Mol. Nutr. Food Res. 2015, 59, 365–372
365
DOI 10.1002/mnfr.201400465
RESEARCH ARTICLE
Increased TRPP2 expression in vascular smooth muscle cells from high-salt intake hypertensive rats: The crucial role in vascular dysfunction Ren Zhao1,2,3 , Muyao Zhou1 , Jie Li1 , Xia Wang1 , Kunli Su1 , Juncheng Hu1 , Yong Ye1 , Jinhang Zhu1 , Gongliang Zhang1 , Kai Wang4 , Juan Du1 , Liecheng Wang1,2∗ and Bing Shen1,5 1
Department of Physiology, Anhui Medical University, Hefei, Anhui, P. R. China Department of Pharmacology, Anhui Medical University, Hefei, Anhui, P. R. China 3 Department of Cardiology, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, P. R. China 4 Department of Neurology, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, P. R. China 5 Central Laboratory of Molecular and Cellular Biology of Basic Medical College, Anhui Medical University, Hefei, Anhui, P. R. China 2
Scope: High-salt intake is a major risk factor in the development of hypertension. The underlying mechanism of high sodium on the cardiovascular system has received extensive attention. TRPP2 (Polycystin-2) is a Ca2+ permeable nonselective cation channel that mediates Ca2+ mobilization to control vascular smooth muscle cells (VSMCs) contraction. Here, we investigated TRPP2 expression change in VSMCs from high-salt intake hypertensive rats and role of TRPP2 in the development of high-salt diet-induced hypertension. Methods and results: After 4 ws of dietary treatment, systolic blood pressure was significantly elevated in high-salt intake rats (132 ± 3 mmHg) compared with regular diet control rats (104 ± 2 mmHg). Results from vessel tension and diameter measurements show that high-salt intake potentiated phenylephrine-induced contraction in denuded mesenteric artery and thoracic aorta. Immunoblot and immunofluorescence data indicate that TRPP2 expression in VSMCs from mesenteric artery and thoracic aorta was significantly increased in high-salt intake-induced hypertensive rats. However, agonist-induced contractions in denuded mesenteric artery and thoracic aorta were markedly decreased if TRPP2 was knocked down by specific shRNA. Conclusion: Our data demonstrate that high-salt intake increased TRPP2 expression in VSMCs, which in turn potentiated blood vessel response to contractors; this may participate in the development of hypertension.
Received: July 11, 2014 Revised: October 5, 2014 Accepted: October 22, 2014
Keywords: High-salt intake / Hypertension / TRPP2 / Vascular smooth muscle cell / Vessel tension
Additional supporting information may be found in the online version of this article at the publisher’s web-site
1 Correspondence: Dr. Bing Shen, Department of Physiology, Anhui Medical University, 81 Meishan Road, Hefei, Anhui 230032, P. R. China E-mail: [email protected] Fax: +86-0551-65161126 Abbreviations: IP3 R, inositol 1,4,5-trisphosphate receptor; Phe, phenylephrine; SERCA, sarco/ER Ca2+ -ATPase; shRNA, short hairpin RNA; SOCE, store-operated Ca2+ entry; TG, thapsigargin; TRPP2, polycystin-2; VSMC, vascular smooth muscle cell C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Introduction
Calcium ions play a central role in the control of vascular smooth muscle cells (VSMCs) contraction [1]. Cytosol Ca2+ comes from Ca2+ release mediated by inositol 1,4,5trisphosphate receptor (IP3 R) in the ER and/or Ca2+ entry through voltage-dependent or receptor-operated Ca2+ channels in the plasma membrane [1–3]. Many agonists, for ∗ Additional corresponding author: Dr. Liecheng Wang, E-mail: [email protected]
www.mnf-journal.com
366
R. Zhao et al.
example, ␣-receptor agonist phenylephrine (Phe), can induce a biphasic increase in cytosolic Ca2+ concentration ([Ca2+ ]i ) of VSMCs. The Ca2+ release first induces a transient [Ca2+ ]i rise, followed by a Ca2+ influx that prolongs the increase of [Ca2+ ]i . In the Ca2+ release phase, the agonist induces an intracellular Ca2+ increase via a G protein-coupled receptor-phospholipase C-IP3 pathway [4]. Polycystin-2 (TRPP2) is a Ca2+ -permeable cation channel belonging to the transient receptor potential channel family [5]. In the ER membrane, TRPP2 may associate with IP3 R and the ryanodine receptor to modulate [Ca2+ ]i homeostasis [6–9]. Through the interaction between IP3 R and TRPP2, IP3 R activation increases local cytosolic Ca2+ concentration, which may activate TRPP2 to evoke further Ca2+ release [6,10]. This Ca2+ release from TRPP2, thereafter, contributes to the transient [Ca2+ ]i increase as well. In the vascular system, TRPP2 has pivotal functions, including the control of VSMCs contraction and flow-induced vessel dilation [11,12]. Two studies with Pkd2+/− mice showed that the intracellular and ER Ca2+ levels were reduced, but that the contractile response to Phe was increased due to elevated expressions of smooth muscle ␣-actin and the myosin heavy chain in VSMCs [13, 14]. More recently, Narayanan et al. found that pressure-induced cerebral artery constriction was significantly decreased if TRPP2 was knocked down by TRPP2 small interfering RNA [15]. Because TRPP2 crucially participates in the handling of Ca2+ in VSMCs, we hypothesized that increased TRPP2 activity and expression may play a role in the augmented vascular contractile response to stimuli in hypertensive animals, which may lead to the development of hypertension.
2
Materials and methods
2.1 Animal preparation All animal experiments were conducted in accordance with NIH publication no. 8523 and approved by the Animal Experimentation Ethics Committee of Anhui Medical University. Animals were housed in a temperature-controlled room with a 12:12 h light-dark cycle. Male 6-wks old Sprague–Dawley rats (150–200 g) were randomized into high-salt and agematched control (regular salt diet) groups. The rats were fed diets containing 4% w/w NaCl in the high-salt group and 0.4% NaCl in the regular-salt group for 4 wks.
2.2 Lentiviral preparation TRPP2 short hairpin RNA (shRNA) sequence (AACCUGUUCUGUGUGGUCAGGUUAU (sense strand) and UUGGACAAGACACACCAGUCCAAUA (antisense strand) [16]) and scramble sequence (UAACGACGCGACGACGUAA (sense strand) and UUACGUCGUCGCGUCGUUA (antisense strand)) as a control were inserted into the pLL3.7 vector. To assemble into a viral particle, the plasmid was C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Mol. Nutr. Food Res. 2015, 59, 365–372
cotransfected into HEK293T cells with the packaging and envelope plasmids. The transfection was carried out using lipofectamine 2000. Culture media was harvested after 48 and 72 h, passed through a 0.45-m filter (Millipore) and stored at −80⬚C. Virus suspensions (108 IU particles/mL) were injected into rats through the tail vein using a 100 L/rat dosage. The rat systolic blood pressure was measured every day. In vessel tension experiments, the blood vessels were isolated on the sixth day after virus infection. To determine the efficacy of shRNA-mediated knockdown, molecular assays to quantify protein levels were performed by using immunoblot.
2.3 Noninvasive blood pressure measurement Systolic blood pressure was determined using a noninvasive measurement of tail cuff plethysmography. Briefly, conscious rats were placed in a restrainer and prewarmed chamber and were allowed to rest inside the cage for 15–20 min before the blood pressure measurement was taken. Pneumatic pulse transducers were positioned on the rat tail. A sphygmomanometer was inflated and deflated automatically. The tail cuff signals from the transducer were automatically collected and analyzed using a data acquisition and analysis system (BL-420E+, Chengdu Technology & Market Corp). The tail blood pressure of each rat was measured repeatedly for three times and the mean value of the readings was obtained.
2.4 Vessel tension measurement in organ bath Vessel tension measurements were performed as previously described [12, 17]. The rats were sacrificed via an overdose of CO2 . The thoracic aorta was removed and dissected free from the surrounding connective tissue in oxygenated icecold Krebs solution, containing (mM): NaCl 118, KCl 4.7, CaCl2 2.5, KH2 PO4 1.2, MgSO4 (7 H2 O) 1.2, NaHCO3 25.2, and glucose 11.1. The thoracic aorta was cut into 2 mm-long ring segments. The endothelial layer was removed by gently scrubbing the luminal side of the ring using a stainless steel wire. The vessel rings were mounted onto two thin stainless steel holders; one was connected to a force displacement transducer and the other was connected to a movable device that allowed the application of passive tension of 0.5 g. The mounted rings were kept in 5 mL organ baths containing Krebs solution at 37⬚C, which were continuously bubbled with a gas mixture of 95% O2 and 5% CO2 to maintain a pH of 7.4. The isometric tension was recorded and analyzed by a data acquisition and analysis system (BL-420E+, Chengdu Technology & Market Corp). After an equilibration period of 60 min, the contractile function of the vessel was tested by replacing the Krebs solution with 60 mM K+ solution that was prepared by replacing NaCl with an equimolar amount of KCl and the result was used as the reference contraction. After the washout and restoration of vessel tension to the baseline levels, the rings were exposed to 10 M Phe to test their www.mnf-journal.com
367
Mol. Nutr. Food Res. 2015, 59, 365–372
contractile responses, and subsequently challenged with acetylcholine to certify endothelial functional removal. Next, vessel tension response to Phe from 1 nM to 10 M was recorded. In the end of the experiment, blood vessel tissue was dried and weighed.
