacturer's instructions.
Quantitations. Radioactivity in bands on EMSAs, Northern blots, and RNase protection assays was directly measured by using a Phosphorimager (Molecular Dynamics,
Sunnyvale, Calif.). RESULTS Expression of Oct-2 protein in highly purified human and mouse T-cell preparations was investigated by using an EMSA with a radiolabelled oligonucleotide probe containing an octamer DNA motif. Extracts from CD4+ T cells (Fig. 1A) and CD8+ T cells (Fig. 1B) purified from human peripheral blood and mouse lymph node T cells (Fig. 1C) contained DNA-binding activities indistinguishable in migration from those of the Oct-1 and Oct-2 proteins present in an extract of the B-cell line WEHI 231. Neither Oct-1 nor Oct-2 bands were seen with T-cell extracts when a probe in which the octamer motif was mutated was used (Fig. 1B, lane 4, and 1C, lane 2, and data not shown). The Oct-2 bands from the mouse and human T-cell extracts were inhibited by addition of anti-Oct-2 serum to the binding reactions, and a new band with slower mobility was generated which represents the binding of Oct-2 to antibody (Fig. 1A, lanes 4 and 5, 1B, lane 8, and 1C, lane 4). The anti-Oct-2 serum used was specific for a peptide derived from a region of Oct-2 that is not conserved among other POU domain transcription factors. Thus, by immunologic and biochemical criteria, nontransformed human and mouse T cells express Oct-2 protein. To determine whether Oct-2 could be induced in normal T cells in response to a cognate antigen, we chose to study a nontransformed murine T-cell clone, A.E7, which responds to a pigeon cytochrome c peptide in the context of I-E (11). We prepared nuclear extracts from A.E7 cells at various times after antigen stimulation and assayed them for octamer-binding proteins by EMSAs using a radiolabelled oligonucleotide containing the NF-IL-2A sequence from the mouse IL-2 gene. Binding activities which comigrated with Oct-1 and Oct-2 were observed when extracts from resting and antigen-stimulated A.E7 cells were used (Fig. 2). Furthermore, both resting and activated A.E7 cells expressed Oct-2 protein, as judged by reactivity with an antiserum specific for Oct-2 (Fig. 3, lanes 1, 2, 9, and 10). Following antigen stimulation, Oct-2-binding activity was slightly increased at 3 h and markedly increased at 9 and 24 h after stimulation (Fig. 2, lanes 1, 5, and 6). In separate experiments, Oct-2 was not induced detectably at 1.5 h poststimulation but did increase progressively in abundance from 3 to 9 h (data not shown). Maximal levels of Oct-2 were observed at 9 h following activation and were sixfold greater than resting levels. The abundance of Oct-2 in activated A.E7 cells approached that of the BJAB B-cell lymphoma cell line, which expresses the highest levels of Oct-2 found in any cell line analyzed to date (Fig. 2, compare lanes 5 and 7). In contrast to Oct-2 levels, Oct-1 levels increased less than twofold following antigen stimulation. To assess whether continued antigen stimulation was necessary for this increase in Oct-2, we separated the T cells from the antigen and APCs after 3 h of stimulation, placed them back in culture, and prepared extracts at various times thereafter. Oct-2 levels continued to increase over time in T cells that had been removed from the antigen stimulus at 3 h (Fig. 2, lanes 2 to 4). Thus, as is the case with many other events following T-cell activation, all of the signals necessary for Oct-2 induction were delivered within the first few hours of activation (31). T-cell activation via stimulation through a T-cell receptor
