Reprod Dom Anim 49, 588–598 (2014); doi: 10.1111/rda.12327 ISSN 0936–6768

Induction of Ram Bone Marrow Mesenchymal Stem Cells into Germ Cell Lineage using Transforming Growth Factor-b Superfamily Growth Factors M Ghasemzadeh-Hasankolaei1, MA Sedighi-Gilani2 and MB Eslaminejad3 1 Fatemeh-Zahra Infertility and Reproductive Health Research Center, Babol University of Medical Sciences, Babol, Iran; 2Department of Andrology at Reproductive Biomedicine Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran; 3Department of Stem Cells and Developmental Biology at Cell Science Research Center, Royan Institute for Stem Cell Biology and Technology, ACECR, Tehran, Iran

Contents Several studies have proposed that in vitro generation of germ cells (GCs) from stem cells can be considered a future option for infertility treatment. Mesenchymal stem cells (MSCs) have the capability to differentiate into male GCs with the use of inducers such as retinoic acid. Transforming growth factorbeta 1 (TGFb1) has been shown to play important roles in male fertility and spermatogenesis. Bone morphogenic protein 4 (BMP4) and BMP8b are also involved in the derivation of primordial GCs (PGCs) from epiblast cells. Therefore, this study aims to determine whether TGFb1, BMP4 and BMP8b can initiate transdifferentiation of MSCs into GCs in vitro and to determine the type of changes that occur in the expression of GC-specific markers. In this study, we have divided passage3 ram bone marrow (BM)-MSCs into three main groups (BMP4, BMP8b and TGFb1) which were separately treated with 10 ng/ml TGFb1, 100 ng/ml BMP4 and 100 ng/ml BMP8b for a period of 21 days. We have evaluated the ability of these groups to differentiate into GCs by assessing expressions of GC-specific markers with reverse transcription PCR (RT-PCR), quantitative RT-PCR (qRT-PCR), immunocytochemistry, morphological changes and alkaline phosphatase (ALP) activity. Our results showed that BMP4 and BMP8b induced PGCs properties in some BM-MSCs and TGFb1 formed spermatogonial stem cells (SSCs) and spermatogonia-like cells in BM-MSCs culture. The important results of this study provide the basis for additional studies to determine the exact mechanism of GCs differentiation and possibly solve the problem of infertility.

Introduction Infertility is one of the most acute social problems that face developed countries. Generally, approximately half of all infertility cases are caused by male factors (Madhukar and Rajender 2009; Miyamoto et al. 2012). Several factors have been defined as causes for male infertility, of which the most important is failure in germ cell (GCs) proliferation and differentiation (Nayernia et al. 2004). A promising treatment of infertility is stem cell therapy; some scientists believe that production of GCs from stem cells in the laboratory may be a useful choice for treatment of male infertility (Lin et al. 2003; Nagano 2007). Mesenchymal stem cells (MSCs) are a type of adult stem cell that possess the capacity to differentiate into male GCs (Nayernia et al. 2006a; Drusenheimer et al. 2007; Hua et al. 2009a,b; Huang et al. 2010). These cells are non-hematopoietic, undifferentiated, multipotent, fibroblast-like cells which reside in various tissues and exhibit differentiation capacity into different cell types of both mesenchymal and non-mesenchymal lineages (Kassem 2004; Uccelli et al. 2008). To date, supplements including retinoic

acid (Nayernia et al. 2006a; Drusenheimer et al. 2007; Hua et al. 2009a,b; Huang et al. 2010; GhasemzadehHasankolaei et al. 2014) and bone morphogenic protein 4 (BMP4) (Mazaheri et al. 2011; Shirazi et al. 2012) are reported to induce MSCs transdifferentiation into GC-like lineages. The transforming growth factor-beta (TGFb) superfamily of cytokines consists of over 40 signalling molecules. These growth factors play a critical role in normal physiology and pathogenesis in a number of tissues. Those best studied in mammalian reproduction include TGFb 1, 2 and 3, the inhibins and activins, BMPs, M€ ullerian-inhibiting substance (MIS), growth and differentiation factors (GDFs) and glial cell linederived neurotropic factor (GDNF) (Itman et al. 2006; Burks and Cohn 2011). It is believed that TGFb1 possesses numerous biological functions such as regulation of cell proliferation and differentiation (Han et al. 1998; Gonzalez et al. 2012) and is necessary for normal sexual competence (Ingman and Robertson 2007). TGFb1 is present in the developing foetal and neonatal testis and is a source of chemoattractant for primordial germ cells (PGCs) both in the genital ridges and in culture (Godin and Wylie 1991; Olaso et al. 1998). Studies have shown that both BMP4 and BMP8b are necessary for formation, specification and probably proliferation of PGCs (Ying et al. 2000, 2001; Hiller et al. 2011). It has been shown that BMP4 knockout mice have several congenital abnormalities and lack GCs in their testes (Lawson et al. 1999). These data have encouraged infertility scientists to attempt the establishment of an in vitro system to produce GCs using stem cells and different stimulators that most likely would solve the infertility problem. Some studies have also shown the reproductive effects of the aforementioned growth factors in vitro. Several studies have shown that BMP4 can induce embryonic stem cells (ESCs) (Toyooka et al. 2003; Kee et al. 2006), bone marrow (BM)-MSCs (Mazaheri et al. 2011; Shirazi et al. 2012), epiblast cells (Pesce et al. 2002) and induced pluripotent stem cells (iPSCs) (Easley et al. 2012) to differentiate into GC-like cells in vitro. Although these studies have demonstrated the capability of BMP4 to induce GC differentiation in different pluripotent cells, no study has been performed to determine whether TGFb1 and BMP8b have the same effects. With the exception of the two aforementioned studies on the impact of BMP4 on mouse BM-MSCs, no other study has been undertaken. There is no report regarding the effects of TGFb1 and BMP8b on © 2014 Blackwell Verlag GmbH

TGFb1, BMP4 and BMP8b, Produced Germ Cell from MSC

589

transdifferentiation of MSCs into GCs. Thus, the current study is a basic study that seeks to determine whether TGFb1, BMP4 and BMP8b can induce ram BM-MSCs to differentiate into male GCs and to define and compare their effects on the expression of GC-specific markers. The results of this study may assist with the establishment of a proper in vitro GC production system. For BMP4, 100 ng/ml has been proposed to be the proper concentration to induce GC differentiation in different cell types (Pesce et al. 2002; Kee et al. 2006). There is no report about the concentration of BMP8b in cell cultures. As previously stated, studies have indicated that each one of BMP4 and BMP8b has its own specific function in derivation of GCs in the embryo and the absence of any of them causes disruption in the normal process of GC development. Furthermore, researchers in their studies have considered equivalent role for BMP4 and BMP8b and wherever they talked about them, emphasized equally on their role (Zhao et al. 1996; Ying et al. 2000, 2001; Shimasaki et al. 2004; de Sousa Lopes et al. 2004; Dudley et al. 2007). For this reason, we have used the same concentration as BMP4 for BMP8b. The proper concentration of TGFb1 for cell culture is 10 ng/ml (Olaso et al. 1998; Zhao et al. 2010). Because numerous similarities exist between sheep and humans in terms of physiology and organ size and due to ease of handling, sheep are appropriate research models for human diseases (Lieschke and Currie 2007). The current study has used a ram as the source for BMMSCs. To date, the most common source for MSCs has been BM. We divided ram BM-MSCs into three different groups and treated each group with either TGFb1, BMP4 and BMP8b for 21 days. Next, we studied GC-specific features by assessment of changes in cell morphology, GC-specific marker expression and alkaline phosphatase (ALP) activity. This is the first study that has evaluated the effects of TGFb1, BMP4 and BMP8b in induction of GC differentiation in MSCs and compared their effectiveness.