2.5 Vessel diameter measurement in pressure myograph system Vessel diameter measurements were performed according to our previous study [12]. Briefly, the mesenteric arteries were dissected and trimmed to 4 mm long segments. The endothelial layer was removed via the gentle rubbing of silk thread. The mesenteric artery segment was mounted on a pressure myograph (Danish MyoTechnology, Denmark, model 110P) with two glass micropipettes. Both cannulation pipettes were connected to independent reservoirs set at the same level, which ensured no flow through the vessel segment. Changes in the vessel diameter and pressure were tracked and measured with MyoView software (version 1.1 P, 2000, Photonics Engineering). The heated (37⬚C) microscope stage bath (volume 5 mL) was filled with Krebs solution and continuously bubbled with a gas mixture of 95% O2 and 5% CO2 to maintain a pH of 7.4. After an equilibration period of 60 min at 50 mmHg intraluminal pressure, the contractile function of the vessel was tested using a 60 mM K+ solution. After the following washout, the vessel segment was sequentially exposed to 2 M Phe and acetylcholine to certify endothelial removal. The vessel tissue was washed three times and was stimulated again with 2 M Phe. The diameter change was recorded.
2.6 Western blotting Target proteins in the thoracic aorta or mesenteric arteries were examined as previously described [18]. Briefly, proteins were extracted with detergent extraction buffer containing 1% Triton X-100, 150 mM NaCl, 50 mM Tris-HCl, 1% sodium deoxycholate, 0.1% SDS, pH 8.0, plus protease inhibitor cocktail tablets and were separated on a 10% SDS-polyacrylamide gel. The proteins on the gel were transferred onto a polyvinylidene difluoride membrane. Nonspecific binding sites were blocked with 5% nonfat milk in Tris-buffered saline solution with Tween 20 (0.1%) for 1 h at room temperature. Membranes were then incubated with antibodies against TRPP2 or -tubulin (Santa Cruz Biotechnology, Inc) overnight at 4⬚C. Immunodetection was accomplished using horseradish peroxidase-conjugated secondary antibody and an ECL detection system. The optical density of each blot was normalized to that of -tubulin and expressed as the relative optical density. C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
2.7 Immunofluorescence The freshly isolated rat thoracic aorta or mesenteric artery were embedded in tissue freezing medium (Leica) and placed in nitrogen to solidify the medium and tissue. Then, 10-mthick sections were prepared and fixed in 4% formaldehyde solution for 30 min. Following washout with PBS, the samples were permeabilized with 0.1% Triton X-100 in PBS for 30 min, and then blocked with 5% BSA in PBS for 1 h at room temperature. Subsequently, TRPP2 expression was determined by incubating the sections with anti-TRPP2 antibody (1:50, rabbit polyclonal, Santa Cruz Biotechnology, Inc.) overnight at 4⬚C. The sections were rinsed with PBS three times for 5 min and probed with goat anti-rabbit Alexa Fluor 488 (1:200, green fluorescence, Invitrogen). Images were acquired with the use of a Leica TCS SP5 confocal laser system. Negative control was performed by the omission of primary antibodies.
2.8 Statistics Collected data were expressed as the means ± SEM. The significance was analyzed using 2-tailed Student’s t-test or two-way ANOVA followed by the Bonferroni post hoc test when more than two treatments were compared. The differences between groups were considered significant for a value of p < 0.05.
3
Results
3.1 Change of systolic blood pressure The systolic blood pressure was measured every week in the regular and high-salt diet rats via the tail-cuff method. Figure 1 shows the systolic blood pressure elevated from first
Figure 1. Change in systolic blood pressure of age control (䊊) and high-salt intake (䊉) rats. Data are shown as the mean ± S.E. n = 11 rats. *p < 0.05 compared with age control (regular salt diet). www.mnf-journal.com
368
R. Zhao et al.
week, which reached a peak after 3 wks in the high-salt intake rats. In contrast, the regular diet (age control) rats did not significantly differ in their systolic blood pressures. By the fourth week, the systolic blood pressure was significantly higher in the high-salt intake rats (132 ± 3 mmHg) than in the age control rats (104 ± 2 mmHg). In all of the following experiments, the systolic blood pressure was confirmed in the hypertensive rats.
3.2 Effect of high-salt intake on Phe-induced vasocontraction To examine the change of the contractile response of the blood vessels, we utilized a vessel constrictor ␣-receptor agonist Phe. Denuded aortic rings from the age control and hypertensive rats were stimulated with incremental concentrations of Phe, from 1 nM to 10 M (Fig. 2A and B). The contractile response of the denuded thoracic aorta to Phe was significantly increased in the hypertensive rats compared to the age control rats (Fig. 2A and B), but 60 mM KCl-induced contraction was not altered (Supporting Information Fig. 1A and C). On the other hand, the weight of the aortic rings was significantly reduced in the hypertensive rats (Supporting Information Fig. 2A. For the mesenteric artery, we used a pressure myograph to measure the vessel diameter change. The contractile response of the denuded mesenteric artery to 2 M Phe was significantly elevated in the hypertensive rats compared to the age control rats (Fig. 2C and D). Similar to the thoracic aorta, no significant changes were found in the 60 mM KCl-induced contraction and the basal diameter (Supporting Information Fig. 3A, 3C, and 4A). We further compared the response to Phe in two types of vessels. The data indicate that Phe-induced vasocontraction
Mol. Nutr. Food Res. 2015, 59, 365–372
increased 42.6% (2 M Phe, n = 4) in the hypertensive mesenteric artery but increased 21.8% (10 M Phe, n = 12) in the hypertensive thoracic aorta.
3.3 Expression profile of TRPP2 in VSMCs Because Ca2+ plays a central role in the regulation of VSMCs constriction, cellular elements linked to [Ca2+ ]i mobilization may control VSMCs contraction function and vessel tone [1]. Literature shows that TRPP2 is located in the ER membrane and contributes to the [Ca2+ ]i homeostasis [6,7,10]. To clarify the mechanism for the enhanced vasoconstriction in the hypertensive rats, we examined the expression level of TRPP2 in VSMCs of the thoracic aorta and mesenteric artery from the age control and high-salt diet rats. Western blotting data show that the expression level of TRPP2 was significantly higher in the thoracic aorta and mesenteric artery from hypertensive rats than in the vessels from the age control rats (Fig. 3A and B). To confirm this finding, we further employed the immunofluorescence staining method. The result indicates that the fluorescence intensity representing TRPP2 in VSMCs of the thoracic aorta and mesenteric artery was much higher in the hypertensive rats than in the age control rats (Fig. 3C). Therefore, our data suggest that upregulated TRPP2 expression is likely one means of effecting the [Ca2+ ]i mobilization and contraction of VSMCs.
3.4 Role of TRPP2 in vasocontraction In order to investigate the functional role of TRPP2 in the Phe-induced vasocontraction, we employed the TRPP2 shRNA lentivirus to knock down the expression of the TRPP2
Figure 2. The vasocontraction of denuded thoracic aorta and mesenteric artery induced by phenylephrine (Phe) from age control or high-salt intake rats. A and B, Representative traces (A) and summarized data (B) of Phe-induced aortic ring contraction in concentration-dependent manner. C and D, Representative traces (C) and summarized data (D) of diameter change of mesenteric artery in responding to 2 M Phe. Data are shown as the mean ± SE. n = 4–12 rats. *p < 0.05 compared with age control (regular salt diet). C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.mnf-journal.com
369
Mol. Nutr. Food Res. 2015, 59, 365–372
Figure 3. The expression profile of TRPP2 in thoracic aorta and mesenteric artery. A and B, Representative images and summarized data showing the expression levels of TRPP2 in fresh isolated aorta (A) and mesenteric artery (B) from age control and high-salt intake-induced hypertensive rats. Protein expressions were normalized to -tubulin. Mean ± SE. *p < 0.05 compared with age control (regular salt diet). n = 3–4 rats. C, Representative images of TRPP2 immunofluorescence. Vessel sections were stained with anti-TRPP2 antibody. The staining for TRPP2 was shown in aorta and mesenteric artery from age control and high-salt intakeinduced hypertensive rats.
protein. We injected TRPP2 shRNA lentiviral particles into normal rats from tail veins. The Western blotting data show that TRPP2 shRNA lentivirus effectively decreased the TRPP2 expression both in the thoracic aorta and the mesenteric artery compared to the scrambled control shRNA lentivirus group (Fig. 4A and B). On the sixth day following TRPP2 or control shRNA lentivirus infection, we isolated the thoracic aorta and mesenteric artery to test Phe-induced vasocontraction. TRPP2 shRNA lentivirus significantly reduced the Pheinduced contraction in the denuded thoracic aortic ring in a dose-dependent manner (Fig. 4C and D); however, the virus infection did not affect aortic weight, and 60 mM KCl-induced contraction (Supporting Information Fig. 1B, 1D, and 2B). In addition, the Phe-induced contraction was strongly reduced as well in the denuded mesenteric artery transduced with TRPP2 shRNA lentivirus (Fig. 4E and F), but the basal diameter and 60 mM KCl-induced contractions were not altered (Supporting Information Fig. 3B, 3D, and 4B). The response to Phe in the two types of vessels was further compared. The Phe-induced vasocontraction decreased 38.7% (2 M Phe, n = 4–5) in the mesenteric artery but decreased 26.5% (10 M Phe, n = 7–11) in the thoracic aorta. These results suggest that the reduction of TRPP2 expression decreased the vasocontraction. In the other groups, we utilized thapsigargin (TG, 2 M), a pharmacological inhibitor of sarco/ER Ca2+ -ATPase [19], to pretreat the vessels for 20 min. The Phe-induced C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
vasocontraction was subsequently examined. The data indicate that TG-treatment largely inhibited the Phe-induced vasocontraction both in the denuded mesenteric artery and thoracic aorta (Fig. 4D and F). Because TG functions as a Ca2+ store depletion reagent, these results suggest that Ca2+ stores essentially participate in the Phe-induced vasocontraction. Moreover, TG-treatment abolished the difference of the Phe-induced vasocontraction between the TRPP2 and control shRNA lentivirus infected rats as well (Fig. 4D and F).