Oct-2 INDUCTION IN ANTIGEN-SPECIFIC T-CELL ACTIVATION
VOL. 12, 1992
A
r N
Cell Type
- H H
~L 3: Antibody Oct-2
+
Ab
N
L L a NI
N
N
4-
4-
s_
t
N
-
as
Cel
IIType
ESI5
Probe- H
, O O t0
Antibody O H,F
E E
cL
tEL
-
S
-~F
Oct-2 + Ab
-II -
Probe
xj
S Oct-1
F
r
N
Oct-2
Oct-i Oct-2
IF
C
LU 0
aL
-
-
rX
B Cell Type
: uD u C-
-l X
L a-
C]
Hq 0
3151
Oct-1 Ot-2
-
i
Oct-1Oct-2- O _
Oct-2 + Ab Oct-1
_so
-
1 2 3 4
56 7 8
0*
_4 1
2 3
1 2 3 4 5 FIG. 1. Expression of Oct-2 protein in human and mouse T cells. (A) EMSA of whole-cell extracts prepared from human CD4+ peripheral blood T cells (lanes 3 to 5) or WEHI 231 B-lymphoma cells (lanes 1 and 2) using the radiolabelled IgK promoter oligonucleotide probe. Extracts were incubated with either preimmune rabbit serum (lanes 1 and 3) or antiserum from a rabbit immunized with a synthetic peptide based on the human Oct-2 sequence (lanes 2, 4, and 5). Lane 5 is a longer exposure of lane 4. Ab, antibody. (B) EMSA of whole-cell extracts of human CD8+ T cells (lanes 2, 4, 7, and 8) or WEHI 231 B-lymphoma cells (lanes 1, 3, 5, and 6) using either a radiolabelled wild-type (WT) IgK promoter oligonucleotide probe (lanes 1, 2, and 5 to 8) or a mutant (MUT) IgK promoter oligonucleotide probe (lanes 3 and 4). Extracts were mixed with preimmune serum (lanes 5 and 7) or anti-Oct-2 serum (lanes 6 and 8). In lane 8, the band representing Oct-2 complexed with antibody is faint but comigrated with the corresponding band seen when WEHI 231 extract was used (lane 6). (C) EMSA of whole-cell extracts of mouse mesenteric lymph node T cells (lanes 1 and 2) or WEHI 231 B-lymphoma cells (lane 3) using either a radiolabelled wild-type IgK promoter oligonucleotide probe (lanes 1, 3, and 4) or a mutant IgK promoter oligonucleotide probe (lane 2). The lane 4 reaction contained anti-Oct-2 serum.
has been shown to be at least partly mediated by calcium mobilization and protein kinase C activation, a process that can be mimicked by treatment with ionomycin and PMA (3, 17, 21). We therefore studied the signal requirements for Oct-2 activation in A.E7 cells. Oct-2 was not induced by PMA alone and only slightly induced by ionomycin alone but was induced eightfold by ionomycin and PMA together (Fig. 3). We next investigated whether induction of Oct-2-binding activity in A.E7 was due to a posttranslational modification of pre-existing Oct-2 protein or to accumulation of Oct-2 mRNA. An RNase protection assay for Oct-2 mRNA showed a small amount of Oct-2 mRNA in resting A.E7 cells, which increased 12- and 28-fold after 3 and 6 h of antigen stimulation, respectively (Fig. 4, lanes 1 to 3). This increase in Oct-2 mRNA was almost completely blocked by addition of CsA (Fig. 4, lanes 4 and 5) and partially blocked by addition of the protein synthesis inhibitor anisomycin (Fig. 4, lanes 6 and 7). Induction of Oct-2-binding activity in an EMSA was also blocked by treatment with CsA or anisomycin (data not shown).