tibias into 50-ml injection syringes, each of which contained 7500 units of heparin. For each ram, the BM sample was immediately mixed with an equal amount of complete culture medium comprised of highglucose Dulbecco’s modified eagle medium (DMEM; Gibco, Paisley, UK), 20% foetal bovine serum (FBS; Gibco), 100 U/ml penicillin G and 100 U/ml streptomycin (Gibco). The mixture was kept on ice and delivered to the Royan Institute Cell Culture Facility.

Materials and Methods Animals Shal strain rams (Ovis aries) were used for BM sampling. For this purpose, newly matured healthy rams that weighed approximately 37–38 kg were purchased from the Sheep Breeding Center at Tehran University, Iran. Rams were maintained for two weeks at the Royan Institute facilities (Karaj, Iran) to fully adapt to housing and diet. Bone marrow (BM) sampling All procedures were performed following official permission granted by the Animal Ethics Committee of Royan Institute (Tehran, Iran). Under general anaesthesia induced by the administration of intramuscular injections of ketamine (22 mg/kg) and xylazine (0.2 mg/ kg), rams were placed in the dorsal recumbency position. Following pre-operative preparations, we withdrew approximately 15 ml of BM from the animals’

© 2014 Blackwell Verlag GmbH

Isolation and culture of ram bone marrow mesenchymal stem cells (BM-MSCs) Ram BM-MSCs were prepared according to previously described methods (Drusenheimer et al. 2007; Ghasemzadeh-Hasankolai et al. 2012) with slight modifications. BM–medium mixture was centrifuged at 800 g for 10 min at 20°C. The cells were then re-suspended in complete culture medium, carefully layered on a Lymphodex (density: 1.077 g/ml; Inno-Train, Kronberg/ Taunus, Germany) cushion and centrifuged at 430 g for 30 min at 20°C. The low-density mononuclear fraction was collected, washed and re-suspended in complete culture medium at 9 9 104 cells/ml. The cultures were maintained at 37°C in humidified 5% CO2 atmosphere. Cell colonies of the primary cultures were isolated by cloning cylinders with 0.25% trypsin/ 1 mM EDTA and cultured in a new culture dish. The culture medium was changed every 3–4 days, and the cells were subcultured prior to complete confluency. Characterization of ram bone marrow mesenchymal stem cells (BM-MSCs) According to the MSCs Committee of the International Society for Cell Therapy, in order for unknown animal cells from most species other than humans to be characterized as MSCs, they should have at least two criteria – the ability to adhere to a culture dish and the capacity to differentiate into bone, cartilage and adipose cell lineages (trilineage differentiation) (Dominici et al. 2006). Therefore, we treated our isolated cells with osteogenic, adipogenic and chondrogenic media for 21 days, after which they were evaluated by specific staining and reverse transcription (RT)-PCR for expression of tissue-specific genes. Furthermore, colonogenic assay was performed to estimate the growth potential of isolated BM cells. Osteogenesis Passaged-3 cells were cultured in six-well plates and treated with osteogenic medium composed of highglucose DMEM (Gibco) supplemented with 0.1 lM dexamethasone (Sigma, St. Louis, MO, USA), 10 mM bglycerol phosphate (Sigma), 0.2 mM ascorbic acid (AsA; Sigma) and 10% FBS (Gibco) for 21 days. The medium was changed twice weekly. For detection of mineralized matrix and cell aggregates after osteogenic induction, we subjected the cultures to alizarin red staining and observed them with a light microscope (Olympus, Tokyo, Japan) followed by gene expression analysis.

590

M Ghasemzadeh-Hasankolaei, MA Sedighi-Gilani and MB Eslaminejad

Chondrogenesis We used the micro-mass method to evaluate the chondrogenesis capability of the cells. To achieve this, 2 9 105 passaged-3 cells were pelleted by centrifuging at 300 g for 5 min and then cultivated in a chondrogenic medium. The medium consisted of high-glucose DMEM (Gibco) supplemented with 0.1 lM dexamethasone, 50 lg/ml AsA, 100 lg/ml sodium pyruvate (Sigma), 40 lg/ml proline (Sigma), 10 ng/ml TGFb3 and 50 mg/ml ITS+ pre-mix [Becton Dickinson; 6.25 lg/ml insulin, 6.25 lg/ml transferrin, 6.25 ng/ml selenious acid, 1.25 mg/ml bovine serum albumin (BSA) and 5.35 mg/ml linoleic acid]. The cultures were maintained for 21 days, and the media was changed every 3–4 days. At the end of the treatment period, the micro-masses underwent a histological process where they were fixed in 10% formalin, dehydrated in ascending concentrations of ethanol, cleared in xylene and subsequently embedded in paraffin wax. From these, 5-lm sections were prepared and stained in toluidine blue. Stained sections were visualized by light microscope (Nikon, Tokyo, Japan). In addition, we evaluated the expression of cartilage-specific genes. Adipogenesis We used six-well culture plates for this test. Passaged-3 cells were treated with adipogenic medium that consisted of high-glucose DMEM (Gibco) supplemented with 0.5 mM 3-isobutyl-1-methylxanthine (IBMX; Sigma), 1 lM hydrocortisone (Sigma), 0.1 mM indomethacin (Sigma) and 10% FBS (Gibco). The medium was changed every 3–4 days for 21 days. At the end of the 21 days, cells were evaluated for adipogenic differentiation. Cells were fixed, stained by Oil Red O solution in 99% isopropanol for 15 min and then observed by light microscope (Olympus, Japan). Analysis of adipose tissue-specific gene expression was performed for confirmation of positive differentiation into adipocytes. Colonogenic assay For this purpose, passaged-3 cells (in triplicate) were plated at 100 cells in 10-cm Petri dish and maintained in incubator for 10 days. At the end of the culture period, the cells were washed (twice) with PBS, fixed for 15 min with 1% glutaraldehyde, rinsed with distilled water and then stained with 1% crystal violet in methanol. The number of colonies was counted under invert microscope (Olympus, Japan). Treatment of bone marrow mesenchymal stem cells (BM-MSCs) with BMP4, BMP8b and TGFb1 There were four study groups in this research, the BMP4 (treated) group, BMP8b (treated) group, TGFb1 (treated) group and an untreated control group (all groups were in triplicate). The treatment medium was a complete culture media with adequate amounts of growth factors. BMP4 (100 ng/ml; human recombinant BMP4, R&D Systems, Minneapolis, MN, USA), BMP8b (100 ng/ml; human recombinant BMP8b,

