Increasing Available NADH Supply During Succinic Acid Production by Corynebacterium glutamicum Zhihui Zhou, Chen Wang, Yali Chen, Kai Zhang, Hongtao Xu, and Heng Cai College of Biotechnology and Pharmaceutical Engineering, Nanjing University of Technology, Nanjing 211816, China

Zhongjun Chen College of Food Science and Engineering, Inner Mongolia Agricultural University, Hohhot 010018, China DOI 10.1002/btpr.1998 Published online 00 Month 2014 in Wiley Online Library (wileyonlinelibrary.com)

A critical factor in the biotechnological production of succinic acid with Corynebacterium glutamicum is the sufficient supply of NADH. It is conceivable that cofactor availability and the proportion of cofactor in the active form may play an important role in dictating the succinic acid yield. PntAB genes from Escherichia coli can directly catalyze the reversible hydride transfer and adjust the dynamic balance between NADP(H) and NAD(H). Hence, we studied the physiological effect of coenzyme systems by expressing the membrane-bound transhydrogenase pntAB genes. We have shown experimentally that the pntAB genes could function as an alternative source of NADH. In an anaerobic fermentation with C. glutamicum NC-3pntAB, a 16% higher succinic acid yield and a 57% higher production from glucose were obtained by pntAB expression. Moreover, the formation of by-products was significantly decreased. The concomitant increase in the consumption of intracellular NADPH from 0.6 to 1.2 mmol/g CDW and the increased NADH/NAD1 ratio resulted from introduction of pntAB, suggesting that the membrane-bound transhydrogenase converted excess NADPH to NADH for succinic acid production. Finally, we explored whether the transhydrogenase had different effects on the succinic acid formation on different carbon sources. The succinic acid yield was increased in the presence of pntAB by 16% on glucose, 7% on sucrose, and without large influence on fructose and xylose. The results of this study demonstrated that the effectiveness of cofactor manipulation could be a promising strategy applied in metabolic engineering. C 2014 American Institute of Chemical Engineers Biotechnol. Prog., 000:000–000, 2014 V Keywords: Corynebacterium glutamicum, membrane-bound transhydrogenase, PntAB, succinic acid yield, NADH supply

Introduction R

Succinic acid, denoted as “a LEGOV of the chemical industry,” is used as significant precursor for many petroleum products such as 1,4-butanediol, tetrahydrofuran, and adipic acid.1 It is widely used in the pharmaceuticals, pesticide, dye industries, and also known as a C4 platform compound, which could serve as a key building block for some important chemical products with a potential global market of $15 billion.2 Currently, the world market demand of succinic acid is more than 276,000 t/a.3 It is mainly produced from fossil fuels by a chemical synthetic process, which comes at a high environmental cost, particularly in the form of higher CO2, the well-known greenhouse gas. With the price of fossil fuels and environmental awareness both increasing, biological processes for succinic acid production become more economical and acceptable. Some bacteria, such as Corynebacterium glutamicum,4 Anaerobiospirillum succinciproducens,5 Actinobacillus succinogenes,6 Escherichia coli,7 and Mannheimia succiniciproCorrespondence concerning this article should be addressed to Heng Cai at [email protected]. C 2014 American Institute of Chemical Engineers V

ducens,8 are applied for succinic acid production. C. glutamicum is regarded as a robust and easily manageable production host. Recent studies have shown the successful employment of C. glutamicum for the production of glutamic acid under aerobic condition9 and of lactic acid, succinic acid under oxygen deprivation condition.10,11 Industrial fermentations commonly use glucose as a substrate. Theoretically, 1.71 mol succinic acid can be produced per mol glucose (plus CO2), based on the available electrons. Actually, the theoretical yield will increase to 2 mol succinic acid per mol glucose, if supplying the CO2 and additional reducing power are done.2 The theoretical yield is the target sought for bacterial succinic acid production. Although wild-type C. glutamicum has the metabolic pathway of succinic acid production, the succinic acid yield is 0.19 g/g, much lower than the theoretical yield 2 mol/mol (1.31 g/g). Metabolic engineering has already been applied to increase succinic acid yield. With increasing concentration of bicarbonate to 400 mmol/L, the yield of succinic acid was increased to 0.29 g/g.12 Overexpressing C. glutamicum pyc in an ldhA mutant increased succinic acid yield to 0.92 g/g.13 A C. glutamicum ATCC13032 strain for anaerobic succinic acid production, which decreased the formation 1

2

Figure 1. Schematic representation of the metabolic pathways relevant for succinic acid production by C. glutamicum under anaerobic condition (showing NADH/NAD1). Reactions leading to by-products are displayed in imaginary line. PPP, pentose phosphate pathway; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; PEP, phosphoenolpyruvate; PEPC, phosphoenolpyruvate carboxylase; PEPCK, phosphoenolpyruvate carboxykinase; PC, pyruvate carboxylase; LDH, lactate dehydrogenase; MDH, malate dehydrogenase; FUM, fumarase; SDH, succinodehydrogenase; TH, pyridine nucleotide transhydrogenase; STH, soluble pyridine nucleotide transhydrogenase.