DISCUSSION The present report demonstrates that Oct-2 is expressed in normal CD4+ and CD8+ T lymphocytes and that Oct-2 levels can be induced by activation of T cells with their cognate antigen. Previous studies of Oct-2 gene expression in the hematopoietic system focusing on transformed cell lines
have shown Oct-2 in cell lines derived from B- and T-lymphoid, myeloid, and erythroid lineages (5, 27). Outside of the hematopoietic system, Oct-2 mRNA can be detected in the fetal spinal cord, in adult brain, and at low levels in a few other tissues (9, 10). Quantitatively, however, Oct-2 levels vary greatly but are generally much higher in B-cell lines than in other cell lines (5, 21, 25). An important observation in the present study, therefore, is that the levels of Oct-2 protein in normal T cells can be as high as those found in B lymphocytes. The levels of Oct-2 protein induced in the A.E7 normal T-cell clone by stimulation with antigen or PMA plus ionomycin approached the highest levels seen in any B-cell tumor line. Some transcriptional responses have been shown to behave nonlinearly in that only after the level of a transcription factor exceeds a threshold is any transcription stimulation observed (7). Thus, the low levels of Oct-2 expression found in many cell types could conceivably fall below a functional threshold whereas the higher levels found in B cells and certain T cells could be functionally significant. An interesting unresolved issue is whether T cells which express high levels of Oct-2 (e.g., A.E7) are functionally or developmentally distinct from T cells which do not express Oct-2 (as represented by the Jurkat T-lymphoma cell line). What might the functional role of Oct-2 expression in T cells be? Previously, it has been shown that the EL4 T-cell line, which expresses high levels of Oct-2, requires only PMA treatment to induce IL-2 promoter activity (8). Simi-
3152
MOL. CELL. BIOL.
KANG ET AL.
~~~~~co
Cell Type
1_
-
r
r
_.
Vol. 12, No. 7
0270-7306/92/073149-06$02.00/0
Copyright X 1992, American Society for Microbiology
Induction of the POU Domain Transcription Factor Oct-2 during T-Cell Activation by Cognate Antigen SANG-MO KANG,"2 WAYNE TSANG,3 SHARON DOLL,3 PEGGY SCHERLE,3 HON-SUM KO,3 ANNIE-CHEN TRAN,1 MICHAEL J. LENARDO,1 AND LOUIS M. STAUDT3* Laboratory of Immunology, National Institute of Allergy and Infectious Diseases,' Howard Hughes Medical Institute,2 and Metabolism Branch, National Cancer Institute,3 Bethesda, Maryland 20892 Received 23 December 1991/Accepted 23 April 1992
Oct-2 is a transcription factor that binds specifically to octamer DNA motifs in the promoters of immunoglobulin and interleukin-2 genes. All tumor cell lines from the B-cell lineage and a few from the T-cell lineage express Oct-2. To address the role of Oct-2 in the T-cell lineage, we studied the expression of Oct-2 mRNA and protein in nontransformed human and mouse T cells. Oct-2 was found in CD4+ and CD8+ T cells prepared from human peripheral blood and in mouse lymph node T cells. In a T-cell clone specific for pigeon cytochrome c in the context of I-Ek, Oct-2 was induced by antigen stimulation, with the increase in Oct-2 protein seen first at 3 h after activation and continuing for at least 24 h. Oct-2 mRNA induction during antigen-driven T-cell activation was blocked by cyclosporin A, as well as by protein synthesis inhibitors. These results suggest that Oct-2 participates in transcriptional regulation during T-cell activation. The relatively delayed kinetics of Oct-2 induction suggests that Oct-2 mediates the changes in gene expression which occur many hours or days following antigen stimulation of T lymphocytes. The octamer DNA motif (ATITIGCAT or close variants) is emerging as an important transcriptional regulatory motif in T-cell activation. Within the interleukin-2 (IL-2) promoter, an octamer motif is present in a 30-bp region, termed NF-IL-2A, that is critical