4
Discussion
In the present study, we examined the role of TRPP2 in the vascular contraction and development of salt-sensitive hypertension. The major findings include (1) consumption of the high-salt diet resulted in a significant increase in systolic blood pressure; (2) Phe-induced vasocontraction was significantly elevated in the denuded vessels in high-salt intakeinduced hypertensive rats; (3) TRPP2 protein expression was elevated in VSMCs of the hypertensive rats; (4) knockdown of TRPP2 via TRPP2 shRNA lentivirus infection reduced the Phe-induced vasocontraction in denuded vessels; and (5) TGtreatment abolished the difference of the Phe-induced vasocontraction between TRPP2 and control shRNA lentivirus infected rats. www.mnf-journal.com
370
R. Zhao et al.
Figure 4. The effect of TRPP2 shRNA on the expression of TRPP2 and vasocontraction in denuded thoracic aorta and mesenteric artery. A and B, Representative images of TRPP2 expression in thoracic aorta and mesenteric artery from control and TRPP2 shRNA lentivirus treated rats. The representative traces (C, E) and summarized data (D, F) of the effect of control and TRPP2 shRNA on phenylephrine (Phe)-induced contraction with or without thapsigargin (TG, 2 M) treatment in thoracic aorta (C, D) and mesenteric artery (E, F, 2 M Phe). Scrambled shRNA was used as control shRNA. Data are shown as the mean ± SE. n = 3–11 experiments from 3–5 rats. *p < 0.05, control shRNA lentivirus treatment group versus TRPP2 shRNA lentivirus treatment group.
The TRPP2 in VSMCs serves as a Ca2+ -release channel coupled to IP3 R to mediate Ca2+ release [6, 7, 10]. The depletion of Ca2+ stores following Ca2+ release will activate the stromal interaction molecule 1 (STIM1) [20, 21]. Through STIM1-Orai1 interaction, Orai1 will be activated to mediate the store-operated Ca2+ entry (SOCE) [22], which in turn induce a secondary increase in the [Ca2+ ]i to refill Ca2+ stores leading to sustained VSMCs contraction. In this process, Ca2+ release from the store is the primary or upstream factor in evoking SOCE. TRPP2 as the Ca2+ release channel in the ER may partially contribute to the intensity of SOCE. Because of the importance of Ca2+ in VSMCs constriction, aberrant Ca2+ handling in VSMCs may be a pivotal factor responsible for the enhanced VSMCs contraction and arterial hypertension. For example, Fernada et al. found that augmented activation of STIM1/Orai1 leads to an impaired control of intracellular Ca2+ homeostasis and vascular function in the hypertensive animal model [23]; the impairment in the function and expression of TRPV4 as a Ca2+ channel in the endothelium of the resistant arteries of high-salt diet animals contributes to the development of salt-sensitive hypertension [24, 25]. Here, C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Mol. Nutr. Food Res. 2015, 59, 365–372
our data indicate that TRPP2 protein expression was dramatically increased in the VSMCs of the thoracic aortae and mesenteric arteries in the hypertensive rats compared to the age control rats. Consistent with the protein expression level, the contractile responses to Phe in the denuded thoracic aortae and mesenteric arteries were elevated in the high-salt intake rats as well. To further uncover the role of TRRP2 in the vasocontraction, TRPP2 shRNA lentivirus was utilized as a tool to knock down TRPP2 expression in VSMCs. Interestingly, we found that TRPP2 shRNA not only effectively suppressed the TRPP2 protein expression in the VMSCs from the thoracic aorta and mesenteric artery but significantly decreased Phe-induced vasocontraction. This result is similar to Qian’s finding showing that resting [Ca2+ ]i and SOCE activity were decreased in VSMCs in Pkd2+/− mice [13, 14]. In addition, the role of TRPP2 in vasocontraction is also supported by Narayanan’s finding that the TRPP2 knockdown by TRPP2 siRNA decreased pressure-induced cerebral artery constriction [15]. Our data show that the Phe-induced vasoconstriction was significantly increased but the weight of aortic rings was notably reduced and the basal diameter of mesenteric artery had slight decrease in hypertensive rats. These results may safely exclude the possible reason that blood vessel hypertrophy increases the contraction in our hypertensive animal model. We also found that vasoconstrictor response to Phe is much higher in the mesenteric arteries than that in the aortae of hypertensive rats. These results suggest that the sensitivity of VSMCs in responding to the vessel constrictor increased in hypertensive rats and more so in resistant arteries. As the downstream of the G protein-coupled receptor, TRPP2 importantly participates in the Phe-induced vasoconstriction. The TRPP2 expression level may be consistent with the Phe effect. From Western blotting data, we find that the expression level of TRPP2 protein in mesenteric arteries is apparently higher than in the aortae. Moreover, the increment of TRPP2 protein in mesenteric arteries is more than that in the aortae in hypertensive rats (mesenteric artery, 4.4 times versus aorta, 3.7 times, Fig. 3A and B). On the other hand, the reduction of TRPP2 expression by TRPP2 shRNA decreased the Phe effect to a greater extent in the mesenteric arteries than in the aortae. Thus, these results may be one reason for much higher sensitivity of resistant arteries in responding to Phe compared to the aortae in hypertensive rats; TRPP2 may play more important role in mesenteric arteries compared to aortae, but we are unable to exclude the influence of unknown mechanisms. In addition to the ER membrane, TRPP2 was also expressed in the primary cilia and plasma membrane where it co-localizes with TRPC1, TRPV4, TRPP1, and other cilia proteins participating in mechanosensing and cilium-based Ca2+ signaling [12, 26, 27]. The recent study from Narayanan et al. suggests that TRPP2 is mainly localized in the plasma membrane of cerebral arterial VSMCs and participates in intravascular pressure-induced vasoconstriction [15]. We also designed the experiment to differentiate the functional role www.mnf-journal.com
371
Mol. Nutr. Food Res. 2015, 59, 365–372
of TRPP2 in the Phe-induced vasocontraction in two different locations. We pretreated the denuded aortic rings and mesenteric arteries with TG, which will deplete Ca2+ stores to remove TRPP2-mediated Ca2+ release but reserve the TRPP2 function in the plasma membrane. The results show that the TG-treatment significantly suppressed the Pheinduced vasocontraction and removed the difference of the Phe-induced vasocontraction between TRPP2 and control shRNA lentivirus infected rats (Fig. 4D and F). Interestingly, these findings indicate that Ca2+ stores may essentially participate in the Phe-induced vasocontraction and decreased Ca2+ store release in VSMCs may be the main reason for the reduced Phe-induced vasocontraction in the TRPP2 shRNAtransduced rats. When the Ca2+ store release was removed by the TG treatment, no significant difference in the vasocontraction between TRPP2 and control shRNA-transduced rats could be observed. Consequently, TRPP2 located in the ER membrane may be important for the agonist-induced vasocontraction, but TRPP2 located in the plasma membrane may have a weaker effect. Moreover, 60 mM KCl solution can depolarize the membrane potential of VSMCs to activate voltage-dependent Ca2+ channel and evoke vasoconstriction. Our data show that TRPP2 shRNA did not notably influence the 60 mM KCl-induced vasoconstriction (Supporting Information Figs. 1 and 3). Thus, the results demonstrate that the plasma membrane TRPP2 does not involve depolarizationinduced contraction. Compared to Narayanan’s result, our findings suggest that different locations of TRPP2 may play diverse roles in responding to different stimuli. In the present study, we demonstrated the functional activity of TRPP2 in the contraction of VSMCs and the correlation between TRPP2 expression and hypertension. Our findings highlight the fact that TRPP2 is a potential therapeutic target for the abrogation of vasoconstriction characteristics of hypertensive disease states. On the other hand, studies have also suggested that other Ca2+ channels and ion transporters such as L-type Ca2+ channels, IP3 R, TRPC1, TRPC3, TRPC6, sarco/ER Ca2+ -ATPase 2, Na+ -Ca2+ exchanger may also participate in the development of hypertension [28–34]; this tends to complicate the etiology of hypertension. These studies suggest that many components linked to Ca2+ homeostasis in VSMCs may be affected in hypertension. Therefore, TRPP2 may not be the last one added into the list. In conclusion, our study suggests that upregulated TRPP2 expression enhanced vascular contraction in high-salt intakeinduced hypertension. The present study also opens up a new avenue for developing therapeutic approaches to treat high-salt intake-induced hypertension. We thank Mr. Dake Huang for technique support in confocal microscopy. This work was supported by Grants from Natural Science Foundation of China (Grant No. 81371284, 81271217); Anhui Provincial Natural Science Foundation (Grant No. 1108085J11, 1208085MH181, 1301043020); Young Prominent Investigator Supporting Program from Anhui Medical University and National Training Program of Innovation and Entrepreneur C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
ship for Undergraduates (Grant No. 201310366013); Anhui Provincial Education Department (KJ2014A122). The authors have declared no conflict of interest.