R&D Systems, Minneapolis, MN, USA) and TGFb1 (10 ng/ml; R&D Systems, Minneapolis, MN, USA) were used for the treatment of passage-3 BM-MSCs. The cells were cultured in a 25-cm2 flask and treated with these growth factors for 21 days. The control group consisted of BM-MSCs that only received complete culture medium. The medium was changed every three days, and at the end of the treatment period, differentiation into male GCs was evaluated by assessments of cell morphology, ALP activity, GC-specific gene expression and their differential expression. Cells were evaluated by immunocytochemistry staining to detect the spermatogonia-specific marker, PGP9.5. Immunostaining Immunocytochemistry was performed to determine whether BMP4, BMP8b and TGFb1 could induce PGP 9.5 (a ubiquitin C-terminal hydrolase) expression in ram BM-MSCs. It has been shown that PGP 9.5 is a marker of spermatogonia and also neural cells (Giambanco et al. 1991; Luo et al. 2006). Passaged-3 cells were cultured in chamber slides and treated by the three growth factors for 21 days. The media was changed every three days. At the end of the 21-day treatment period, slides were processed for immunostaining according to a previously described method (Rodriguez-Sosa et al. 2006) with slight modifications. Cells in the chamber slides were fixed with 4% paraformaldehyde (20 min, 2–8°C), washed with 0.05% phosphatebuffered saline/Tween (PBS/Tween, 2 9 5 min), permeabilized with 0.1% triton (10 min, room temperature), washed again with PBS (2 9 5 min), blocked in 5% goat serum (Dako, Glostrup, Denmark) in PBS for 30 min at room temperature and exposed overnight to primary antibody at 2–8°C. An unconjugated primary antibody (rabbit anti-PGP 9.5; Dako, Glostrup, Denmark) was used at a dilution of 1 : 300 in PBS with 2.5% goat serum (PBS-GS). After washing three times in PBS for 5 min each, the slides were exposed for 1 h at room temperature to a secondary antibody [goat anti-rabbit IgG-FITC (Santa Cruz, CA, USA), 1 : 200 in PBS-GS] and then twice washed in PBS for 10 min. Immediately, slides were stained with DAPI (Vector Laboratories, Burlington, ON, Canada), mounted and viewed under a fluorescent microscope. Reverse transcription (RT)-PCR and quantitative RT-PCR (qRT-PCR) analyses RT-PCR was performed to evaluate the treated cells for tissue-specific gene expression for osteogenic, chondrogenic, adipogenic and GC differentiation. We extracted total RNA from the cells with TRIzol reagent (Invitrogen, Paisley, UK) according to the manufacturer’s instructions. To eliminate probable genomic DNA contamination, DNase treatment was performed by DNase I (Takara, Shiga, Japan). Standard RT reactions were performed with 2 lg of total RNA that was reverse transcribed into cDNA using a random hexamer primer and a RevertAidTM First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Roth, Germany) according to the manufacturer’s instructions. © 2014 Blackwell Verlag GmbH

TGFb1, BMP4 and BMP8b, Produced Germ Cell from MSC

591

To evaluate tissue-specific gene expression, we used the following PCR mixtures: 2 ll cDNA; 1x PCR buffer (AMSTM; CinnaGen Co., Tehran, Iran); 200 lM dNTPs; 0.5 lM each of bone, fat, cartilage tissue and GC-specific antisense and sense primers; and 1U Taq DNA polymerase (CinnaGen Co., Tehran, Iran). Efficiency was determined for each primer using a standard curve (the serial dilution of testis cDNA). The primers used for RT-PCR are listed in Table 1. Changes in the expression of GC-specific genes were evaluated by qRT-PCR using an Applied Biosystem Real-Time PCR (ABI Step1-plus, Foster City, CA, USA), Master SYBR Green Kit (ABI), and REST© software for data analysis (Pfaffl et al. 2002). Three independent biological repetitions for each treatment group were used to analyse quantitative gene expression, and triplicate PCRs were performed for each sample. The mathematical model used in REST© software is based on the mean crossing point deviation between the sample (treatment) and control groups. After checking of a number of housekeeping genes, the most efficient one was selected for real-time RT-PCR analysis, and based on the REST© guidelines, there is no problem with using one reference (housekeeping) gene. In our study, for each sample, the reference gene (b-actin) and target gene were amplified in the same run. The target genes were normalized to a reference gene and expressed relative to the control or untreated group. Passage-3 ram untreated BM-MSCs were considered as the control in the real-time RT-PCR evaluation, and changes in gene expression were compared with the expression of genes in BM-MSCs. So, the gene expression of the control group was considered as baseline (X axis). BMPs, in particular BMP4, have an important role in osteogenesis (Kang et al. 2009) and cause high ALP activity in MSCs following treatment (Luu et al. 2007). To reject osteogenic differentiation, changes in the expression of osteocalcin (bone-specific gene) in both BMP4- and BMP8b-treated cells were evaluated by qRT-PCR. Studies have also shown the role of TGFb1 in osteogenesis (Zhao et al. 2010) and chondrogenesis (Solorio et al. 2010). Therefore, after treatment of

the cells with TGFb1, we evaluated expressions of osteocalcin and collagen type 2 (cartilage-specific gene) by qRT-PCR. As previously stated, a number of scientists have shown that PGP9.5 is a neural marker (Giambanco et al. 1991). To reject differentiation into nerve cells, we examined the PGP9.5 expressing groups for expression of tyrosine hydroxylase (TH). The primers used for qRT-PCR were the same as those used for RT-PCR analysis (Table 1). Alkaline phosphatase (ALP) assay It has been shown that PGCs and embryonic GCs both exhibit high levels of ALP activity (McLaren and Durcova-Hills 2001; Zhao and Garbers 2002). To determine whether treatment of BM-MSCs with BMP4, BMP8b and TGFb1 affected ALP activity, we measured the enzyme levels following treatment and compared them with untreated control cells from the Alkaline Phosphatase Assay Kit (BioVision, Milpitas, CA, USA). Passaged-3 BM-MSCs were cultured in a 24-well plate; for each growth factor, three wells were analysed. The cells were treated with BMP4, BMP8b and TFGb1 for 21 days. At the end of the treatment period, we measured ALP activity in each well, which consisted of approximately 160 000 BM-MSCs at almost complete confluency and compared them to the control group. Statistical analysis Data obtained from different experiments including realtime RT-PCR analysis, the number of PGP positive cells and ALP activity of the cells were analysed with one-way ANOVA and Tukey’s HSD. Version 18 SPSS (SPSS Inc., Chicago, IL, USA) software was utilized for analysis. p < 0.05 was considered statistically significant.

Results After culturing the BM-derived mononuclear cells, we observed a number of fibroblastic elongated cells attached to the bottom of the culture dish. These

Table 1. Primers used for RT-PCR and qRT-PCR Gene GAPDH AGGRECAN COLLAGEN II PPARa OSTEOCALCIN LPL TH ACTB OCT4 VASA PIWIL2 DAZL Beta1 INTEGRIN PROACROSIN

Sequence A. N.