of by-products, overexpressed the pyc gene and expressed an NAD1-coupled formate dehydrogenase accumulated succinic acid with a yield of 1.09 g/g (1.7 mol/mol), accompanied by a low level of by-products.4 Acetic acid and succinic acid production were increased under microaerobic conditions by C. glutamicum ATCC13032 harboring E. coli transhydrogenase gene pntAB.14 In anaerobic glucose fermentation, the enzymes of the TCA pathway are repressed by both glucose and hypoxia. For example, the oxoglutarate dehydrogenase complex is not functional in anaerobic conditions. Camarasa et al.15 found that the formation of succinic acid from oxaloacetate via the oxidative branch of the pathway either does not occur or occurs at levels too low for detection by 13C-NMR under anaerobic conditions. Thus, the oxidative branch of the TCA cycle is omitted in Figure 1.11 In principle, 1 mole of glucose can produce 2 moles of succinic acid. Whereas, 1 mole of glucose can only generate 2 moles of NADH, and the synthesis of 2 moles of succinic acid requires 4 moles of NADH.11 Thus, one major obstacle

Biotechnol. Prog., 2014, Vol. 00, No. 00

to high succinic acid yield through the reductive branch of the TCA cycle is NADH limitation. NADPH and NADH are the key cofactor of metabolism, the content and form can be changed in microbial cell. Cofactor engineering has been increasingly popular in the production of many chemicals such as pyruvic acid,16 1,3-propanediol,17,18 and acetoin.19 This promising and powerful strategy has been applied to the production of another important bio-based chemical, succinic acid. The efficient NADH regeneration is essential to improving succinic acid yield. Expressing a NAD1-coupled formate dehydrogenase (FDH) to provide additional reducing equivalents was applied to optimize the production of succinic acid.4 PntAB expression had been used to increase NADPH supply for xylitol production in E. coli and L-lysine production in C. glutamicum.20,21 Nevertheless, few reports about increasing NADH to improve chemicals yield by expressing pntAB genes have been found. E. coli, but not C. glutamicum, possess a membrane-bound transhydrogenase encoded by the pntAB genes.21 Membranebound transhydrogenase catalyzes a reversible reduction of NADP1 by NADH, which is ATP-dependent and linked to the translocation of one proton from the intermembrane space (out) to the cytosol (in) in bacteria, respectively. This work began with the intent to improve succinic acid yield in C. glutamicum by metabolic engineering. To solve the problem of unbalanced coenzymes and further facilitate NADPH converting to NADH for succinic acid production, pntAB genes were successfully expressed in C. glutamicum. Our work was to determine whether a transhydrogenase pntAB could function as an alternative source of NADH, because many industrial useful compounds required NADH during their biosynthesis. The transhydrogenase strategy is dependent on the pentose phosphate pathway (PPP) where CO2 is lost, which also limits the yield, and also dependent on PPP for the production of NADPH, which would be converted to NADH. Finally, a 16% higher succinic acid yield and a 57% higher succinic acid production from glucose were obtained in the expressing pntAB strain. The functionality of this system was successfully demonstrated in succinic acid production experiments. These results presented here reveal that both productivity and yield of succinic acid can be increased when NADH availability is increased.

Materials and Methods Bacterial strains, plasmids, and DNA manipulation The strains, plasmids, and primers used in this study are listed in Table 1, with their related characteristics and sources. C. glutamicum NC-3 (C. glutamicum ATCC 13032, Dldh, ::xylA, xylB, gapA) was used for constructing the mutant strain used in this study.22 C. glutamicum NC-3pntAB, heterologous expression of pntAB genes strain, were used for testing the effects of pntAB on succinic acid production. Plasmid pXMJ19, a C. glutamicum–E. coli shuttle vector, was used for construction. The empty vector, pXMJ19, was transformed into C. glutamicum NC-3, resulting in C. glutamicum NC-3a. E. coli JM109 was applied as the DNA sources for amplifying pntAB genes and maintenance. Plasmid pXMJ19-pntAB was used to express the pntAB genes, under the control of an IPTG-inducible tac promoter. Plasmid preparation and manipulation (kits from Zoman Biotechnology, China, ZP101-03), genomic DNA preparation (kits from TIANamp Biotechnology, China,

Biotechnol. Prog., 2014, Vol. 00, No. 00

3

Table 1. Bacterial Strains, Plasmids, and Primers Used in This Study Strain, Plasmids, or Primers Genotypes, Properties, or Sequences Strains C. glutamicum NC-3 C. glutamicum NC-3a C. glutamicum NC-3-pntAB E. coli JM109 Plasmids* pXMJ19 pXMJ19-pntAB Primers† P1 P2

C. glutamicum ATCC 13032 derivative with an in-frame deletion of the ldhA, with integration of xylose metabolic gene (xylA,xylB) and gapA C. glutamicum NC-3 derivative with pXMJ19 as the control, C. glutamicum NC-3 derivative with pntAB expression recA1 endA1 gyrA96 thi hsdR17 supE44 relA1 D(lac-proAB)/F0 [traD36 proAB1 lacIq lacZDM15]

Sources or References 22 This study This study Takara

Cmr; E. coli-C. glutamicum shuttle vector, tac promoter Cmr, pXMJ19 derivative containing the E. coli pntAB genes under the control of an IPTG-inducible tac promoter

43 This study

50 -GATTCTAGAAAAGGAGGACAACCATGCGAATTGGCATACCA-30 50 -GGGGTACCCAGGGTTACAGAGCTTTCAG-30

This study This study

*cmr : chloramphenicol resistance. The underlined letters indicated the restriction sites, the bold letters means the SD sequences.