5
References
[1] Fleckenstein-Grun, G., Calcium antagonism in vascular smooth muscle cells. Pflugers Arch. 1996, 432, R53–60. [2] Streb, H., Irvine, R. F., Berridge, M. J., Schulz, I., Release of Ca2+ from a nonmitochondrial intracellular store in pancreatic acinar cells by inositol-1,4,5-trisphosphate. Nature 1983, 306, 67–69. [3] Parekh, A. B., Putney, J. W., Jr., Store-operated calcium channels. Physiol. Rev. 2005, 85, 757–810. [4] Demoliou-Mason, C. D., G-protein-coupled receptors in vascular smooth muscle cells. Biol. Signals Recept. 1998, 7, 90– 97. [5] Hofherr, A., Kottgen, M., TRPP channels and polycystins. Adv. Exp Med. Biol. 2011, 704, 287–313. [6] Sammels, E., Devogelaere, B., Mekahli, D., Bultynck, G. et al., Polycystin-2 activation by inositol 1,4,5-trisphosphateinduced Ca2+ release requires its direct association with the inositol 1,4,5-trisphosphate receptor in a signaling microdomain. J. Biol. Chem. 2010, 285, 18794–18805. [7] Koulen, P., Cai, Y., Geng, L., Maeda, Y. et al., Polycystin-2 is an intracellular calcium release channel. Nat. Cell Biol. 2002, 4, 191–197. [8] Gao, Z., Joseph, E., Ruden, D. M., Lu, X., Drosophila Pkd2 is haploid-insufficient for mediating optimal smooth muscle contractility. J. Biol. Chem. 2004, 279, 14225–14231. [9] Anyatonwu, G. I., Estrada, M., Tian, X., Somlo, S. et al., Regulation of ryanodine receptor-dependent calcium signaling by polycystin-2. Proc. Natl. Acad. Sci. U S A 2007, 104, 6454– 6459. [10] Li, Y., Wright, J. M., Qian, F., Germino, G. G. et al., Polycystin 2 interacts with type I inositol 1,4,5-trisphosphate receptor to modulate intracellular Ca2+ signaling. J. Biol. Chem. 2005, 280, 41298–41306. [11] Beech, D. J., Emerging functions of 10 types of TRP cationic channel in vascular smooth muscle. Clin. Exp. Pharmacol. 2005, 32, 597–603. [12] Du, J., Wong, W. Y., Sun, L., Huang, Y. et al., Protein kinase G inhibits flow-induced Ca2+ entry into collecting duct cells. J. Am. Soc. Nephrol. 2012, 23, 1172–1180. [13] Kip, S. N., Hunter, L. W., Ren, Q., Harris, P. C. et al., [Ca2+]i reduction increases cellular proliferation and apoptosis in vascular smooth muscle cells: relevance to the ADPKD phenotype. Circ. Res. 2005, 96, 873–880. [14] Qian, Q., Hunter, L. W., Li, M., Marin-Padilla, M. et al., Pkd2 haploinsufficiency alters intracellular calcium regulation in vascular smooth muscle cells. Hum. Mol. Genet. 2003, 12, 1875–1880. [15] Narayanan, D., Bulley, S., Leo, M. D., Burris, S. K. et al., Smooth muscle cell transient receptor potential polycystin2 (TRPP2) channels contribute to the myogenic response in cerebral arteries. J. Physiol. 2013, 591, 5031–5046. www.mnf-journal.com
372
R. Zhao et al.
[16] AbouAlaiwi, W. A., Takahashi, M., Mell, B. R., Jones, T. J. et al., Ciliary polycystin-2 is a mechanosensitive calcium channel involved in nitric oxide signaling cascades. Circ. Res. 2009, 104, 860–869. [17] Kwan, H. Y., Shen, B., Ma, X., Kwok, Y. C. et al., TRPC1 associates with BK(Ca) channel to form a signal complex in vascular smooth muscle cells. Circ. Res. 2009, 104, 670– 678. [18] Shen, B., Zhu, J., Zhang, J., Jiang, F. et al., Attenuated mesangial cell proliferation related to store-operated Ca2+ entry in aged rat: the role of STIM 1 and Orai 1. Age (Dordr) 2013, 35, 2193–2202. [19] Bian, J. H., Ghosh, T. K., Wang, J. C., Gill, D. L., Identification of intracellular calcium pools. Selective modification by thapsigargin. J. Biol. Chem. 1991, 266, 8801–8806. [20] Soboloff, J., Rothberg, B. S., Madesh, M., Gill, D. L., STIM proteins: dynamic calcium signal transducers. Nat. Rev. Mol. Cell. Biol. 2012, 13, 549–565. [21] Zhou, Y., Srinivasan, P., Razavi, S., Seymour, S. et al., Initial activation of STIM1, the regulator of store-operated calcium entry. Nat. Struct. Mol. Biol. 2013, 20, 973–981. [22] Putney, J. W., Capacitative calcium entry: from concept to molecules. Immunol. Rev. 2009, 231, 10–22.
Mol. Nutr. Food Res. 2015, 59, 365–372
[26] Hassane, S., Claij, N., Jodar, M., Dedman, A. et al., Pkd1inactivation in vascular smooth muscle cells and adaptation to hypertension. Lab. Invest. 2011, 91, 24–32. [27] Bai, C. X., Giamarchi, A., Rodat-Despoix, L., Padilla, F. et al., Formation of a new receptor-operated channel by heteromeric assembly of TRPP2 and TRPC1 subunits. EMBO Rep. 2008, 9, 472–479. [28] Kunichika, N., Landsberg, J. W., Yu, Y., Kunichika, H. et al., Bosentan inhibits transient receptor potential channel expression in pulmonary vascular myocytes. Am. J. Respir. Crit. Care Med. 2004, 170, 1101–1107. [29] Kharade, S. V., Sonkusare, S. K., Srivastava, A. K., Thakali, K. M. et al., The beta3 subunit contributes to vascular calcium channel upregulation and hypertension in angiotensin II-infused C57BL/6 mice. Hypertension 2013, 61, 137–142. [30] Bae, Y. M., Kim, A., Lee, Y. J., Lim, W. et al., Enhancement of receptor-operated cation current and TRPC6 expression in arterial smooth muscle cells of deoxycorticosterone acetatesalt hypertensive rats. J. Hypertens. 2007, 25, 809–817. [31] Liu, D., Yang, D., He, H., Chen, X. et al., Increased transient receptor potential canonical type 3 channels in vasculature from hypertensive rats. Hypertension 2009, 53, 70–76.
[23] Giachini, F. R. C., Chiao, C. W., Carneiro, F. S., Lima, V. V. et al., Increased activation of stromal interaction molecule1/Orai-1 in aorta from hypertensive rats: a novel insight into vascular dysfunction. Hypertension 2009, 53, 409–416.
[32] Pulina, M. V., Zulian, A., Baryshnikov, S. G., Linde, C. I. et al., Cross talk between plasma membrane Na(+)/Ca (2+) exchanger-1 and TRPC/Orai-containing channels: key players in arterial hypertension. Adv. Exp. Med. Biol. 2013, 961, 365–374.
[24] Gao, F., Wang, D. H., Impairment in function and expression of transient receptor potential vanilloid type 4 in Dahl salt-sensitive rats: significance and mechanism. Hypertension 2010, 55, 1018–1025.
[33] Xia, Y., Yang, X. R., Fu, Z., Paudel, O. et al., Classical transient receptor potential 1 and 6 contribute to hypoxic pulmonary hypertension through differential regulation of pulmonary vascular functions. Hypertension 2014, 63, 173–180.
[25] Gao, F., Sui, D., Garavito, R. M., Worden, R. M. et al., Salt intake augments hypotensive effects of transient receptor potential vanilloid 4: functional significance and implication. Hypertension 2009, 53, 228–235.
[34] Linde, C. I., Karashima, E., Raina, H., Zulian, A. et al., Increased arterial smooth muscle Ca2+ signaling, vasoconstriction, and myogenic reactivity in Milan hypertensive rats. Am. J. Physiol. Heart Circ. Physiol. 2012, 302, H611–620.