for promoter activity during activation of the Jurkat T-cell line (6, 13, 23). Activation of Jurkat cells generates a DNase-hypersensitive site in the NF-IL-2A region, suggesting that transcription factors bind to this sequence in an inducible fashion (24). The NF-IL-2A region, when multimerized, functions as an inducible transcriptional enhancer that responds to signals delivered by cross-linking the T-cell antigen receptor, and this enhancer activity depends on the octamer motif (2, 4, 15, 31). The immunosuppressive agents cyclosporin A (CsA) and FK506 inhibit the transcription of a host of genes which are normally induced during T-cell activation, and both agents block the activity of the NF-IL-2A sequence (2, 4, 15, 31). Transcription factors which bind specifically to the octamer motif belong to the POU domain multigene family (12). One member of this family, Oct-1, is expressed in most cell types and is the only octamer-binding protein which is detectable in Jurkat T cells (2, 13, 14, 23, 25, 31). However, Oct-1 levels do not change during activation of Jurkat cells (2, 23, 31). It has been shown that an inducible protein interacts with Oct-1 and accounts for the inducibility of the NF-IL-2A sequence in this T-cell tumor line (13, 30, 31). Another octamer-specific POU domain protein, Oct-2, is expressed predominantly, but not exclusively, in the B-cell lineage, where it has been implicated in the transcriptional control of immunoglobulin (Ig) genes (26). However, Oct-2 is also expressed in some, but not all, T-cell tumor lines (5, 22, 25). The ELA T-lymphoma cell line expresses high levels of Oct-2, whereas Jurkat cells do not express detectable Oct-2 (25). Interestingly, transfection of Jurkat cells with an Oct-2 expression construct cooperates with phorbol myristate acetate (PMA) to induce IL-2 gene expression and substitutes *
for the phytohemagglutinin signal (13). These studies raise the interesting possibility that Oct-2 has a role in gene expression during T-cell activation. We therefore investigated the expression of Oct-2 in nontransformed T cells and demonstrate here that Oct-2 is induced in T cells in response to a cognate antigen.
MATERIALS AND METHODS Cells. A.E7 is a nontransformed TH1 T-cell clone derived from a B10.A mouse immunized with pigeon cytochrome c (11). A.E7 cells are responsive to pigeon cytochrome c, cyanogen bromide fragment 81-104, in the context of I-Ek. A.E7 produces IL-2, gamma interferon, tumor necrosis factor alpha, lymphotoxin, granulocyte macrophage colonystimulating factor, and IL-3 upon antigenic stimulation and was maintained essentially as previously described (11). Briefly, cells were stimulated for 2 days in 24-well tissue culture plates (Costar, Cambridge, Mass.) at a concentration of 106 A.E7 cells per well and 5 x 106 B10.A irradiated (3,000 rads) spleen cells per well in 2 ml of A.E7 medium (EHAA medium [Biofluids, Rockville, Md.] supplemented with 10% fetal calf serum [Biofluids], 2 mM glutamine, 100 mg of streptomycin per ml, 100 U of penicillin per ml, and 50 mM 2-mercaptoethanol). The cells were then expanded into 200-cm2 flasks (Nunc, Roskilde, Denmark) in A.E7 medium supplemented with 1% conditioned supernatant from the MLA-144 cell line, which provides approximately 15 U of IL-2 per ml. The cells were then allowed to rest for 14 to 21 days before use. DCEK is a transfected fibroblast line which expresses I-Ek and can present antigen to A.E7 cells (kindly provided by Ron Germain, National Institutes of Health, Bethesda, Md.). DCEK cells were grown in Dulbecco modified Eagle medium (Biofluids) supplemented with 10% fetal calf serum (Biofluids), 2 mM glutamine, 100 mg of streptomycin per ml, 100 U of penicillin per ml, and 50 mM 2-mercaptoethanol. Human CD4+ T cells and CD8+ T cells (a gift of Ivan Horak, Metabolism Branch, National Cancer Institute, Be-
Corresponding author. 3149
3150
MOL. CELL. BIOL.
KANG ET AL.