Forward primer

Reverse primer

A.T. (°C)

AF030943.1 FJ200438 FJ200439 FJ200440 NM_001040009.1 FJ200435 XM_004019963.1 NM_001009784.1 JN625522 JF411068.1 JF780512.1 JN625521 NM_001113770.1 AJ278742.1

50 -CACAGTCAAGGCAGAGAAC 50 -TTGGACTTTGGCAGAATACC 50 -GCGGAGACTACTGGATTG 50 -AGAACAAGGAAGCGGAAGTC 50 -AGCGAGGTGGTGAAGAGAC 50 -TCTCTTGGGATACAGCCTTG 50 -GCAAACAGAATGGAGAGGTG 50 -TCAGAGCAAGAGAGGCATCC 50 -GAAAGAGAAAGCGGACGAG 50 -GAGAGGCGGTTATCAAGACG 50 -TCGTATTGATGATGTGGATTGG 50 TCCAAGTTCACCAGTTCAGG 50 -AGGGGAGCCACAGACATTC 50 -GTCGCCAGAGATAACACCAC

50 -TTCACGCCCATCACAAAC 50 -CTTCCACCAATGTCGTATCC 50 -TTTCTTGTCCTTGCTCTTGC 50 -ATCCCGTCTTTGTTCATCAC 50 -GCTCATCACAGTCAGGGTTG 50 -ATGCCCTACTGGTTTCTG 50 -ACGGGTCAAACTTCACAGAG 50 -GGTCATCTTCTCACGGTTGG 50 -GTGAAAGGAGACCCAGCAG 50 -AACCACCTCGTCCACTTCC 50 -GGGAGCAGCAGGATTTCAC 50 - CGTCTGTATGCTTCTGTCCAC 50 -AAAGAGCCAAACCCGATTC 50 -ATCAGCCTCCAGTCGGTCAC

60 59 58 60 60 59 60 60 60 60 60 60 60 60

Seq. A.N., sequence accession number; A.T., annealing temperature.

© 2014 Blackwell Verlag GmbH

592

M Ghasemzadeh-Hasankolaei, MA Sedighi-Gilani and MB Eslaminejad

cells showed colony formation ability. Prior to complete confluency, the cells were detached by trypsinization and subcultured. To confirm that these cells were MSCs, we performed the trilineage differentiation test. Trilineage differentiation and characterization of ram bone marrow mesenchymal stem cells (BM-MSCs) Osteogenesis At approximately day six of osteogenic treatment, we observed the first morphological changes with gradual formation of nodule-like aggregations. These nodules stained red with alizarin red staining, which indicated the presence of mineralized compartments (Fig. 1a).

RT-PCR analysis showed the expression of bonespecific genes (Fig. 1b). Adipogenesis The first lipid droplets were seen at approximately day nine of adipogenic treatment and increased in number as time progressed. Lipid droplets stained positive with Oil Red O staining (Fig. 1c). RT-PCR analysis confirmed the expression of adipocyte-specific genes (Fig. 1d). Chondrogenesis Staining of the micro-mass sections with toluidine blue showed the cartilage matrix (Fig. 1e). RT-PCR analysis

(a)

(b)

(c)

(d)

(e)

(f)

Fig. 1. Trilineage differentiation of ram bone marrow mesenchymal stem cells (BM-MSCs). (a) Osteogenesis in BM-MSCs confirmed by alizarin red staining (Bar = 200 lm). (b) Reverse transcription (RT)-PCR for two bone-specific genes. (c) Lipid droplets of adipocytes stained red with Oil Red O stain (Bar = 200 lm). (d) Expression of fat tissue-specific genes. (e) Section of the micro-mass of ram BM-MSCs treated with chondrogenic medium and cartilage matrix stained with toluidine blue (Bar = 100 lm). (f) RT-PCR analysis for cartilage-specific genes

© 2014 Blackwell Verlag GmbH

TGFb1, BMP4 and BMP8b, Produced Germ Cell from MSC

593

revealed the expression of cartilage-specific genes (Fig. 1f). These results confirmed that our isolated cells were undoubtedly MSCs.

treatment and control groups after 21 days of treatment (data not shown).

Colonogenic assay Our evaluations revealed that ram BM-isolated MSCs were colonogenic cells. After 10 days of culture, the average number of colonies produced by the cells was 60.44  5.72. Morphological changes in bone marrow mesenchymal stem cells (BM-MSCs) after treatment with growth factors No morphological changes were seen in BMP4- and BMP8b-treated cultures. To confirm that BMP4 and BMP8b did not induce osteogenic differentiation in BMMSCs, we stained the cells with alizarin red at the end of the treatment period. Both BMP4- and BMP8b-treated cells were negative for osteogenic differentiation. TGFb1 caused morphological changes in the BMMSCs. The first morphological changes were seen on the second day of treatment. Spindle shape, elongated MSCs changed to oval and round shaped cells (Fig. 2a,b), and a considerable number of cell colonies were formed in TGFb1-treated cultures (Fig. 2c). Immunostaining Immunocytochemistry revealed that PGP 9.5 expression was induced by all three growth factors. Interestingly, cell colonies that were formed in TGFb1-treated groups strongly expressed PGP 9.5 (Fig. 3a,b). Although the percentage of PGP 9.5 positive cells in BMP4 and BMP8b groups was very low, there were considerable numbers of PGP 9.5 positive cells in the TGFb1 group (Fig. 3c). No expression of TH was observed in the

Fig. 2. Change of bone marrow mesenchymal stem cell (BMMSCs) morphology after treatment with transforming growth factor b1. (a) Before treatment (Bar = 50 lm). (b) After treatment (Bar = 50 lm). (c) Cell aggregates (Bar = 200 lm)

© 2014 Blackwell Verlag GmbH

Expression of germ cell-specific genes in treated bone marrow mesenchymal stem cells (BM-MSCs) At the end of the treatment period, the cells were lysed and their RNA extracted for molecular analysis. RT-PCR analysis showed that OCT4, VASA, ITGb1 and PIWIL2 highly expressed in the untreated control group, while DAZL and ACR did not express. qRTPCR analysis revealed that all three growth factors induced downregulation in OCT4 and PIWIL2 expression at the end of the treatment period. In contrast, VASA and ITGb1 were upregulated after treatment. Treatment with TGFb1 caused upregulation of VASA and ITGb1, although PIWIL2 was mostly unchanged and OCT4 slightly downregulated. TGFb1 did not induce the expression of ACR, while DAZL expression was induced after 21 days in treated cells. BMP4 and BMP8b showed almost similar effects on GC-specific gene expression; however, BMP8b had a somewhat greater effect (p > 0.05) and no expression of ACR was seen at the end of the experiment in either the treatment or control groups. BMP4 and BMP8b induced low expressions of DAZL in treated cells. While all three utilized growth factors showed these effects, a comparison with the gene expression pattern of the testicular cells showed that TGFb1 induced the most similar gene expression pattern to the testis. All results are shown in Fig. 4a,b. Alkaline phosphatase (ALP) activity of treated bone marrow mesenchymal stem cells (BM-MSCs) Alkaline phosphatase activity was measured at the end of the treatment period. Statistical analysis (one-way ANOVA) showed a significant increase in ALP in the

594

M Ghasemzadeh-Hasankolaei, MA Sedighi-Gilani and MB Eslaminejad

(a)

(a)

(b)

(b)

Fig. 4. Expression of germ cell-specific (GC-specific) genes in bone marrow mesenchymal stem cells (BM-MSCs) before and after treatment with different growth factors. (a) RT-PCR analysis. (b) Relative expression of GC genes (meanstandard error) in treated BM-MSCs. Different letters represent significant difference in level of expression (p < 0.05)

(c)

than the BMP8b group. All differences were statistically significant (Fig. 5). At the end of the treatment period, qRT-PCR showed downregulation of osteocalcin and collagen type 2 in TGFb1-treated cells and osteocalcin in BMP4- and BMP8b-treated cells (data not shown).