C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.mnf-journal.com
365
DOI 10.1002/mnfr.201400465
RESEARCH ARTICLE
Increased TRPP2 expression in vascular smooth muscle cells from high-salt intake hypertensive rats: The crucial role in vascular dysfunction Ren Zhao1,2,3 , Muyao Zhou1 , Jie Li1 , Xia Wang1 , Kunli Su1 , Juncheng Hu1 , Yong Ye1 , Jinhang Zhu1 , Gongliang Zhang1 , Kai Wang4 , Juan Du1 , Liecheng Wang1,2∗ and Bing Shen1,5 1
Department of Physiology, Anhui Medical University, Hefei, Anhui, P. R. China Department of Pharmacology, Anhui Medical University, Hefei, Anhui, P. R. China 3 Department of Cardiology, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, P. R. China 4 Department of Neurology, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui, P. R. China 5 Central Laboratory of Molecular and Cellular Biology of Basic Medical College, Anhui Medical University, Hefei, Anhui, P. R. China 2
Scope: High-salt intake is a major risk factor in the development of hypertension. The underlying mechanism of high sodium on the cardiovascular system has received extensive attention. TRPP2 (Polycystin-2) is a Ca2+ permeable nonselective cation channel that mediates Ca2+ mobilization to control vascular smooth muscle cells (VSMCs) contraction. Here, we investigated TRPP2 expression change in VSMCs from high-salt intake hypertensive rats and role of TRPP2 in the development of high-salt diet-induced hypertension. Methods and results: After 4 ws of dietary treatment, systolic blood pressure was significantly elevated in high-salt intake rats (132 ± 3 mmHg) compared with regular diet control rats (104 ± 2 mmHg). Results from vessel tension and diameter measurements show that high-salt intake potentiated phenylephrine-induced contraction in denuded mesenteric artery and thoracic aorta. Immunoblot and immunofluorescence data indicate that TRPP2 expression in VSMCs from mesenteric artery and thoracic aorta was significantly increased in high-salt intake-induced hypertensive rats. However, agonist-induced contractions in denuded mesenteric artery and thoracic aorta were markedly decreased if TRPP2 was knocked down by specific shRNA. Conclusion: Our data demonstrate that high-salt intake increased TRPP2 expression in VSMCs, which in turn potentiated blood vessel response to contractors; this may participate in the development of hypertension.
Received: July 11, 2014 Revised: October 5, 2014 Accepted: October 22, 2014
Keywords: High-salt intake / Hypertension / TRPP2 / Vascular smooth muscle cell / Vessel tension
Additional supporting information may be found in the online version of this article at the publisher’s web-site
1 Correspondence: Dr. Bing Shen, Department of Physiology, Anhui Medical University, 81 Meishan Road, Hefei, Anhui 230032, P. R. China E-mail: [email protected] Fax: +86-0551-65161126 Abbreviations: IP3 R, inositol 1,4,5-trisphosphate receptor; Phe, phenylephrine; SERCA, sarco/ER Ca2+ -ATPase; shRNA, short hairpin RNA; SOCE, store-operated Ca2+ entry; TG, thapsigargin; TRPP2, polycystin-2; VSMC, vascular smooth muscle cell C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Introduction
Calcium ions play a central role in the control of vascular smooth muscle cells (VSMCs) contraction [1]. Cytosol Ca2+ comes from Ca2+ release mediated by inositol 1,4,5trisphosphate receptor (IP3 R) in the ER and/or Ca2+ entry through voltage-dependent or receptor-operated Ca2+ channels in the plasma membrane [1–3]. Many agonists, for ∗ Additional corresponding author: Dr. Liecheng Wang, E-mail: [email protected]
www.mnf-journal.com
366
R. Zhao et al.
example, ␣-receptor agonist phenylephrine (Phe), can induce a biphasic increase in cytosolic Ca2+ concentration ([Ca2+ ]i ) of VSMCs. The Ca2+ release first induces a transient [Ca2+ ]i rise, followed by a Ca2+ influx that prolongs the increase of [Ca2+ ]i . In the Ca2+ release phase, the agonist induces an intracellular Ca2+ increase via a G protein-coupled receptor-phospholipase C-IP3 pathway [4]. Polycystin-2 (TRPP2) is a Ca2+ -permeable cation channel belonging to the transient receptor potential channel family [5]. In the ER membrane, TRPP2 may associate with IP3 R and the ryanodine receptor to modulate [Ca2+ ]i homeostasis [6–9]. Through the interaction between IP3 R and TRPP2, IP3 R activation increases local cytosolic Ca2+ concentration, which may activate TRPP2 to evoke further Ca2+ release [6,10]. This Ca2+ release from TRPP2, thereafter, contributes to the transient [Ca2+ ]i increase as well. In the vascular system, TRPP2 has pivotal functions, including the control of VSMCs contraction and flow-induced vessel dilation [11,12]. Two studies with Pkd2+/− mice showed that the intracellular and ER Ca2+ levels were reduced, but that the contractile response to Phe was increased due to elevated expressions of smooth muscle ␣-actin and the myosin heavy chain in VSMCs [13, 14]. More recently, Narayanan et al. found that pressure-induced cerebral artery constriction was significantly decreased if TRPP2 was knocked down by TRPP2 small interfering RNA [15]. Because TRPP2 crucially participates in the handling of Ca2+ in VSMCs, we hypothesized that increased TRPP2 activity and expression may play a role in the augmented vascular contractile response to stimuli in hypertensive animals, which may lead to the development of hypertension.
2
Materials and methods
2.1 Animal preparation All animal experiments were conducted in accordance with NIH publication no. 8523 and approved by the Animal Experimentation Ethics Committee of Anhui Medical University. Animals were housed in a temperature-controlled room with a 12:12 h light-dark cycle. Male 6-wks old Sprague–Dawley rats (150–200 g) were randomized into high-salt and agematched control (regular salt diet) groups. The rats were fed diets containing 4% w/w NaCl in the high-salt group and 0.4% NaCl in the regular-salt group for 4 wks.
2.2 Lentiviral preparation TRPP2 short hairpin RNA (shRNA) sequence (AACCUGUUCUGUGUGGUCAGGUUAU (sense strand) and UUGGACAAGACACACCAGUCCAAUA (antisense strand) [16]) and scramble sequence (UAACGACGCGACGACGUAA (sense strand) and UUACGUCGUCGCGUCGUUA (antisense strand)) as a control were inserted into the pLL3.7 vector. To assemble into a viral particle, the plasmid was C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Mol. Nutr. Food Res. 2015, 59, 365–372
cotransfected into HEK293T cells with the packaging and envelope plasmids. The transfection was carried out using lipofectamine 2000. Culture media was harvested after 48 and 72 h, passed through a 0.45-m filter (Millipore) and stored at −80⬚C. Virus suspensions (108 IU particles/mL) were injected into rats through the tail vein using a 100 L/rat dosage. The rat systolic blood pressure was measured every day. In vessel tension experiments, the blood vessels were isolated on the sixth day after virus infection. To determine the efficacy of shRNA-mediated knockdown, molecular assays to quantify protein levels were performed by using immunoblot.
2.3 Noninvasive blood pressure measurement Systolic blood pressure was determined using a noninvasive measurement of tail cuff plethysmography. Briefly, conscious rats were placed in a restrainer and prewarmed chamber and were allowed to rest inside the cage for 15–20 min before the blood pressure measurement was taken. Pneumatic pulse transducers were positioned on the rat tail. A sphygmomanometer was inflated and deflated automatically. The tail cuff signals from the transducer were automatically collected and analyzed using a data acquisition and analysis system (BL-420E+, Chengdu Technology & Market Corp). The tail blood pressure of each rat was measured repeatedly for three times and the mean value of the readings was obtained.
2.4 Vessel tension measurement in organ bath Vessel tension measurements were performed as previously described [12, 17]. The rats were sacrificed via an overdose of CO2 . The thoracic aorta was removed and dissected free from the surrounding connective tissue in oxygenated icecold Krebs solution, containing (mM): NaCl 118, KCl 4.7, CaCl2 2.5, KH2 PO4 1.2, MgSO4 (7 H2 O) 1.2, NaHCO3 25.2, and glucose 11.1. The thoracic aorta was cut into 2 mm-long ring segments. The endothelial layer was removed by gently scrubbing the luminal side of the ring using a stainless steel wire. The vessel rings were mounted onto two thin stainless steel holders; one was connected to a force displacement transducer and the other was connected to a movable device that allowed the application of passive tension of 0.5 g. The mounted rings were kept in 5 mL organ baths containing Krebs solution at 37⬚C, which were continuously bubbled with a gas mixture of 95% O2 and 5% CO2 to maintain a pH of 7.4. The isometric tension was recorded and analyzed by a data acquisition and analysis system (BL-420E+, Chengdu Technology & Market Corp). After an equilibration period of 60 min, the contractile function of the vessel was tested by replacing the Krebs solution with 60 mM K+ solution that was prepared by replacing NaCl with an equimolar amount of KCl and the result was used as the reference contraction. After the washout and restoration of vessel tension to the baseline levels, the rings were exposed to 10 M Phe to test their www.mnf-journal.com
367
Mol. Nutr. Food Res. 2015, 59, 365–372
contractile responses, and subsequently challenged with acetylcholine to certify endothelial functional removal. Next, vessel tension response to Phe from 1 nM to 10 M was recorded. In the end of the experiment, blood vessel tissue was dried and weighed.