†

DP302-02), and transformation was performed using procedures.23 Restriction enzymes and T4 DNA ligase were bought from Takara Biotechnology. Oligonucleotides were synthesized, and DNA sequencing was conducted by Genscript Biotechnology. Media Agar plate medium containing 10 g/L tryptone, 5 g/L yeast extract, 10 g/L NaCl, and 15 g/L agar was used for strain construction, added Chloromycetin (Cm) (100 mg/mL) necessarily. The nutrient-rich medium (A medium) was used for aerobic growth: 2 g/L urea, 2 g/L yeast extract powder, 7 g/L casein acid hydrolysate, 7 g/L (NH4)2SO4, 0.5 g/L KH2PO4, 0.5 g/L K2HPO4, 0.5 g/L MgSO47H2O, 6 m g/L FeSO47H2O, 4.2 m g/L MnSO4H2O, 0.2 m g/L biotin, 0.2 m g/L vitamin B1. The mineral salts medium (BT medium), including 0.5 g/L KH2PO4, 0.5 g/L K2HPO4, 0.5 g/L MgSO47H2O, 6 m g/L FeSO47H2O, 4.2 m g/L MnSO4H2O, 0.2 m g/L biotin, 0.2 m g/L vitamin B1, 300 mmol/L Na2CO3.

Aerobic culture for cell growth A single colony was picked from plates and inoculated into 5 mL Luria Bertani broth, cultivated at 30 C for 12 h. For aerobic fermentation, a seed inoculum from an overnight 2 mL culture was added to 50 mL nutrient rich-medium (Amedium) with carbon source and 0.1% IPTG (0.8 mM/L), constant agitation at 200 rpm at 30 C for 18 h. Anaerobic fermentation for succinic acid production The cells grown in aerobic-phase cultures were harvested by centrifugation for 10 min at 8,000 rpm, and washed with mineral salts medium (BT medium). An appropriate amount of washed cells were suspended in 25 mL mineral salts medium. The deprivation of oxygen (dissolved oxygen concentration was lower than 0.01 ppm) was achieved by a gassing manifold with oxygen-free CO2 for 30 s. The cell suspension was incubated at 30 C, 150 rpm for 18 h. Preparation of cell extracts and transhydrogenase activity assay

Construction of transhydrogenase pntAB expression plasmid Standard protocols were used for the construction, purification, analysis of plasmid DNA and the transformation of E. coli. Extraction of C. glutamicum chromosomal DNA and transformation of C. glutamicum by electroporation were performed as described previously.24 PCR was performed using a DNA thermal cycler (2720 Thermal cycler, Applied Biosystems, USA) using Prime STARHS DNA Polymerase (Takara Bio, Japan). For pntAB expression in C. glutamicum, the pntA– pntB segments were amplified from E. coli JM109 genomic DNA (prepared by TIANamp Bacteria DNA Kit, DP302-02). Primer 1 for pntAB genes amplification were: “P1” 50 -GATTC TAGAAAAGGAGGACAACCATGCGAATTG GCATACCA30 (XbaI underlined); “P2”50 -GGGGTACCCAGGGTTACA GAGCTTTCAG-30 (KpnI underlined). The PCR-generated DNA fragment was digested with XbaI and KpnI and cloned into expression vector pXMJ19 digested with the same restriction enzymes, transformed into E. coli JM109, and plated on LB plates containing 50 mg/mL Cm. The resulting plasmid pXMJ19-pntAB was verified by sequence analysis (Genscript Biotechnology). Plasmid pXMJ19-pntAB was electroporated into C. glutamicum competent cell (3 kV, 5 ms). After screening, C. glutamicum NC-3-pntAB, overexpressing pntAB strain, was obtained.

The recombinant strain C. glutamicum NC-3-pntAB was grown in 500 mL Erlenmeyer flasks with 50 mL working volume. IPTG was added into the culture to a final concentration of 0.8 mM to induce the expression of pntAB gene when the strains grew to an OD600 of 0.6–0.8. After induction at 30 C for 16 h, cells were harvested by centrifugation for 10 min at 8000 rpm. According to the previous studies,25 the cell extracts used for transhydrogenase activity assay were prepared. The method was based on that provided in Ref. 26. The reaction was performed at 30 C in a 1-mL (final volume) mixture containing 50 mM potassium phosphate (pH7.0), 1 mM KCN, 1 mM DTT, 1 mM EDTA, 0.4 mM 3-acetylpyridine-NAD1 (Sigma), and 0.4 mM NADPH (Sigma). The reduction of 3-acetylpyridine-NAD1 by NADPH was measured by determining the increase in absorbance at 375 nm. An extinction coefficient of 5.1 mM/ cm was used. One unit corresponded to the conversion of 1 lM of 3-acetylpyridine-NAD1 to 3-acetylpyridine-NADH per minute. Determination of intracellular pyridine nucleotide concentration For the measurement of intracellular NAD1, NADH, NADPH, NADP1 concentrations, cell extraction was