thesda, Md.) were prepared from peripheral blood as previously described (29). Mouse T cells (a gift of Toshio Tanaka, Laboratory of Immunology, National Institute of Allergy and Infectious Diseases, Bethesda, Md.) were prepared from mesenteric lymph nodes as previously described (28). Both cell populations consisted of >99% T cells as determined by staining with anti-CD4 or anti-CD8 antibodies (human T cells) or a mixture of anti-Thyl.2, anti-CD3, anti-CD4, and anti-CD8 antibodies (mouse T cells) followed by flow cytometry on a FACScan (Becton Dickinson & Co., Mountain View, Calif.). Cell stimulation. To selectively assay changes in Oct-2 expression in A.E7 T cells from cultures containing DCEK antigen-producing cells (APCs), a method of removing APCs was developed (13a). Briefly, DCEK cells were loaded with magnetic beads (Dynal, Great Neck, N.Y.), isolated by using a magnet (Advanced Magnetics Inc., Cambridge, Mass.), and irradiated with 3,000 rads. A.E7 cells (50 x 106) were then incubated with 25 x 106 bead-loaded DCEK cells and 10 ,uM pigeon cytochrome c (CNBr fragment 81-104) in 20 ml of A.E7 medium in an upright 80-cm2 flask (Nunc). The cells were harvested, pipetted vigorously to obtain a singlecell suspension, and fractionated by using a magnet which yielded a cell population that consisted of >99% A.E7 cells. Treatment with ionomycin (2 F.M) and/or PMA (20 ng/ml) was done in the same manner as the antigen treatments, except that no DCEK cells were used. CsA (a gift of Sandoz Pharmaceuticals) was used at 200 ng/ml. Treatment with anisomycin (10 ,uM) was begun 30 min prior to antigen stimulation. EMSA. Electrophoretic mobility shift assays (EMSAs) were performed as previously described (27), by using 2 p,g of nuclear extract (16) or whole-cell extract (19) prepared as previously described. The radiolabelled oligonucleotide probes used were derived from an IgK promoter, either wild type or mutated in all base pairs of the octamer motif (19), or the mouse IL-2 promoter NF-IL-2A region with the following sequence:
5'TCGAGAAAATATGTGTAATATGTAAAACATCGT3' 3'CTTTTATACACATTATACATTTTGTAGCAAGCT5' Rabbit anti-Oct-2 serum was prepared by immunizing rabbits with the peptide EAEKQGLDSPSEHTDTERN (derived from the amino terminus of human Oct-2, outside of the POU domain) coupled to thyroglobulin. One microliter of undiluted antiserum was premixed with extract and incubated at 4°C for 30 min. The remaining components of the binding reaction were then added, and the mixture was incubated at room temperature for 15 min prior to loading on a nondenaturing polyacrylamide gel as previously described (27). RNA analysis. Total RNA was prepared by using RNAzol (Cinna/Biotexc, Friendswood, Tex.) in accordance with the manufacturer's protocols and analyzed on Northern (RNA) blots (20) or by RNase protection assay (1) as previously described. Northern blots were hybridized with mouse actin cDNA probes radiolabelled by the random-hexanucleotide priming method (1). The plasmid template used to prepare the radiolabelled RNA probe for the Oct-2 RNase protection assay was constructed by blunting the 360-bp TthIII1HindIII fragment of mouse Oct-2 cDNA (9) and ligating it into the SmaI site of pGEM3Z (Promega, Madison, Wis.). The template was linearized with HindIII and transcribed by using T7 RNA polymerase (Promega) in accordance with the manufacturer's instructions.