2.5 Vessel diameter measurement in pressure myograph system Vessel diameter measurements were performed according to our previous study [12]. Briefly, the mesenteric arteries were dissected and trimmed to 4 mm long segments. The endothelial layer was removed via the gentle rubbing of silk thread. The mesenteric artery segment was mounted on a pressure myograph (Danish MyoTechnology, Denmark, model 110P) with two glass micropipettes. Both cannulation pipettes were connected to independent reservoirs set at the same level, which ensured no flow through the vessel segment. Changes in the vessel diameter and pressure were tracked and measured with MyoView software (version 1.1 P, 2000, Photonics Engineering). The heated (37⬚C) microscope stage bath (volume 5 mL) was filled with Krebs solution and continuously bubbled with a gas mixture of 95% O2 and 5% CO2 to maintain a pH of 7.4. After an equilibration period of 60 min at 50 mmHg intraluminal pressure, the contractile function of the vessel was tested using a 60 mM K+ solution. After the following washout, the vessel segment was sequentially exposed to 2 M Phe and acetylcholine to certify endothelial removal. The vessel tissue was washed three times and was stimulated again with 2 M Phe. The diameter change was recorded.
2.6 Western blotting Target proteins in the thoracic aorta or mesenteric arteries were examined as previously described [18]. Briefly, proteins were extracted with detergent extraction buffer containing 1% Triton X-100, 150 mM NaCl, 50 mM Tris-HCl, 1% sodium deoxycholate, 0.1% SDS, pH 8.0, plus protease inhibitor cocktail tablets and were separated on a 10% SDS-polyacrylamide gel. The proteins on the gel were transferred onto a polyvinylidene difluoride membrane. Nonspecific binding sites were blocked with 5% nonfat milk in Tris-buffered saline solution with Tween 20 (0.1%) for 1 h at room temperature. Membranes were then incubated with antibodies against TRPP2 or -tubulin (Santa Cruz Biotechnology, Inc) overnight at 4⬚C. Immunodetection was accomplished using horseradish peroxidase-conjugated secondary antibody and an ECL detection system. The optical density of each blot was normalized to that of -tubulin and expressed as the relative optical density. C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
2.7 Immunofluorescence The freshly isolated rat thoracic aorta or mesenteric artery were embedded in tissue freezing medium (Leica) and placed in nitrogen to solidify the medium and tissue. Then, 10-mthick sections were prepared and fixed in 4% formaldehyde solution for 30 min. Following washout with PBS, the samples were permeabilized with 0.1% Triton X-100 in PBS for 30 min, and then blocked with 5% BSA in PBS for 1 h at room temperature. Subsequently, TRPP2 expression was determined by incubating the sections with anti-TRPP2 antibody (1:50, rabbit polyclonal, Santa Cruz Biotechnology, Inc.) overnight at 4⬚C. The sections were rinsed with PBS three times for 5 min and probed with goat anti-rabbit Alexa Fluor 488 (1:200, green fluorescence, Invitrogen). Images were acquired with the use of a Leica TCS SP5 confocal laser system. Negative control was performed by the omission of primary antibodies.
2.8 Statistics Collected data were expressed as the means ± SEM. The significance was analyzed using 2-tailed Student’s t-test or two-way ANOVA followed by the Bonferroni post hoc test when more than two treatments were compared. The differences between groups were considered significant for a value of p < 0.05.
3
Results
3.1 Change of systolic blood pressure The systolic blood pressure was measured every week in the regular and high-salt diet rats via the tail-cuff method. Figure 1 shows the systolic blood pressure elevated from first
Figure 1. Change in systolic blood pressure of age control (䊊) and high-salt intake (䊉) rats. Data are shown as the mean ± S.E. n = 11 rats. *p < 0.05 compared with age control (regular salt diet). www.mnf-journal.com
368
R. Zhao et al.
week, which reached a peak after 3 wks in the high-salt intake rats. In contrast, the regular diet (age control) rats did not significantly differ in their systolic blood pressures. By the fourth week, the systolic blood pressure was significantly higher in the high-salt intake rats (132 ± 3 mmHg) than in the age control rats (104 ± 2 mmHg). In all of the following experiments, the systolic blood pressure was confirmed in the hypertensive rats.
3.2 Effect of high-salt intake on Phe-induced vasocontraction To examine the change of the contractile response of the blood vessels, we utilized a vessel constrictor ␣-receptor agonist Phe. Denuded aortic rings from the age control and hypertensive rats were stimulated with incremental concentrations of Phe, from 1 nM to 10 M (Fig. 2A and B). The contractile response of the denuded thoracic aorta to Phe was significantly increased in the hypertensive rats compared to the age control rats (Fig. 2A and B), but 60 mM KCl-induced contraction was not altered (Supporting Information Fig. 1A and C). On the other hand, the weight of the aortic rings was significantly reduced in the hypertensive rats (Supporting Information Fig. 2A. For the mesenteric artery, we used a pressure myograph to measure the vessel diameter change. The contractile response of the denuded mesenteric artery to 2 M Phe was significantly elevated in the hypertensive rats compared to the age control rats (Fig. 2C and D). Similar to the thoracic aorta, no significant changes were found in the 60 mM KCl-induced contraction and the basal diameter (Supporting Information Fig. 3A, 3C, and 4A). We further compared the response to Phe in two types of vessels. The data indicate that Phe-induced vasocontraction
Mol. Nutr. Food Res. 2015, 59, 365–372
increased 42.6% (2 M Phe, n = 4) in the hypertensive mesenteric artery but increased 21.8% (10 M Phe, n = 12) in the hypertensive thoracic aorta.
3.3 Expression profile of TRPP2 in VSMCs Because Ca2+ plays a central role in the regulation of VSMCs constriction, cellular elements linked to [Ca2+ ]i mobilization may control VSMCs contraction function and vessel tone [1]. Literature shows that TRPP2 is located in the ER membrane and contributes to the [Ca2+ ]i homeostasis [6,7,10]. To clarify the mechanism for the enhanced vasoconstriction in the hypertensive rats, we examined the expression level of TRPP2 in VSMCs of the thoracic aorta and mesenteric artery from the age control and high-salt diet rats. Western blotting data show that the expression level of TRPP2 was significantly higher in the thoracic aorta and mesenteric artery from hypertensive rats than in the vessels from the age control rats (Fig. 3A and B). To confirm this finding, we further employed the immunofluorescence staining method. The result indicates that the fluorescence intensity representing TRPP2 in VSMCs of the thoracic aorta and mesenteric artery was much higher in the hypertensive rats than in the age control rats (Fig. 3C). Therefore, our data suggest that upregulated TRPP2 expression is likely one means of effecting the [Ca2+ ]i mobilization and contraction of VSMCs.
3.4 Role of TRPP2 in vasocontraction In order to investigate the functional role of TRPP2 in the Phe-induced vasocontraction, we employed the TRPP2 shRNA lentivirus to knock down the expression of the TRPP2
Figure 2. The vasocontraction of denuded thoracic aorta and mesenteric artery induced by phenylephrine (Phe) from age control or high-salt intake rats. A and B, Representative traces (A) and summarized data (B) of Phe-induced aortic ring contraction in concentration-dependent manner. C and D, Representative traces (C) and summarized data (D) of diameter change of mesenteric artery in responding to 2 M Phe. Data are shown as the mean ± SE. n = 4–12 rats. *p < 0.05 compared with age control (regular salt diet). C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.mnf-journal.com
369
Mol. Nutr. Food Res. 2015, 59, 365–372
Figure 3. The expression profile of TRPP2 in thoracic aorta and mesenteric artery. A and B, Representative images and summarized data showing the expression levels of TRPP2 in fresh isolated aorta (A) and mesenteric artery (B) from age control and high-salt intake-induced hypertensive rats. Protein expressions were normalized to -tubulin. Mean ± SE. *p < 0.05 compared with age control (regular salt diet). n = 3–4 rats. C, Representative images of TRPP2 immunofluorescence. Vessel sections were stained with anti-TRPP2 antibody. The staining for TRPP2 was shown in aorta and mesenteric artery from age control and high-salt intakeinduced hypertensive rats.
protein. We injected TRPP2 shRNA lentiviral particles into normal rats from tail veins. The Western blotting data show that TRPP2 shRNA lentivirus effectively decreased the TRPP2 expression both in the thoracic aorta and the mesenteric artery compared to the scrambled control shRNA lentivirus group (Fig. 4A and B). On the sixth day following TRPP2 or control shRNA lentivirus infection, we isolated the thoracic aorta and mesenteric artery to test Phe-induced vasocontraction. TRPP2 shRNA lentivirus significantly reduced the Pheinduced contraction in the denuded thoracic aortic ring in a dose-dependent manner (Fig. 4C and D); however, the virus infection did not affect aortic weight, and 60 mM KCl-induced contraction (Supporting Information Fig. 1B, 1D, and 2B). In addition, the Phe-induced contraction was strongly reduced as well in the denuded mesenteric artery transduced with TRPP2 shRNA lentivirus (Fig. 4E and F), but the basal diameter and 60 mM KCl-induced contractions were not altered (Supporting Information Fig. 3B, 3D, and 4B). The response to Phe in the two types of vessels was further compared. The Phe-induced vasocontraction decreased 38.7% (2 M Phe, n = 4–5) in the mesenteric artery but decreased 26.5% (10 M Phe, n = 7–11) in the thoracic aorta. These results suggest that the reduction of TRPP2 expression decreased the vasocontraction. In the other groups, we utilized thapsigargin (TG, 2 M), a pharmacological inhibitor of sarco/ER Ca2+ -ATPase [19], to pretreat the vessels for 20 min. The Phe-induced C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
vasocontraction was subsequently examined. The data indicate that TG-treatment largely inhibited the Phe-induced vasocontraction both in the denuded mesenteric artery and thoracic aorta (Fig. 4D and F). Because TG functions as a Ca2+ store depletion reagent, these results suggest that Ca2+ stores essentially participate in the Phe-induced vasocontraction. Moreover, TG-treatment abolished the difference of the Phe-induced vasocontraction between the TRPP2 and control shRNA lentivirus infected rats as well (Fig. 4D and F).