Discussion In this study, we attempted to evaluate and compare the effects of BMP4, BMP8b and TGFb1 on the induction

Fig. 3. PGP 9.5 expression induced after treatment with all three growth factors in bone marrow mesenchymal stem cells (BM-MSCs). (a) Single PGP 9.5-positive cells in transforming growth factor (TGF) b1-treated culture (Bar = 100 lm). (b) A cell colony of PGP 9.5positive cells in TGFb1-treated culture (Bar = 100 lm). Nuclei are stained with DAPI. (c) The percentage of PGP 9.5-expressing cells in different groups. The highest numbers of cells (meanstandard deviation) were observed in the TGFb1 group. Different letters represent significant difference between groups (p < 0.05)

treated cells of the BMP4, BMP8b and TGFb1 groups compared with the control group (p < 0.05). ALP activity in the TGFb1 group was greater than the other two groups; the BMP4 group had greater ALP activity

Fig. 5. Changes in alkaline phosphatase (ALP) activity in bone marrow mesenchymal stem cells (BM-MSCs) by treatment with bone morphogenic protein (BMP)4, BMP8b and transforming growth factor (TGF)b1. All three growth factors significantly increased ALP activity in comparison with untreated cells. The level of the enzyme in TGFb1-treated cells was the highest. This level in the BMP4 group was greater than the BMP8b group. Different letters represent significant difference in ALP activity level (p < 0.05). ALP values are shown as mean  standard deviation

© 2014 Blackwell Verlag GmbH

TGFb1, BMP4 and BMP8b, Produced Germ Cell from MSC

595

of GC transdifferentiation in ram BM-MSCs. As mentioned before, several researchers have shown the capability of various pluripotent cell types such as ESCs (Toyooka et al. 2003; Nayernia et al. 2006b), MSCs (Nayernia et al. 2006a; Drusenheimer et al. 2007; Hua et al. 2009a,b; Huang et al. 2010), epiblasts (Ying et al. 2001; Pesce et al. 2002) and dermal stem cells (Linher et al. 2009; Dyce et al. 2011) to differentiate into GCs in vitro. Moreover, different inducers have been used for induction of differentiation into GCs in the cells. Retinoic acid alone or combined with other inducers such as testicular cell conditioned medium or testis extract (Nayernia et al. 2006a; Drusenheimer et al. 2007; Hua et al. 2009a,b; Huang et al. 2010) and BMP4 in two studies (Mazaheri et al. 2011; Shirazi et al. 2012) have been used for production of GCs from MSCs. In this study, we selected BMP4, BMP8b and TGFb1 to stimulate ram BM-MSCs to differentiate into GCs; this selection was based on their role in the GCs development process in the body. Passage-3 ram BM-MSCs were treated with the above-mentioned growth factors in separate groups for 21 days after which the expression of GC-specific properties was analysed. The ram is a large farm animal with numerous similarities to humans which makes it a good model for research of numerous diseases. Moreover, few studies have been conducted on the sheep MSCs capability of differentiation into GCs. The greatest limitation of this study was the lack of sheep GC-specific gene sequences and GC-specific markers, a limitation mentioned by other researchers (Bahadorani et al. 2011). Thus, we selected two PGC genes (VASA and OCT4) and five spermatogonia and spermatogonial stem cell (SSC) genes (PIWIL2, ITGb1, DAZL, ACR and PGP 9.5) to assay the differentiation process. Ram BM-MSCs were characterized by their adherence to the bottom of the culture dish and differentiation capacity into bone, cartilage and fat cells. We observed that ram BM-MSCs were colony-forming elongated spindle-shaped cells that attached to the culture plate and had great capacity for proliferation and differentiation into osteoblasts, chondrocytes and adipocytes. After 21-day treatment with BMP4, BMP8b and TGFb1, there was a slight change in cell morphology in the first two groups, while there were observed changes in cell morphology in the TGFb1-treated group. Spindle shape MSCs changed to oval and round shape cells; a number of cell colonies were observed in the culture. Some studies have shown that male adult GCs are round and colonogenic cells in culture (Wu et al. 2009; Izadyar et al. 2011). RT-PCR results showed that untreated control MSCs expressed the GC-specific genes VASA, PIWIL2, ITGb1 and OCT4. Thus, we performed qRT-PCR to determine the presence of changes in gene expression after treatment. Real-time RT-PCR revealed that 21-day treatment of ram BM-MSCs with BMP4, BMP8b and TGFb1 changed the expressions of the evaluated genes. Our results showed that BMP4, BMP8b and TGFb1 increased expression of the VASA gene, obviously, and the effects of BMP8b and TGFb1 were greater than the effect of BMP4. VASA is a GC-specific gene that

functions in germ cell specification in the embryo that highly expresses in GCs of both males and females during development (Gustafson and Wessel 2010; Huang et al. 2010; Ghasemzadeh-Hasankolaei et al. 2014). This gene is expressed from PGCs until the post-meiotic GC stage (Lacham-Kaplan 2004; Drusenheimer et al. 2007). VASA expression in humans can be observed in migrating PGCs, spermatogonia, spermatocytes and spermatids (Castrillon et al. 2000). There is no report about the effects of BMP8b and TGFb1 alone on the expression of VASA; however, two studies have shown that BMP4 can induce and increase the expression of VASA in mouse BM-MSCs (Mazaheri et al. 2011; Shirazi et al. 2012). Kee et al. have shown that addition of BMP8b to BMP4 during treatment could promote the expression of the GC-specific gene, VASA, in human ESCs (Kee et al. 2006). OCT4 is a pluripotency marker expressed in pluripotent and undifferentiated cells that plays an important role in GCs development (Ovitt and Scholer 1998; Saitou et al. 2002). OCT4 expression is increased in PGCs and gradually decreased during development towards SSCs and A1–A4 spermatogonia (LachamKaplan 2004). OCT4 expression remained almost unchanged in all three groups. Although the expression of OCT4 in the control and three treatment groups was lower than its expression in the testis cells, it seemed that the treated cells somewhat retained their pluripotency states. Our results showed that PIWIL2 expression greatly downregulated in the BMP4 and BMP8b groups, whereas in the TGFb1-treated group the gene expression was almost unchanged when compared with the control group. The Piwi-like 2 (PIWIL2) gene, a member of the AGO/PIWI gene family, is exclusively expressed in testis GCs (spermatogonia and SSCs). This gene has a role in the self-renewal of SSCs and spermatogenesis and is required for the repair of DNA damage induced by various types of genotoxic agents (Lee et al. 2006; Nayernia et al. 2006a; Yin et al. 2011). In the mouse, it has been shown that PIWIL2-null mutants have incomplete spermatogenesis and cannot produce sperm (Deng and Lin 2002). PIWIL2 has a low expression in pre-migratory and migratory stages and an almost increased expression during the development of GCs from post-migratory PGCs to spermatogonia stages (Lacham-Kaplan 2004). Overall, our findings have shown that TGFb1-treated MSCs and untreated control MSCs clearly expressed PIWIL2. Beta1 (b1) and alpha6 ITGs are SSCs and spermatogonia markers (Shinohara et al. 1999; Lacham-Kaplan 2004; Nayernia et al. 2006a). b1 ITGs are required for normal germline transition as well as PGC arrival and settlement in the primary gonads. Researchers have also shown the role of b1 ITGs in the development of the early germline (Shinohara et al. 1999). The 21-day treatment with BMP4, BMP8b and TGFb1 upregulated ITGb1 expression in ram BM-MSCs. The effects of BMP4 and BMP8b were greater than that of TGFb1, and interestingly, the expression level of TGFb1-treated cells was very similar to that of testicular cells. DAZL is a GC-specific gene that expresses throughout the majority of the lifespan of GCs. It is necessary