4

Biotechnol. Prog., 2014, Vol. 00, No. 00

performed as follows. Cells from 5 mL culture were harvested by centrifugation for 5 min, at 12,000 rpm, after removing the supernatant, 300 lL 0.2 mol/L NaOH for NADH/NADPH or 300 lL 0.2 mol/L HCl for NAD1/ NADP1 was added to the pellets to resuspend them. The NaOH extraction destroyed the oxidized form, and the HCl extraction destroyed the reduced form of pyridine nucleotide.27 The samples were incubated for 10 min in 55 C, immediately placed on ice until cooling to 0 C. After adding 300 lL 0.1 mol/L NaOH for NADH/NADPH extraction or 300 lL 0.1 mol/L HCl for NAD1/NADP1 to neutralization, the samples were centrifuged for 5 min, at 12,000 rpm. Finally, the supernatant was moved in an iced tube, necessary to measure in 1 h. The intracellular concentration of NADH and NAD1 were determined by the enzymatic reaction using the NAD1/NADH Assay kit (Comin biotechnology company, China, AY1–2), intracellular concentration of NADPH and NADP1 were measured using the NADP1/ NADPH Assay kit (Comin biotechnology company, China, BY1–2). Determination of culture biomass The culture biomass was determined by measuring the absorbance value of the culture sample at 600 nm using a UV visible spectroscopy system (Mapada Company, China). One unit of optical density was determined to be equivalent 0.4 g CDW per liter. Quantification of sugars and organic acids For quantification of sugars and organic acids, samples from 25 mL anaerobic culture were centrifuged (12,000 rpm, 1 min), and the supernatants were analyzed for glucose, organic acid. Organic acids (succinic acid, acetic acid, pyruvic acid) were analyzed by HPLC (high-performance liquid chromatograph) system (Agilent, America) equipped with an UV detector and conductivity meter and a Grace PrevaiTM column (Part NO.88645 Length 250 nm. ID 4.6 nm). The mobile phase was 25 mM KH2PO4 (PH 2.5) solution at a flow rate of 1.0 mL/min, and the column was operated at 25 C, 215 nm. Sugar (glucose) was measured by a glucose analyzer containing glucose oxidase (SBA-40E, Biology Institute of Shandong Academy of Sciences, China). Xylose and fructose were quantified with a Agilent HPLC on an Aminex HPX-87H column (Bio-Rad) operating at 45 C with 5 mM H2SO4 as the mobile phase at a flow rate of 0.6 mL/ min and detected with an RI-detector. Sucrose was determined with a sucrose assay kit as detected by the manufacturer (Amyjet Scientific Inc K626-100). The mass yield of succinic acid was defined as the amount of succinic acid from 1 g glucose consumed and expressed in g/g.

Results Influence of pntAB expression on the recombinant transhydrogenase activity The specific transhydrogenase activity was determined in cell extracts of C. glutamicum NC-3-pntAB. The activity was 0.64 lmol per min per mg of protein, which was in the same range as that measured for C. glutamicum DM1730 expressing the E. coli pntAB genes.21 However, no transhydrogenase activity was detected in the reference strain.

Figure 2. Cofactor concentration of succinic acid producing strains with and without expression of pntAB genes in sealed bottles supplemented with 40 g/L glucose. The color gray means the beginning of anaerobic fermentation, the color white means the end of anaerobic fermentation. The data represent mean values and deviation of three independent experiments.

Effects of expressing transhydrogenase on intracellular NADH and NADPH concentrations Heterologous expression of pntAB in C. glutamicum was expected to increase intracellular NADH pool and thus strengthen the flux of NADH-dependent succinic acid formation pathway. We determined the concentrations of NADH, NAD1, NADPH, NADP1 in cells of C. glutamicum NC-3pntAB in anaerobic fermentation (Figure 2). The high concentration of NADPH in the beginning anaerobic fermentation was consistent with that excess NADPH in Corynebacterium crenatum,14 which was up to 3.5 mmol/g CDW (Figure 2). NADPH consumption was 0.6 mmol/g CDW in the reference strain; however, NADPH consumption was 1.2 mmol/g CDW in the pntAB expression strain (Figure 2). The consumption of NADPH in C. glutamicum NC-3pntAB was greater than the control, suggesting that more NADPH was converted into NADH by transhydrogenase to produce succinic acid. The NADH/NAD1 ratio was higher in the pntAB expressing strain than that of the control (Figure 3). In contrast, the

Biotechnol. Prog., 2014, Vol. 00, No. 00

Figure 3.

5

Cofactor level of C. glutamicum with and without expression of pntAB genes in sealed bottles in anaerobic medium supplemented with 40 g/L glucose. The data represent mean values and deviation of three independent experiments.

NADPH/NADP1 ratio was decreased in the pntAB expressing strain from 1.97 to 1.43 mol/mol (Figure 3). It indicated that the transhydrogenase converted NADPH into NADH in C. glutamicum NC-3-pntAB and redox status in C. glutamicum NC-3 was changed. Impact of pntAB expression in C. glutamicum NC-3 on growth and succinic acid production with glucose As the NADH supply is a critical factor in succinic acid production, we tested whether pntAB genes from E. coli could be used to increase available NADH supply for succinic acid production. In aerobic phase, pntAB expression had no significant influence on the growth and the consumption of glucose in C. glutamicum (data not shown). During anaerobic fermentation, the cell concentration was 13.8 g CDW per liter in C. glutamicum NC-3 and C. glutamicum NC-3-pntAB. When grown on glucose, the succinic acid production in C. glutamicum NC-3-pntAB was increased in comparison with the reference strain C. glutamicum NC-3a by 57% (14–23 g/L). Succinic acid yield was improved in the presence of transhydrogenase by 16% (0.70–0.81 g/g) (Figure 4A). PntAB expression led to an increase in glucose consumption tested by 40% (20–28 g/L) (Figure 4B). Thus, expression of the transhydrogenase genes pntAB had a positive influence on succinic production and yield. The recombinant strain produced less acetic acid and more pyruvic acid due to the result of increased NADH availability, compared with the control strain (Table 2). In sum, only 160 mM C was found in by-products compared to 776 mM C in succinic acid (194 mM). Fermentation study on different sugars with expressing pntAB genes in C. glutamicum For analyzing the different effects of pntAB expression on succinic acid production with different carbon sources, C. glutamicum NC-3-pntAB and the reference strain C. glutamicum NC-3a produced succinic acid upon induction with 0.8 mM IPTG and from the carbon sources: 40 g/L glucose,