Quantitations. Radioactivity in bands on EMSAs, Northern blots, and RNase protection assays was directly measured by using a Phosphorimager (Molecular Dynamics,
Sunnyvale, Calif.). RESULTS Expression of Oct-2 protein in highly purified human and mouse T-cell preparations was investigated by using an EMSA with a radiolabelled oligonucleotide probe containing an octamer DNA motif. Extracts from CD4+ T cells (Fig. 1A) and CD8+ T cells (Fig. 1B) purified from human peripheral blood and mouse lymph node T cells (Fig. 1C) contained DNA-binding activities indistinguishable in migration from those of the Oct-1 and Oct-2 proteins present in an extract of the B-cell line WEHI 231. Neither Oct-1 nor Oct-2 bands were seen with T-cell extracts when a probe in which the octamer motif was mutated was used (Fig. 1B, lane 4, and 1C, lane 2, and data not shown). The Oct-2 bands from the mouse and human T-cell extracts were inhibited by addition of anti-Oct-2 serum to the binding reactions, and a new band with slower mobility was generated which represents the binding of Oct-2 to antibody (Fig. 1A, lanes 4 and 5, 1B, lane 8, and 1C, lane 4). The anti-Oct-2 serum used was specific for a peptide derived from a region of Oct-2 that is not conserved among other POU domain transcription factors. Thus, by immunologic and biochemical criteria, nontransformed human and mouse T cells express Oct-2 protein. To determine whether Oct-2 could be induced in normal T cells in response to a cognate antigen, we chose to study a nontransformed murine T-cell clone, A.E7, which responds to a pigeon cytochrome c peptide in the context of I-E (11). We prepared nuclear extracts from A.E7 cells at various times after antigen stimulation and assayed them for octamer-binding proteins by EMSAs using a radiolabelled oligonucleotide containing the NF-IL-2A sequence from the mouse IL-2 gene. Binding activities which comigrated with Oct-1 and Oct-2 were observed when extracts from resting and antigen-stimulated A.E7 cells were used (Fig. 2). Furthermore, both resting and activated A.E7 cells expressed Oct-2 protein, as judged by reactivity with an antiserum specific for Oct-2 (Fig. 3, lanes 1, 2, 9, and 10). Following antigen stimulation, Oct-2-binding activity was slightly increased at 3 h and markedly increased at 9 and 24 h after stimulation (Fig. 2, lanes 1, 5, and 6). In separate experiments, Oct-2 was not induced detectably at 1.5 h poststimulation but did increase progressively in abundance from 3 to 9 h (data not shown). Maximal levels of Oct-2 were observed at 9 h following activation and were sixfold greater than resting levels. The abundance of Oct-2 in activated A.E7 cells approached that of the BJAB B-cell lymphoma cell line, which expresses the highest levels of Oct-2 found in any cell line analyzed to date (Fig. 2, compare lanes 5 and 7). In contrast to Oct-2 levels, Oct-1 levels increased less than twofold following antigen stimulation. To assess whether continued antigen stimulation was necessary for this increase in Oct-2, we separated the T cells from the antigen and APCs after 3 h of stimulation, placed them back in culture, and prepared extracts at various times thereafter. Oct-2 levels continued to increase over time in T cells that had been removed from the antigen stimulus at 3 h (Fig. 2, lanes 2 to 4). Thus, as is the case with many other events following T-cell activation, all of the signals necessary for Oct-2 induction were delivered within the first few hours of activation (31). T-cell activation via stimulation through a T-cell receptor
Oct-2 INDUCTION IN ANTIGEN-SPECIFIC T-CELL ACTIVATION
VOL. 12, 1992
A
r N
Cell Type
- H H
~L 3: Antibody Oct-2
+
Ab
N
L L a NI
N
N
4-
4-
s_
t
N
-
as
Cel
IIType
ESI5
Probe- H
, O O t0
Antibody O H,F
E E
cL
tEL
-
S
-~F
Oct-2 + Ab
-II -
Probe
xj
S Oct-1
F
r
N
Oct-2
Oct-i Oct-2
IF
C
LU 0
aL
-
-
rX
B Cell Type
: uD u C-
-l X
L a-
C]
Hq 0
3151
Oct-1 Ot-2
-
i
Oct-1Oct-2- O _
Oct-2 + Ab Oct-1
_so
-
1 2 3 4
56 7 8
0*
_4 1
2 3
1 2 3 4 5 FIG. 1. Expression of Oct-2 protein in human and mouse T cells. (A) EMSA of whole-cell extracts prepared from human CD4+ peripheral blood T cells (lanes 3 to 5) or WEHI 231 B-lymphoma cells (lanes 1 and 2) using the radiolabelled IgK promoter oligonucleotide probe. Extracts were incubated with either preimmune rabbit serum (lanes 1 and 3) or antiserum from a rabbit immunized with a synthetic peptide based on the human Oct-2 sequence (lanes 2, 4, and 5). Lane 5 is a longer exposure of lane 4. Ab, antibody. (B) EMSA of whole-cell extracts of human CD8+ T cells (lanes 2, 4, 7, and 8) or WEHI 231 B-lymphoma cells (lanes 1, 3, 5, and 6) using either a radiolabelled wild-type (WT) IgK promoter oligonucleotide probe (lanes 1, 2, and 5 to 8) or a mutant (MUT) IgK promoter oligonucleotide probe (lanes 3 and 4). Extracts were mixed with preimmune serum (lanes 5 and 7) or anti-Oct-2 serum (lanes 6 and 8). In lane 8, the band representing Oct-2 complexed with antibody is faint but comigrated with the corresponding band seen when WEHI 231 extract was used (lane 6). (C) EMSA of whole-cell extracts of mouse mesenteric lymph node T cells (lanes 1 and 2) or WEHI 231 B-lymphoma cells (lane 3) using either a radiolabelled wild-type IgK promoter oligonucleotide probe (lanes 1, 3, and 4) or a mutant IgK promoter oligonucleotide probe (lane 2). The lane 4 reaction contained anti-Oct-2 serum.