© 2014 Blackwell Verlag GmbH

596

M Ghasemzadeh-Hasankolaei, MA Sedighi-Gilani and MB Eslaminejad

for the development of PGCs as well as for the differentiation and maturation of most GC stages (Lacham-Kaplan 2004; Nayernia et al. 2006a; Yu et al. 2009). Of interest, after the 21-day treatment, expression of DAZL was induced in cells from the BMP4, BMP8b and TGFb1 groups. This was a key finding in our study. As previously mentioned, untreated ram BM-MSCs did not express DAZL, and expression of this marker after treatment with the above growth factors has indicated that these growth factors have stimulatory effects on differentiation into GCs and appearance of GC characteristics in treated BM-MSCs. ACR is a specific marker of meiotic and post-meiotic GCs, and expression of this marker in the culture shows the cell’s entry into meiosis (Bermudez et al. 1994; Marques-Mari et al. 2009). There was no expression of ACR in both control and treatment groups after 21-day treatment, and meiosis did not occur. GCs have high ALP activity (McLaren and DurcovaHills 2001; Zhao and Garbers 2002). Our results indicated that all three growth factors significantly increased ALP activity in BM-MSCs (p < 0.05). The enzyme level was highest in TGFb1-treated cells (p < 0.05). Immunocytochemistry revealed that all three growth factors induced PGP 9.5 expression in the BM-MSCs, although the expressions in BMP4 and BMP8b groups were very low. No statistically significant difference existed between these two groups and the control group. PGP 9.5 expression in the TGFb1 group was significantly higher than the other treatment and control groups. Our evaluations showed that the neural marker did not express in all treatment groups. A group of researchers reported that pluripotent ESC-derived neural cells have very low ALP contents in both the mRNA and protein levels (Fathi et al. 2011). Totally, from the changes in the expression of GC-specific genes together with high ALP activity in BMP4- and BMP8b-treated cells, expression of GCsspecific genes during GCs development in vivo (LachamKaplan 2004) and the gene expression pattern of testis GCs (Fig. 4b), it could be concluded that BMP4 and BMP8b induced BM-MSCs to differentiate into PGCs (pre-migratory and migratory stages). This finding agreed with former reports regarding the effects of BMP4 (Mazaheri et al. 2011; Shirazi et al. 2012). There were differences between the effects of BMP4 and BMP8b, and BMP8b showed a greater transdifferentiation induction effect. However, in total, their effects were almost similar. TGFb1 induced some considerable changes in the genes’ expressions (particularly induction

References Bahadorani M, Hosseini SM, Abedi P, Hajian M, Afrough M, Azhdari Tafti Z, Azizi H, Hosseini SE, Vahdati A, Baharvand H, Nasr-Esfahani M, 2011: Comparative immunohistochemical analysis of VASA, PLZF and THY1 in goats and sheep suggests that these markers are also conserved in these species. J Cytol Histol 2, 126.

of DAZL expression), a considerably increased ALP activity, obvious morphological changes and PGP 9.5 expression. These findings together with comparison of the GC-specific gene expression in the TGFb1-treated group with the gene expression pattern in the testis GCs (Fig. 4b; a similar pattern of gene expression) and molecular characteristics described for GCs in each stage of the development process (Lacham-Kaplan 2004) showed that TGFb1 could produce adult male germ-like cells (SSCs or undifferentiated spermatogonia) from BM-MSCs. The produced spermatogonia-like cells in the TGFb1-treated culture did not express the meiotic marker, ACR, so it could be concluded that they did not enter meiosis. According to other researchers, meiosis has been a great barrier for the achievement of complete gametogenesis from in vitro-derived GCs (Nayernia et al. 2006a; Drusenheimer et al. 2007). Overall, it could be concluded that BMP4, BMP8b and TGFb1 could form different GC types from ram BM-MSCs. BMP4 and BMP8b produced PGC-like cells, and TGFb1 could create spermatogonia-like cells in the BM-MSC culture. It should be noted that although this was a basic research that has assessed one concentration of the aforementioned growth factors over a given time period (21 days), these remarkable findings are certainly useful for future research on laboratory production of GCs. One possible future study may be an evaluation of the produced GCs functionality by their transplantation into the testis. Another study may be the use of all three aforesaid growth factors together for induction of differentiation into the GCs. Of note, GC development is a highly complicated procedure, and in addition, precise studies should be performed to understand the exact mechanisms of action of the growth factors and to achieve an optimal, effective system for in vitro production of male GCs. Acknowledgement We thank Dr. Soroush Mohit-mafi for his critical assistance with the bone marrow sampling operation. This study was supported financially by Royan Institute (grant number 160).

Conflict of interest None of the authors have any conflict of interest to declare.

Author contributions All the authors contributed equally in the design, research work and manuscript preparation.

Bermudez D, Escalier D, Gallo JM, Viellefond A, Rius F, Perez de Vargas I, Schrevel J, 1994: Proacrosin as a marker of meiotic and post-meiotic germ cell differentiation: quantitative assessment of human spermatogenesis with a monoclonal antibody. J Reprod Fertil 100, 567– 575. Burks TN, Cohn RD, 2011: Role of TGF-beta signaling in inherited and acquired myopathies. Skelet Muscle 1, 19.