4
Discussion
In the present study, we examined the role of TRPP2 in the vascular contraction and development of salt-sensitive hypertension. The major findings include (1) consumption of the high-salt diet resulted in a significant increase in systolic blood pressure; (2) Phe-induced vasocontraction was significantly elevated in the denuded vessels in high-salt intakeinduced hypertensive rats; (3) TRPP2 protein expression was elevated in VSMCs of the hypertensive rats; (4) knockdown of TRPP2 via TRPP2 shRNA lentivirus infection reduced the Phe-induced vasocontraction in denuded vessels; and (5) TGtreatment abolished the difference of the Phe-induced vasocontraction between TRPP2 and control shRNA lentivirus infected rats. www.mnf-journal.com
370
R. Zhao et al.
Figure 4. The effect of TRPP2 shRNA on the expression of TRPP2 and vasocontraction in denuded thoracic aorta and mesenteric artery. A and B, Representative images of TRPP2 expression in thoracic aorta and mesenteric artery from control and TRPP2 shRNA lentivirus treated rats. The representative traces (C, E) and summarized data (D, F) of the effect of control and TRPP2 shRNA on phenylephrine (Phe)-induced contraction with or without thapsigargin (TG, 2 M) treatment in thoracic aorta (C, D) and mesenteric artery (E, F, 2 M Phe). Scrambled shRNA was used as control shRNA. Data are shown as the mean ± SE. n = 3–11 experiments from 3–5 rats. *p < 0.05, control shRNA lentivirus treatment group versus TRPP2 shRNA lentivirus treatment group.
The TRPP2 in VSMCs serves as a Ca2+ -release channel coupled to IP3 R to mediate Ca2+ release [6, 7, 10]. The depletion of Ca2+ stores following Ca2+ release will activate the stromal interaction molecule 1 (STIM1) [20, 21]. Through STIM1-Orai1 interaction, Orai1 will be activated to mediate the store-operated Ca2+ entry (SOCE) [22], which in turn induce a secondary increase in the [Ca2+ ]i to refill Ca2+ stores leading to sustained VSMCs contraction. In this process, Ca2+ release from the store is the primary or upstream factor in evoking SOCE. TRPP2 as the Ca2+ release channel in the ER may partially contribute to the intensity of SOCE. Because of the importance of Ca2+ in VSMCs constriction, aberrant Ca2+ handling in VSMCs may be a pivotal factor responsible for the enhanced VSMCs contraction and arterial hypertension. For example, Fernada et al. found that augmented activation of STIM1/Orai1 leads to an impaired control of intracellular Ca2+ homeostasis and vascular function in the hypertensive animal model [23]; the impairment in the function and expression of TRPV4 as a Ca2+ channel in the endothelium of the resistant arteries of high-salt diet animals contributes to the development of salt-sensitive hypertension [24, 25]. Here, C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Mol. Nutr. Food Res. 2015, 59, 365–372
our data indicate that TRPP2 protein expression was dramatically increased in the VSMCs of the thoracic aortae and mesenteric arteries in the hypertensive rats compared to the age control rats. Consistent with the protein expression level, the contractile responses to Phe in the denuded thoracic aortae and mesenteric arteries were elevated in the high-salt intake rats as well. To further uncover the role of TRRP2 in the vasocontraction, TRPP2 shRNA lentivirus was utilized as a tool to knock down TRPP2 expression in VSMCs. Interestingly, we found that TRPP2 shRNA not only effectively suppressed the TRPP2 protein expression in the VMSCs from the thoracic aorta and mesenteric artery but significantly decreased Phe-induced vasocontraction. This result is similar to Qian’s finding showing that resting [Ca2+ ]i and SOCE activity were decreased in VSMCs in Pkd2+/− mice [13, 14]. In addition, the role of TRPP2 in vasocontraction is also supported by Narayanan’s finding that the TRPP2 knockdown by TRPP2 siRNA decreased pressure-induced cerebral artery constriction [15]. Our data show that the Phe-induced vasoconstriction was significantly increased but the weight of aortic rings was notably reduced and the basal diameter of mesenteric artery had slight decrease in hypertensive rats. These results may safely exclude the possible reason that blood vessel hypertrophy increases the contraction in our hypertensive animal model. We also found that vasoconstrictor response to Phe is much higher in the mesenteric arteries than that in the aortae of hypertensive rats. These results suggest that the sensitivity of VSMCs in responding to the vessel constrictor increased in hypertensive rats and more so in resistant arteries. As the downstream of the G protein-coupled receptor, TRPP2 importantly participates in the Phe-induced vasoconstriction. The TRPP2 expression level may be consistent with the Phe effect. From Western blotting data, we find that the expression level of TRPP2 protein in mesenteric arteries is apparently higher than in the aortae. Moreover, the increment of TRPP2 protein in mesenteric arteries is more than that in the aortae in hypertensive rats (mesenteric artery, 4.4 times versus aorta, 3.7 times, Fig. 3A and B). On the other hand, the reduction of TRPP2 expression by TRPP2 shRNA decreased the Phe effect to a greater extent in the mesenteric arteries than in the aortae. Thus, these results may be one reason for much higher sensitivity of resistant arteries in responding to Phe compared to the aortae in hypertensive rats; TRPP2 may play more important role in mesenteric arteries compared to aortae, but we are unable to exclude the influence of unknown mechanisms. In addition to the ER membrane, TRPP2 was also expressed in the primary cilia and plasma membrane where it co-localizes with TRPC1, TRPV4, TRPP1, and other cilia proteins participating in mechanosensing and cilium-based Ca2+ signaling [12, 26, 27]. The recent study from Narayanan et al. suggests that TRPP2 is mainly localized in the plasma membrane of cerebral arterial VSMCs and participates in intravascular pressure-induced vasoconstriction [15]. We also designed the experiment to differentiate the functional role www.mnf-journal.com
371
Mol. Nutr. Food Res. 2015, 59, 365–372
of TRPP2 in the Phe-induced vasocontraction in two different locations. We pretreated the denuded aortic rings and mesenteric arteries with TG, which will deplete Ca2+ stores to remove TRPP2-mediated Ca2+ release but reserve the TRPP2 function in the plasma membrane. The results show that the TG-treatment significantly suppressed the Pheinduced vasocontraction and removed the difference of the Phe-induced vasocontraction between TRPP2 and control shRNA lentivirus infected rats (Fig. 4D and F). Interestingly, these findings indicate that Ca2+ stores may essentially participate in the Phe-induced vasocontraction and decreased Ca2+ store release in VSMCs may be the main reason for the reduced Phe-induced vasocontraction in the TRPP2 shRNAtransduced rats. When the Ca2+ store release was removed by the TG treatment, no significant difference in the vasocontraction between TRPP2 and control shRNA-transduced rats could be observed. Consequently, TRPP2 located in the ER membrane may be important for the agonist-induced vasocontraction, but TRPP2 located in the plasma membrane may have a weaker effect. Moreover, 60 mM KCl solution can depolarize the membrane potential of VSMCs to activate voltage-dependent Ca2+ channel and evoke vasoconstriction. Our data show that TRPP2 shRNA did not notably influence the 60 mM KCl-induced vasoconstriction (Supporting Information Figs. 1 and 3). Thus, the results demonstrate that the plasma membrane TRPP2 does not involve depolarizationinduced contraction. Compared to Narayanan’s result, our findings suggest that different locations of TRPP2 may play diverse roles in responding to different stimuli. In the present study, we demonstrated the functional activity of TRPP2 in the contraction of VSMCs and the correlation between TRPP2 expression and hypertension. Our findings highlight the fact that TRPP2 is a potential therapeutic target for the abrogation of vasoconstriction characteristics of hypertensive disease states. On the other hand, studies have also suggested that other Ca2+ channels and ion transporters such as L-type Ca2+ channels, IP3 R, TRPC1, TRPC3, TRPC6, sarco/ER Ca2+ -ATPase 2, Na+ -Ca2+ exchanger may also participate in the development of hypertension [28–34]; this tends to complicate the etiology of hypertension. These studies suggest that many components linked to Ca2+ homeostasis in VSMCs may be affected in hypertension. Therefore, TRPP2 may not be the last one added into the list. In conclusion, our study suggests that upregulated TRPP2 expression enhanced vascular contraction in high-salt intakeinduced hypertension. The present study also opens up a new avenue for developing therapeutic approaches to treat high-salt intake-induced hypertension. We thank Mr. Dake Huang for technique support in confocal microscopy. This work was supported by Grants from Natural Science Foundation of China (Grant No. 81371284, 81271217); Anhui Provincial Natural Science Foundation (Grant No. 1108085J11, 1208085MH181, 1301043020); Young Prominent Investigator Supporting Program from Anhui Medical University and National Training Program of Innovation and Entrepreneur C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
ship for Undergraduates (Grant No. 201310366013); Anhui Provincial Education Department (KJ2014A122). The authors have declared no conflict of interest.