Figure 4. Succinic acid production, yield and glucose consumption of C. glutamicum with or without expressing pntAB genes. The experiments were conducted under anaerobic conditions in sealed bottles using anaerobic medium supplemented with 40 g/L glucose. Error bars represent standard deviations of triplicate samples. Figure 4A compared succinic acid production and succinic acid yield between C. glutamicum NC3a and C. glutamicum NC-3-pntAB; Symbols: gray, succinic acid production; white, succinic acid yield. Figure 4B showed different glucose consumption of both strains. Symbols: gray, the beginning of anaerobic fermentation; white, the end of anaerobic fermentation.

40 g/L sucrose, 40 g/L fructose, or 40 g/L D-xylose. Catabolism of D-xylose was achieved in C. glutamicum NC-3 by expressing xylA and xylB genes from E. coli.28 Carbon source consumption, biomass formation, and succinic acid production, as measured after 18 h, are summarized in Table 3. In the pntAB-expressing strain, glucose and sucrose consumption was significantly increased, whereas the consumption of fructose and D-xylose was either slightly increased or not different (Table 3). With respect to biomass synthesis, pntAB expression had no difference for all the carbon sources. The succinic acid concentration was increased in the presence of pntAB on all carbon sources tested, but to a highly varying extent: about 29.4% on glucose, 22.6% on sucrose, 3.5% on fructose, and 3.7% on D-xylose. With

6

Biotechnol. Prog., 2014, Vol. 00, No. 00

respect to succinic acid yield, pntAB expression led to an increase on glucose tested by 16% (Table 3), and increase on sucrose tested by 7%. By comparison, there was no large influence on succinic acid yield when either fructose or xylose was used, but fructose use provided the highest yield for succinic acid.

Discussion Under anaerobic conditions, succinic acid production can be limited due to cofactor imbalance within the synthetic pathway.14 Recently, these cofactor imbalance problems were addressed in many reports. Ethanol fermentation in Saccharomyces cerevisiae was increased by 14% through switching cofactor supply of xylose reductase from NADPH to NADH.29 A C. glutamicum whose GAPDH was replaced by one directly generating NADPH required for L-lysine synthesis showed a 2.2-fold increase in the production relative to its NADH-generating parent strain.30 PntAB as a resource of NADPH was expressed in C. glutamicum to increase 31 L-valine production. Expressing transhydrogenase genes probably resulted in a more balanced redox state, with a regaining of efficient glucose utilization of C. glutamicum Iso4, and improved isobutanol production.32 Through heterologous expression of a NAD1-dependent formate dehydrogenase of Candida boidinii in E. coli, the intracellular NADH provision was increased twice, which increased the production of ethanol in mixed acid fermentation of E. coli.33 The recent work from Japan has provided a precedent and a basis to our study.14 However, we explored the effects of pntAB in a ldh-deficient C. glutamicum, which showed different metabolic change in comparison with that work. We deleted the ldh gene to decrease the consumption of NADH and the formation of by-product, which would save more NADH for succinic acid production. The succinic acid yield has shown marked increase in our work. Acetic acid concentration was decreased, which could be attributed to Table 2. Effects of Expressing pntAB Genes on By-products Formation in Corynebacterium glutamicum C. glutamicum C. glutamicum Strain NC23a NC-3-pntAB Carbon source consumed* (g/L) Pyruvic acid formed (g/L) Pyruvic acid yield (g/g) Acetic acid formed (g/L) Acetic acid yield (g/g)

19.6761.0 1.21 6 0.02 0.06 6 0.002 2.33 6 0.04 0.12 6 0.006

28 6 1.1 2.06 6 0.01 0.07 6 0.0003 1.49 6 0.02 0.05 6 0.002

*Results of sealed bottles experiments using 40 g/L glucose in anaerobic medium after 18 h for incubation, and the values shown are averages of triplicate experiments 6 standard deviations.