has been shown to be at least partly mediated by calcium mobilization and protein kinase C activation, a process that can be mimicked by treatment with ionomycin and PMA (3, 17, 21). We therefore studied the signal requirements for Oct-2 activation in A.E7 cells. Oct-2 was not induced by PMA alone and only slightly induced by ionomycin alone but was induced eightfold by ionomycin and PMA together (Fig. 3). We next investigated whether induction of Oct-2-binding activity in A.E7 was due to a posttranslational modification of pre-existing Oct-2 protein or to accumulation of Oct-2 mRNA. An RNase protection assay for Oct-2 mRNA showed a small amount of Oct-2 mRNA in resting A.E7 cells, which increased 12- and 28-fold after 3 and 6 h of antigen stimulation, respectively (Fig. 4, lanes 1 to 3). This increase in Oct-2 mRNA was almost completely blocked by addition of CsA (Fig. 4, lanes 4 and 5) and partially blocked by addition of the protein synthesis inhibitor anisomycin (Fig. 4, lanes 6 and 7). Induction of Oct-2-binding activity in an EMSA was also blocked by treatment with CsA or anisomycin (data not shown).
DISCUSSION The present report demonstrates that Oct-2 is expressed in normal CD4+ and CD8+ T lymphocytes and that Oct-2 levels can be induced by activation of T cells with their cognate antigen. Previous studies of Oct-2 gene expression in the hematopoietic system focusing on transformed cell lines
have shown Oct-2 in cell lines derived from B- and T-lymphoid, myeloid, and erythroid lineages (5, 27). Outside of the hematopoietic system, Oct-2 mRNA can be detected in the fetal spinal cord, in adult brain, and at low levels in a few other tissues (9, 10). Quantitatively, however, Oct-2 levels vary greatly but are generally much higher in B-cell lines than in other cell lines (5, 21, 25). An important observation in the present study, therefore, is that the levels of Oct-2 protein in normal T cells can be as high as those found in B lymphocytes. The levels of Oct-2 protein induced in the A.E7 normal T-cell clone by stimulation with antigen or PMA plus ionomycin approached the highest levels seen in any B-cell tumor line. Some transcriptional responses have been shown to behave nonlinearly in that only after the level of a transcription factor exceeds a threshold is any transcription stimulation observed (7). Thus, the low levels of Oct-2 expression found in many cell types could conceivably fall below a functional threshold whereas the higher levels found in B cells and certain T cells could be functionally significant. An interesting unresolved issue is whether T cells which express high levels of Oct-2 (e.g., A.E7) are functionally or developmentally distinct from T cells which do not express Oct-2 (as represented by the Jurkat T-lymphoma cell line). What might the functional role of Oct-2 expression in T cells be? Previously, it has been shown that the EL4 T-cell line, which expresses high levels of Oct-2, requires only PMA treatment to induce IL-2 promoter activity (8). Simi-
3152
MOL. CELL. BIOL.
KANG ET AL.
~~~~~co
Cell Type
1_
-
r
r
_.