Castrillon DH, Quade BJ, Wang TY, Quigley C, Crum CP, 2000: The human VASA gene is specifically expressed in the germ cell lineage. Proc Natl Acad Sci USA 97, 9585–9590. Deng W, Lin H, 2002: miwi, a murine homolog of piwi, encodes a cytoplasmic protein essential for spermatogenesis. Dev Cell 2, 819–830. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause

© 2014 Blackwell Verlag GmbH

TGFb1, BMP4 and BMP8b, Produced Germ Cell from MSC D, Deans R, Keating A, Prockop D, Horwitz E, 2006: Minimal criteria for defining multipotent mesenchymal stromal cells. The international society for cellular therapy position statement. Cytotherapy 8, 315–317. Drusenheimer N, Wulf G, Nolte J, Lee JH, Dev A, Dressel R, Gromoll J, Schmidtke J, Engel W, Nayernia K, 2007: Putative human male germ cells from bone marrow stem cells. Soc Reprod Fertil Suppl 63, 69–76. Dudley BM, Runyan C, Takeuchi Y, Schaible K, Molyneaux K, 2007: BMP signaling regulates PGC numbers and motility in organ culture. Mech Dev 124, 68–77. Dyce PW, Liu J, Tayade C, Kidder GM, Betts DH, Li J, 2011: In vitro and in vivo germ line potential of stem cells derived from newborn mouse skin. PLoS ONE 6, e20339. Easley CA 4th, Phillips BT, McGuire MM, Barringer JM, Valli H, Hermann BP, Simerly CR, Rajkovic A, Miki T, Orwig KE, Schatten GP, 2012: Direct differentiation of human pluripotent stem cells into haploid spermatogenic cells. Cell Rep 2, 440–446. Fathi A, Hatami M, Hajihosseini V, Fattahi F, Kiani S, Baharvand H, Salekdeh GH, 2011: Comprehensive gene expression analysis of human embryonic stem cells during differentiation into neural cells. PLoS ONE 6, e22856. Ghasemzadeh-Hasankolaei M, Eslaminejad MB, Batavani R, Sedighi-Gilani M, 2014: Comparison of the efficacy of three concentrations of retinoic acid for transdifferentiation induction in sheep marrow-derived mesenchymal stem cells into male germ cells. Andrologia 46, 24–35. Ghasemzadeh-Hasankolai M, Batavani R, Eslaminejad MB, Sedighi-Gilani M, 2012: Effect of zinc ions on differentiation of bone marrow-derived mesenchymal stem cells to male germ cells and some germ cell-specific gene expression in rams. Biol Trace Elem Res 150, 137–146. Giambanco I, Bianchi R, Ceccarelli P, Pula G, Sorci G, Antonioli S, Bocchini V, Donato R, 1991: ‘Neuron-specific’ protein gene product 9.5 (PGP 9.5) is also expressed in glioma cell lines and its expression depends on cellular growth state. FEBS Lett 290, 131–134. Godin I, Wylie CC, 1991: TGF beta 1 inhibits proliferation and has a chemotropic effect on mouse primordial germ cells in culture. Development 113, 1451– 1457. Gonzalez CR, Calandra RS, Gonzalez-Calvar SI, 2012: Influence of the photoperiod on TGF-beta1 and p15 expression in hamster Leydig cells. Reprod Biol 12, 201–218. Gustafson EA, Wessel GM, 2010: Vasa genes: emerging roles in the germ line and in multipotent cells. BioEssays 32, 626–637. Han SH, Yea SS, Jeon YJ, Yang KH, Kaminski NE, 1998: Transforming growth factor-beta 1 (TGF-beta1) promotes IL-2 mRNA expression through the up-regulation of NF-kappaB, AP-1 and NF-AT in EL4 cells. J Pharmacol Exp Ther 287, 1105–1112.

© 2014 Blackwell Verlag GmbH

Hiller M, Liu C, Blumenthal PD, Gearhart JD, Kerr CL, 2011: Bone morphogenetic protein 4 mediates human embryonic germ cell derivation. Stem Cells Dev 20, 351–361. Hua J, Pan S, Yang C, Dong W, Dou Z, Sidhu KS, 2009a: Derivation of male germ cell-like lineage from human fetal bone marrow stem cells. Reprod Biomed Online 19, 99–105. Hua J, Yu H, Dong W, Yang C, Gao Z, Lei A, Sun Y, Pan S, Wu Y, Dou Z, 2009b: Characterization of mesenchymal stem cells (MSCs) from human fetal lung: potential differentiation of germ cells. Tissue Cell 41, 448–455. Huang P, Lin LM, Wu XY, Tang QL, Feng XY, Lin GY, Lin X, Wang HW, Huang TH, Ma L, 2010: Differentiation of human umbilical cord Wharton’s jellyderived mesenchymal stem cells into germ-like cells in vitro. J Cell Biochem 109, 747–754. Ingman WV, Robertson SA, 2007: Transforming growth factor-beta1 null mutation causes infertility in male mice associated with testosterone deficiency and sexual dysfunction. Endocrinology 148, 4032–4043. Itman C, Mendis S, Barakat B, Loveland KL, 2006: All in the family: TGF-beta family action in testis development. Reproduction 132, 233–246. Izadyar F, Wong J, Maki C, Pacchiarotti J, Ramos T, Howerton K, Yuen C, Greilach S, Zhao HH, Chow M, Chow YC, Rao J, Barritt J, Bar-Chama N, Copperman A, 2011: Identification and characterization of repopulating spermatogonial stem cells from the adult human testis. Hum Reprod 26, 1296–1306. Kang Q, Song WX, Luo Q, Tang N, Luo J, Luo X, Chen J, Bi Y, He BC, Park JK, Jiang W, Tang Y, Huang J, Su Y, Zhu GH, He Y, Yin H, Hu Z, Wang Y, Chen L, Zuo GW, Pan X, Shen J, Vokes T, Reid RR, Haydon RC, Luu HH, He TC, 2009: A comprehensive analysis of the dual roles of BMPs in regulating adipogenic and osteogenic differentiation of mesenchymal progenitor cells. Stem Cells Dev 18, 545–559. Kassem M, 2004: Mesenchymal stem cells: biological characteristics and potential clinical applications. Cloning Stem Cells 6, 369–374. Kee K, Gonsalves JM, Clark AT, Pera RA, 2006: Bone morphogenetic proteins induce germ cell differentiation from human embryonic stem cells. Stem Cells Dev 15, 831–837. Lacham-Kaplan O, 2004: In vivo and in vitro differentiation of male germ cells in the mouse. Reproduction 128, 147–152. Lawson KA, Dunn NR, Roelen BA, Zeinstra LM, Davis AM, Wright CV, Korving JP, Hogan BL, 1999: Bmp4 is required for the generation of primordial germ cells in the mouse embryo. Genes Dev 13, 424–436. Lee JH, Engel W, Nayernia K, 2006: Stem cell protein Piwil2 modulates expression of murine spermatogonial stem cell expressed genes. Mol Reprod Dev 73, 173–179.