diversion of carbon possibly toward pathways that would help balance the redox state. In addition, we have found that pntAB expression had different effects on succinic acid synthesis when using different carbon sources. In the defined succinic acid-producing C. glutamicum NC3-pntAB, the presence of an active transhydrogenase stimulated the consumption of glucose and the formation of succinic acid. The synthesis of pyruvic acid was increased (Table 2), which showed that the carboxylation reaction efficiency was probably too low although this strain might have increased NADH availability. The decrease of acetic acid production indicated that pntAB-mediated NADH production might affect the partitioning at the acetyl-CoA node to favor the formation of succinic acid over acetic acid. Similar concept of diverting excessive precursors produced from the glycolysis pathways to other products was previously demonstrated to reduce acetate accumulation.34 On the other hand, reduction in acetic acid excretion could be attributed to diversion of carbon possibly toward pathways that would help balance the redox state. In this work, C. glutamicum was genetically engineered to synthesize a membrane-bound transhydrogenase that catalyzed the proton-coupled transfer of reducing equivalents between the NAD(H) and NADP(H) coenzyme systems. A high rate of conversion of NADPH and NAD1 into NADP1 and NADH in C. glutamicum NC-3-pntAB by the transhydrogenase decreased the intracellular pool of NADPH (Figure 2). The NADPH/NADP1 ratio decreased compared with the control, which supported the hypothesis that transhydrogenase converted NADPH into NADH in C. glutamicum NC-3pntAB (Figure 3). NADPH is covered mainly by the oxidative part of the PPP. Chromosomal inactivation of the pgi gene, encoding the phosphoglucoisomerase, would make the carbon flux exclusively redirect toward the oxidative PPP.35 In this Dpgi mutant, the effect of transhydrogenase expression should be more significant. H1-ATPase defect in C. glutamicum could also increase NADH concentration.36 The observed different effects of transhydrogenase expression between the different carbon sources are probably the consequence of different substrate uptake and entrance routes into metabolism (Figure 5).37 Introducing the pntAB genes resulted in the improvement of succinic acid yield and production when growth was on glucose or sucrose. There were no influences when growth was on fructose or D-xylose. The amount of the increased succinic acid yield might be related to the conversion of NADPH, which was dependent on the carbon flux through PPP. This initial step of glucose metabolism was catalyzed to glucose-6-phosphate, which was continuously catalyzed by both glycolysis and the PPP (Figure 5). Compared with the glucose metabolism, the transport and

Table 3. Comparison of Succinic Acid of Corynebacterium glutamicum NC-3a and C. glutamicum NC-3-pntAB Strain Grown on Different Sugars Glucose Sucrose Fructose D-xylose Carbon source* PntAB plasmid 1 2 1 2 1 2 1 2 Carbon source 31.7 6 1.5 27.82 6 1.1 31.37 6 1.2 27.27 6 1.0 19.23 6 0.8 18.17 6 0.8 12.83 6 0.5 11.69 6 0.6 consumed (g/L) Succinic formed (g/L) 26 6 0.9 20.1 6 0 9 21.7 6 0.7 17.7 6 0.4 18.6 6 0.4 17.97 6 0.6 7.98 6 0.2 7.69 6 0.3 Succinic/CDW 1.89 6 0.01 1.48 6 0.01 1.63 6 0.01 1.38 6 0.01 1.52 6 0.008 1.49 6 0.02 1.35 6 0.006 28 6 0.01 Anaerobic 13.76 6 1.1 13.6 6 0.9 13.28 6 0.6 12.8 6 0.8 12.2 6 1.1 12 6 1.05 5.9 6 1.02 6 6 1.01 biomass/CDW 0.82 6 0.002 0.71 6 0.002 0.69 6 0.001 0.65 6 0.001 0.96 6 0.003 0.97 6 0.003 0.68 6 0.002 0.68 6 0.001 Ysuccinic† *Results of sealed bottles experiments using 40 g/L sugars in anaerobic medium after 18 h for incubation, and the values shown are averages of triplicate experiments 6 standard deviations. † Ysuccinic value is succinic acid yield based on sugars (g/g).

Biotechnol. Prog., 2014, Vol. 00, No. 00

7

strategy of manipulation of cofactors and have the promising potential to be an essential tool to solve the problem of cofactor unbalance, such as the production of ethanol, 1, 3propanediol and acetoin, which will achieve a higher production and yield applied to industry production.

Acknowledgments This work was supported by the 973 Program of China (grant no. 2011CB707405).

Literature Cited

Figure 5. Schematic representation of different sugars metabolism of C. glutamicum. (A) Schematic showing the catabolism of glucose as it enters the glycolysis (producing NADH) and Pentose Phosphate Pathway(producing NADPH); (B) Schematic showing the catabolism of fructose as it enters the glycolysis(producing NADH) and Pentose Phosphate Pathway (producing NADPH); (C) Schematic showing the catabolism of sucrose as it enters the glycolysis(producing NADH) and Pentose Phosphate Pathway(producing NADPH); (D) Schematic showing the catabolism of xylose as it enters non-oxidative part of Pentose phosphate Pathway (not producing NADPH).

phosphorylation of sucrose was conducted by the specific PTSsuc.38 The glucose-6-phosphate and fructose were generated from the sucrose-6-phosphate.39 The lack of enzymes with fructokinase activity may have resulted in the export of intracellular fructose and re-importation by PTSfru, which might lead to the decrease of carbon flux through PPP, compared with glucose.40 Thus, the extent of increased succinic acid yield would be less than that with glucose (Table 3). The fructose was taken and phosphorylated to fructose-1phosphate via the PTSfru (Figure 5). PTSglu contributed only 7% of total carbon flux, generating fructose-6-phosphate, finally forming glucose-6-phosphate.41 The entry of fructose into the central metabolism could result in a reduced flux through PPP.37 PPP represented the main source of NADPH, thus, transhydrogenase had little effects on succinic acid production, but efficient NADH was supplied for succinic acid formation through glycolysis, which resulted in the highest succinic acid yield, compared with that of glucose and sucrose. On the other hand, compared to fructose, the use of glucose and sucrose clearly limited the succinic acid yield, owing to the shortage of available NADH supply. The transport of D-xylose was realized by xylA and xylB genes, the final product of D-xylose was D-xylulose-5-phosphate, which is the intermediate of the non-oxidative part of PPP. Because no NADPH formed in non-oxidative part of PPP, transhydrogenase made no difference on succinic acid production with D-xylose. However, we conjectured that not all NADPH was indeed converted into NADH by transhydrogenase.42 Our work demonstrated that the introduction of pntAB activity had a positive effect on improving succinic acid production in C. glutamicum. The supply of NADH could be increased by the