5
References
[1] Fleckenstein-Grun, G., Calcium antagonism in vascular smooth muscle cells. Pflugers Arch. 1996, 432, R53–60. [2] Streb, H., Irvine, R. F., Berridge, M. J., Schulz, I., Release of Ca2+ from a nonmitochondrial intracellular store in pancreatic acinar cells by inositol-1,4,5-trisphosphate. Nature 1983, 306, 67–69. [3] Parekh, A. B., Putney, J. W., Jr., Store-operated calcium channels. Physiol. Rev. 2005, 85, 757–810. [4] Demoliou-Mason, C. D., G-protein-coupled receptors in vascular smooth muscle cells. Biol. Signals Recept. 1998, 7, 90– 97. [5] Hofherr, A., Kottgen, M., TRPP channels and polycystins. Adv. Exp Med. Biol. 2011, 704, 287–313. [6] Sammels, E., Devogelaere, B., Mekahli, D., Bultynck, G. et al., Polycystin-2 activation by inositol 1,4,5-trisphosphateinduced Ca2+ release requires its direct association with the inositol 1,4,5-trisphosphate receptor in a signaling microdomain. J. Biol. Chem. 2010, 285, 18794–18805. [7] Koulen, P., Cai, Y., Geng, L., Maeda, Y. et al., Polycystin-2 is an intracellular calcium release channel. Nat. Cell Biol. 2002, 4, 191–197. [8] Gao, Z., Joseph, E., Ruden, D. M., Lu, X., Drosophila Pkd2 is haploid-insufficient for mediating optimal smooth muscle contractility. J. Biol. Chem. 2004, 279, 14225–14231. [9] Anyatonwu, G. I., Estrada, M., Tian, X., Somlo, S. et al., Regulation of ryanodine receptor-dependent calcium signaling by polycystin-2. Proc. Natl. Acad. Sci. U S A 2007, 104, 6454– 6459. [10] Li, Y., Wright, J. M., Qian, F., Germino, G. G. et al., Polycystin 2 interacts with type I inositol 1,4,5-trisphosphate receptor to modulate intracellular Ca2+ signaling. J. Biol. Chem. 2005, 280, 41298–41306. [11] Beech, D. J., Emerging functions of 10 types of TRP cationic channel in vascular smooth muscle. Clin. Exp. Pharmacol. 2005, 32, 597–603. [12] Du, J., Wong, W. Y., Sun, L., Huang, Y. et al., Protein kinase G inhibits flow-induced Ca2+ entry into collecting duct cells. J. Am. Soc. Nephrol. 2012, 23, 1172–1180. [13] Kip, S. N., Hunter, L. W., Ren, Q., Harris, P. C. et al., [Ca2+]i reduction increases cellular proliferation and apoptosis in vascular smooth muscle cells: relevance to the ADPKD phenotype. Circ. Res. 2005, 96, 873–880. [14] Qian, Q., Hunter, L. W., Li, M., Marin-Padilla, M. et al., Pkd2 haploinsufficiency alters intracellular calcium regulation in vascular smooth muscle cells. Hum. Mol. Genet. 2003, 12, 1875–1880. [15] Narayanan, D., Bulley, S., Leo, M. D., Burris, S. K. et al., Smooth muscle cell transient receptor potential polycystin2 (TRPP2) channels contribute to the myogenic response in cerebral arteries. J. Physiol. 2013, 591, 5031–5046. www.mnf-journal.com
372
R. Zhao et al.
[16] AbouAlaiwi, W. A., Takahashi, M., Mell, B. R., Jones, T. J. et al., Ciliary polycystin-2 is a mechanosensitive calcium channel involved in nitric oxide signaling cascades. Circ. Res. 2009, 104, 860–869. [17] Kwan, H. Y., Shen, B., Ma, X., Kwok, Y. C. et al., TRPC1 associates with BK(Ca) channel to form a signal complex in vascular smooth muscle cells. Circ. Res. 2009, 104, 670– 678. [18] Shen, B., Zhu, J., Zhang, J., Jiang, F. et al., Attenuated mesangial cell proliferation related to store-operated Ca2+ entry in aged rat: the role of STIM 1 and Orai 1. Age (Dordr) 2013, 35, 2193–2202. [19] Bian, J. H., Ghosh, T. K., Wang, J. C., Gill, D. L., Identification of intracellular calcium pools. Selective modification by thapsigargin. J. Biol. Chem. 1991, 266, 8801–8806. [20] Soboloff, J., Rothberg, B. S., Madesh, M., Gill, D. L., STIM proteins: dynamic calcium signal transducers. Nat. Rev. Mol. Cell. Biol. 2012, 13, 549–565. [21] Zhou, Y., Srinivasan, P., Razavi, S., Seymour, S. et al., Initial activation of STIM1, the regulator of store-operated calcium entry. Nat. Struct. Mol. Biol. 2013, 20, 973–981. [22] Putney, J. W., Capacitative calcium entry: from concept to molecules. Immunol. Rev. 2009, 231, 10–22.
Mol. Nutr. Food Res. 2015, 59, 365–372
[26] Hassane, S., Claij, N., Jodar, M., Dedman, A. et al., Pkd1inactivation in vascular smooth muscle cells and adaptation to hypertension. Lab. Invest. 2011, 91, 24–32. [27] Bai, C. X., Giamarchi, A., Rodat-Despoix, L., Padilla, F. et al., Formation of a new receptor-operated channel by heteromeric assembly of TRPP2 and TRPC1 subunits. EMBO Rep. 2008, 9, 472–479. [28] Kunichika, N., Landsberg, J. W., Yu, Y., Kunichika, H. et al., Bosentan inhibits transient receptor potential channel expression in pulmonary vascular myocytes. Am. J. Respir. Crit. Care Med. 2004, 170, 1101–1107. [29] Kharade, S. V., Sonkusare, S. K., Srivastava, A. K., Thakali, K. M. et al., The beta3 subunit contributes to vascular calcium channel upregulation and hypertension in angiotensin II-infused C57BL/6 mice. Hypertension 2013, 61, 137–142. [30] Bae, Y. M., Kim, A., Lee, Y. J., Lim, W. et al., Enhancement of receptor-operated cation current and TRPC6 expression in arterial smooth muscle cells of deoxycorticosterone acetatesalt hypertensive rats. J. Hypertens. 2007, 25, 809–817. [31] Liu, D., Yang, D., He, H., Chen, X. et al., Increased transient receptor potential canonical type 3 channels in vasculature from hypertensive rats. Hypertension 2009, 53, 70–76.
[23] Giachini, F. R. C., Chiao, C. W., Carneiro, F. S., Lima, V. V. et al., Increased activation of stromal interaction molecule1/Orai-1 in aorta from hypertensive rats: a novel insight into vascular dysfunction. Hypertension 2009, 53, 409–416.
[32] Pulina, M. V., Zulian, A., Baryshnikov, S. G., Linde, C. I. et al., Cross talk between plasma membrane Na(+)/Ca (2+) exchanger-1 and TRPC/Orai-containing channels: key players in arterial hypertension. Adv. Exp. Med. Biol. 2013, 961, 365–374.
[24] Gao, F., Wang, D. H., Impairment in function and expression of transient receptor potential vanilloid type 4 in Dahl salt-sensitive rats: significance and mechanism. Hypertension 2010, 55, 1018–1025.
[33] Xia, Y., Yang, X. R., Fu, Z., Paudel, O. et al., Classical transient receptor potential 1 and 6 contribute to hypoxic pulmonary hypertension through differential regulation of pulmonary vascular functions. Hypertension 2014, 63, 173–180.
[25] Gao, F., Sui, D., Garavito, R. M., Worden, R. M. et al., Salt intake augments hypotensive effects of transient receptor potential vanilloid 4: functional significance and implication. Hypertension 2009, 53, 228–235.
[34] Linde, C. I., Karashima, E., Raina, H., Zulian, A. et al., Increased arterial smooth muscle Ca2+ signaling, vasoconstriction, and myogenic reactivity in Milan hypertensive rats. Am. J. Physiol. Heart Circ. Physiol. 2012, 302, H611–620.
C 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
www.mnf-journal.com