597 Lieschke GJ, Currie PD, 2007: Animal models of human disease: zebrafish swim into view. Nat Rev Genet 8, 353–367. Lin DP, Chang MY, Chen BY, Chang HH, 2003: Male germ line stem cells: from cell biology to cell therapy. Reprod Fertil Dev 15, 323–331. Linher K, Dyce P, Li J, 2009: Primordial germ cell-like cells differentiated in vitro from skin-derived stem cells. PLoS ONE 4, e8263. Luo J, Megee S, Rathi R, Dobrinski I, 2006: Protein gene product 9.5 is a spermatogonia-specific marker in the pig testis: application to enrichment and culture of porcine spermatogonia. Mol Reprod Dev 73, 1531–1540. Luu HH, Song WX, Luo X, Manning D, Luo J, Deng ZL, Sharff KA, Montag AG, Haydon RC, He TC, 2007: Distinct roles of bone morphogenetic proteins in osteogenic differentiation of mesenchymal stem cells. J Orthop Res 25, 665–677. Madhukar D, Rajender S, 2009: Hormonal treatment of male infertility: promises and pitfalls. J Androl 30, 95–112. Marques-Mari AI, Lacham-Kaplan O, Medrano JV, Pellicer A, Simon C, 2009: Differentiation of germ cells and gametes from stem cells. Hum Reprod Update 15, 379–390. Mazaheri Z, Movahedin M, Rahbarizadeh F, Amanpour S, 2011: Different doses of bone morphogenetic protein 4 promote the expression of early germ cell-specific gene in bone marrow mesenchymal stem cells. In Vitro Cell Dev Biol Anim 47, 521–525. McLaren A, Durcova-Hills G, 2001: Germ cells and pluripotent stem cells in the mouse. Reprod Fertil Dev 13, 661–664. Miyamoto T, Tsujimura A, Miyagawa Y, Koh E, Namiki M, Sengoku K, 2012: Male infertility and its causes in human. Adv Urol 2012, 384520. Nagano MC, 2007: In vitro gamete derivation from pluripotent stem cells: progress and perspective. Biol Reprod 76, 546–551. Nayernia K, Li M, Jaroszynski L, Khusainov R, Wulf G, Schwandt I, Korabiowska M, Michelmann HW, Meinhardt A, Engel W, 2004: Stem cell based therapeutical approach of male infertility by teratocarcinoma derived germ cells. Hum Mol Genet 13, 1451–1460. Nayernia K, Lee JH, Drusenheimer N, Nolte J, Wulf G, Dressel R, Gromoll J, Engel W, 2006a: Derivation of male germ cells from bone marrow stem cells. Lab Invest 86, 654–663. Nayernia K, Nolte J, Michelmann HW, Lee JH, Rathsack K, Drusenheimer N, Dev A, Wulf G, Ehrmann IE, Elliott DJ, Okpanyi V, Zechner U, Haaf T, Meinhardt A, Engel W, 2006b: In vitro-differentiated embryonic stem cells give rise to male gametes that can generate offspring mice. Dev Cell 11, 125–132. Olaso R, Pairault C, Boulogne B, Durand P, Habert R, 1998: Transforming growth factor beta1 and beta2 reduce the number of gonocytes by increasing apoptosis. Endocrinology 139, 733–740. Ovitt CE, Scholer HR, 1998: The molecular biology of Oct-4 in the early mouse embryo. Mol Hum Reprod 4, 1021–1031.

598 Pesce M, Gioia Klinger F, De Felici M, 2002: Derivation in culture of primordial germ cells from cells of the mouse epiblast: phenotypic induction and growth control by Bmp4 signalling. Mech Dev 112, 15–24. Pfaffl MW, Horgan GW, Dempfle L, 2002: Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 30, e36. Rodriguez-Sosa JR, Dobson H, Hahnel A, 2006: Isolation and transplantation of spermatogonia in sheep. Theriogenology 66, 2091–2103. Saitou M, Barton SC, Surani MA, 2002: A molecular programme for the specification of germ cell fate in mice. Nature 418, 293–300. Shimasaki S, Moore RK, Otsuka F, Erickson GF, 2004: The bone morphogenetic protein system in mammalian reproduction. Endocr Rev 25, 72–101. Shinohara T, Avarbock MR, Brinster RL, 1999: beta1- and alpha6-integrin are surface markers on mouse spermatogonial stem cells. Proc Natl Acad Sci USA 96, 5504–5509. Shirazi R, Zarnani AH, Soleimani M, Abdolvahabi MA, Nayernia K, Ragerdi Kashani I, 2012: BMP4 can generate primordial germ cells from bone-marrow-derived pluripotent stem cells. Cell Biol Int 36, 1185–1193. Solorio LD, Fu AS, Hernandez-Irizarry R, Alsberg E, 2010: Chondrogenic differentiation of human mesenchymal stem cell

M Ghasemzadeh-Hasankolaei, MA Sedighi-Gilani and MB Eslaminejad aggregates via controlled release of TGF-beta1 from incorporated polymer microspheres. J Biomed Mater Res A 92, 1139–1144. de Sousa Lopes SM, Roelen BA, Monteiro RM, Emmens R, Lin HY, Li E, Lawson KA, Mummery CL, 2004: BMP signaling mediated by ALK2 in the visceral endoderm is necessary for the generation of primordial germ cells in the mouse embryo. Genes Dev 18, 1838–1849. Toyooka Y, Tsunekawa N, Akasu R, Noce T, 2003: Embryonic stem cells can form germ cells in vitro. Proc Natl Acad Sci USA 100, 11457–11462. Uccelli A, Moretta L, Pistoia V, 2008: Mesenchymal stem cells in health and disease. Nat Rev Immunol 8, 726–736. Wu Z, Falciatori I, Molyneux LA, Richardson TE, Chapman KM, Hamra FK, 2009: Spermatogonial culture medium: an effective and efficient nutrient mixture for culturing rat spermatogonial stem cells. Biol Reprod 81, 77–86. Yin DT, Wang Q, Chen L, Liu MY, Han C, Yan Q, Shen R, He G, Duan W, Li JJ, Wani A, Gao JX, 2011: Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin. PLoS ONE 6, e27154. Ying Y, Liu XM, Marble A, Lawson KA, Zhao GQ, 2000: Requirement of Bmp8b for the generation of primordial germ cells in the mouse. Mol Endocrinol 14, 1053–1063. Ying Y, Qi X, Zhao GQ, 2001: Induction of primordial germ cells from murine epiblasts by synergistic action of BMP4 and

BMP8B signaling pathways. Proc Natl Acad Sci USA 98, 7858–7862. Yu Z, Ji P, Cao J, Zhu S, Li Y, Zheng L, Chen X, Feng L, 2009: Dazl promotes germ cell differentiation from embryonic stem cells. J Mol Cell Biol 1, 93–103. Zhao GQ, Garbers DL, 2002: Male germ cell specification and differentiation. Dev Cell 2, 537–547. Zhao GQ, Deng K, Labosky PA, Liaw L, Hogan BL, 1996: The gene encoding bone morphogenetic protein 8B is required for the initiation and maintenance of spermatogenesis in the mouse. Genes Dev 10, 1657–1669. Zhao L, Jiang S, Hantash BM, 2010: Transforming growth factor beta1 induces osteogenic differentiation of murine bone marrow stromal cells. Tissue Eng Part A 16, 725–733.

Submitted: 22 Jan 2014; Accepted: 6 Apr 2014 Author’s address (for correspondence): Mohamadreza Baghaban Eslaminejad, Department of Stem Cells and Developmental Biology, Royan Institute, Bani Hashem Sq., Bani Hashem St., Resalat Highway, P.O. Box: 19395-4644, Tehran, Iran. E-mails: [email protected] or [email protected]

© 2014 Blackwell Verlag GmbH