1. Sauer M, Porro D, Mattanovich D, Branduardi P. Microbial production of organic acids: expanding the markets. Trends Biotechnol. 2008;26:100–108. 2. McKinlay JB, Vieille C, Zeikus JG. Prospects for a bio-based succinate industry. Appl Microbiol Biotechnol. 2007;76:727– 740. 3. Lin H, Bennett GN, San KY. Metabolic engineering of aerobic succinate production systems in Escherichia coli to improve process productivity and achieve the maximum theoretical succinate yield. Metab Eng. 2005;7:116–127. 4. Litsanov B, Brocker M, Bott M. Toward homosuccinate fermentation: metabolic engineering of Corynebacterium glutamicum for anaerobic production of succinate from glucose and formate. Appl Environ Microbiol. 2012;78:3325–3337. 5. Samuelov NS, Lamed R, Lowe S, Zeikus JG. Influence of CO2HCO2 3 levels and pH on growth, succinate production, and enzyme activities of Anaerobiospirillum succiniciproducens. Appl Environ Microbiol. 1991;57:3013–3019. 6. Guettler MV, Rumler D, Jain MK. Actinobacillus succinogenes sp.nov, a novel succinic-acid-producing strain from the bovine rumen. Int J Syst Bacteriol. 1999;49:207–216. 7. Ma J-F, Jiang M, Chen K-Q, Xu B, Liu SW, Wei P, Ying HJ. Succinic acid production with metabolically engineered E. coli recovered from two-stage fermentation. Biotechnol Lett. 2010; 32:1413–1418. 8. Lee PC, Lee SY, Hong SH, Chang HN. Isolation and characterization of a new succinic acid-producing bacterium, Mannheimia succiniciproducens MBEL55E, from bovine rumen. Appl Microbiol Biotechnol. 2002;58:663–668. 9. Schneider J, Niermann K, Wendisch VF. Production of the amino acids L-glutamate, L-lysine, L-ornithine and L-arginine from arabinose by recombinant Corynebacterium glutamicum. J Biotechnol. 2011;154:191–198. 10. Okino S, Suda M, Fujikura K, Inui M, Yukawa H. Production of D-lactic acid by Corynebacterium glutamicum under oxygen deprivation. Appl Microbiol Biotechnol. 2008;78:449–454. 11. Inui M, Murakami S, Okino S, Kawaguchi H, Alain A. Verte`s Hideaki Yukawa. Metabolic Analysis of Corynebacterium glutamicum during lactate and succinate productions under oxygen deprivation conditions. J Mol Microbiol Biotechnol. 2004;7: 182–196. 12. Okino S, Inui M, Yukawa H. Production of organic acids by Corynebacterium glutamicum under oxygen deprivation. Appl Microbiol Biotechnol. 2005;68:475–480. 13. Okino S, Noburyu R, Suda M, Jojima T, Inui M, Yukawa H. An efficient succinic acid production process in a metabolically engineered Corynebacterium glutamicum. Appl Microbiol Biotechnol. 2008;81:459–464. 14. Yamauchi Y, Hirasawa T, Nishii M, Furusawa C, Shimizu H. Enhanced acetic acid and succinic acid production under microaerobic conditions by Corynebacterium glutamicum harboring Escherichia coli transhydrogenase gene pntAB. J Gen Appl Microbiol. 2014;60:112–118. 15. Camarasa C, Grivet J-P, Dequin S. Investigation by 13C-NMR and tricarboxylic acid (TCA) deletion mutant analysis of pathways for succinate formation in Saccharomyces cerevisiae during anaerobic fermentation. Microbiology. 2003;149:2669–2678.

8 16. Liu LM, Li Y, Shi ZP, Du GC, Chen J. Enhancement of pyruvate productivity in Torulopsis glabrata: increase of NAD1 availability. J Biotechnol. 2006;126:173–185. 17. Zhang YP, Li Y, Du CY, Liu M, Cao ZA. Inactivation of aldehyde dehydrogenase: a key factor for engineering 1,3-propanediol production by Klebsiella pneumoniae. Metab Eng. 2006;8: 578–586. 18. Zhang YP, Huang ZH, Du CY, Li Y, Cao ZA. Introduction of an NADH regeneration system into Klebsiella oxytoca leads to an enhanced oxidative and reductive metabolism of glycerol. Metab Eng. 2009;11:101–106. 19. Ji X-J, Xia Z-F, Fu N-H, Nie Z-K, Shen M-Q, Tian Q-Q, Huang H. Cofactor engineering through heterologous expression of an NADH oxidase and its impact on metabolic flux redistribution in Klebsiella pneumoniae. Biotechnol Biofuels. 2013;6:7. 20. Chin JW, Khankal R, Monroe CA, Maranas CD, Cirino PC. Analysis of NADPH supply during xylitol production by engineered Escherichia coli. Biotechnol Bioeng. 2009;102:209–220. 21. Kabus A, Georgi T, Wendisch VF, Bott M. Expression of the Escherichia coli pntAB genes encoding a membrane-bound transhydrogenase in Corynebacterium glutamicum improves Llysine formation. Appl Microbiol Biotechnol. 2007;75:47–53. 22. Wang C, Zhang H, Cai H, Zhou Z, Chen Y, Chen Y, Ouyang P. Succinic acid production from corn cobs hydrolysates by genetically engineered Corynebacterium glutamicum. Appl Biochem Biotechnol. 2014;172:340–350. 23. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989. 24. Ikeda M, Mizuno Y, Awane S-I, Hayashi M, Mitsuhashi S, Takeno S. Identification and application of a different glucose uptake system that functions as an alternative to the phosphotransferase system in Corynebacterium glutamicum. Appl Microbiol Biotechnol. 2011;90:1443–1451. 25. Anderlund M, Nissn TL, Nielsen J, Villadsen J, Rydstrom J, Hahn-H€agerdal B, Kielland-Brandt MC. Expression of the Escherichia coli pntA and pntB genes, encoding nicotinamide nucleotide transhydrogenase, in Saccharomyces cerevisiae and its effect on product formation during anaerobic glucose fermentation. Appl Environ Microbiol. 1999;65:2333–2340. 26. Kaplan NO. Beef heart TPNH-DPN pyridine nucleotide transhydrogenases. Methods Enzymol. 1967;10:317–322. 27. Lilius EM, Multanen VM, Toivonen V. Quantitative extraction and estimation of intracellular nicotinamid dinucleotides in Escherichia coli. Anal Biochem. 1979;99:22–27. 28. Kawaguchi H, Verte`s AA, Okino S, Inui M, Yukawa H. Engineering of a xylose metabolic pathway in Corynebacterium glutamicum. Appl Microbiol Biotechnol. 2006;72:3418–3428. 29. Watanabe S, Abu Saleh A, Pack SP, Annaluru N, Kodaki T, Makino K. Ethanol production from xylose by recombinant Saccharomyces cerevisiae expressing protein-engineered NADHpreferring xylose reductase from Pichia stipitis. Microbiology. 2007;153:3044–3054. 30. Takeno S, Murata R, Kobayashi R, Mitsuhashi S, Ikeda M. Engineering of Corynebacterium glutamicum with an NADPHgenerating glycolytic pathway for L-lysine production. Appl Environ Microbiol. 2010;76:7154–7160.

Biotechnol. Prog., 2014, Vol. 00, No. 00 31. Bartek T, Blombach B, Lang S, Eikmanns BJ, Wiechert W, Oldiges M, Noh K, Noack S. Comparative 13C Metabolic Flux Analysis of Pyruvate Dehydrogenase Complex-Deficient, lValine-Producing Corynebacterium glutamicum. Appl Environ Microbiol. 2011;77:6644–6654. 32. Blombach B, Riester T, Wieschalka S, Ziert C, Youn JW, Wendish VF, Eikmanns BJ. Corynebacterium glutamicum tailored for efficient isobutanol production. Appl Environ Microbiol. 2011;77:3300–3312. 33. Berrios-Rivera SJ, Bennett GN, San KY. Metabolic engineering of Escherichia coli: increase of NADH availability by overexpressing an NAD1-dependent formate dehydrogenase. Metab Eng. 2002;4:217–229. 34. Aristidou AA, San KY, Bennett GN. Modification of central metabolic pathway in Escherichia coli to reduce acetate accumulation by heterologous expression of the bacillus subtilis acetolactate synthase gene. Biotechnol Bioeng. 1994;44:944–951. 35. Lindner SN, Petrov DP, Hagmann CT, Henrich A, Kr€amer R, Eikmanns BJ, Wendisch VF, Seibold GM. Phosphotransferase system-mediated glucose uptake is repressed in phosphoglucoisomerase-deficient Corynebacterium glutamicum strains. Appl Environ Microbiol. 2013;79:2588–2595. 36. Sawada K, Kato Y, Imai K, Li LY, Wada M, Matsushita K, Yokota A. Mechanism of increased respiration in an H1ATPase-defective mutant of Corynebacterium glutamicum. J Biosci Bioeng. 2012;113:467–473. 37. Kiefer P, Heinzle E, Wittmann C. Influence of glucose, fructose and sucrose as carbon sources on kinetics and stoichiometry of lysine production by Corynebacterium glutamicum. J Ind Microbiol Biotechnol. 2002;28:338–343. 38. Moon MW, Kim HJ, Oh TK, Shin CS, Lee JS, Kim SJ, Lee JK. Analyses of enzyme II gene mutants for sugar transport and heterologous expression of fructokinase gene in Corynebacterium glutamicum ATCC 13032. FEMS Microbiol Lett. 2005; 244:259–266. 39. Dominguez H, Lindley ND. Complete sucrose metabolism requires fructose phosphotransferase activity in Corynebacterium glutamicum to ensure phosphorylation of liberated fructose. Appl Environ Microbiol. 1996;62:3878–3880. 40. Blombach B, Seibold GM. Carbohydrate metabolism in Corynebacterium glutamicum and applications for the metabolic engineering of L-lysine production strains. Appl Microbiol Biotechnol. 2010;86:1313–132. 41. Ikeda M. Sugar transport systems in Corynebacterium glutamicum: features and applications to strain development. Appl Microbiol Biotechnol. 2012;96:1191–1200. 42. Akinterinwa O, Cirino PC. Anaerobic obligatory xylitol production in Escherichia coli strains devoid of native fermentation pathways. Appl Environ Microbiol. 2011;77:706–709. 43. Jakoby M, Ngouoto-Nkili CE, Burkovski A. Construction and application of new Corynebacterium glutamicum vectors. Biotechnol Techniques. 1999;13:437–441. Manuscript received Feb. 11, 2014, and revision received Oct. 9, 2014.