Arch Gynecol Obstet (2015) 291:299–303 DOI 10.1007/s00404-014-3441-z
MATERNAL-FETAL MEDICINE
Increased mRNA levels of apolipoprotein M and apolipoprotein AI in the placental tissues with fetal macrosomia Yang Yu • Guang-hua Luo • Jun Zhang • Hua Jiang • Jiang Wei • Yuan-ping Shi • Xiao-ying Zhang • Ning Xu
Received: 17 March 2014 / Accepted: 26 August 2014 / Published online: 7 September 2014 Ó Springer-Verlag Berlin Heidelberg 2014
Abstract Purpose The present study examined mRNA levels of apolipoprotein M (apoM) and apolipoprotein AI (apoAI) in the term placental tissues obtained from 37 women with normal birth weight neonates and from 37 women with macrosomic neonates (birth body weight C4,000 g), and further discussed possible clinical significance of these observations. Methods The mRNA levels of apoM and apoAI in the placental tissues were determined by the real time RTPCR, which demonstrated that both apoM and apoAI mRNA levels were significantly higher in the placentas from macrosomia than those from normal birth. Moreover, we analyzed the overexpressions of apoM and apoAI with the clinical data. Meanwhile we examined several known risk factors of macrosomia including the mRNA levels of insulin-like growth factor I (IGF-I), IGF-II, insulin-like growth factor I receptor (IGF-IR) and IGF-IIR.
Y. Yu (&) G. Luo (&) J. Zhang J. Wei Y. Shi X. Zhang Comprehensive Laboratory, Third Affiliated Hospital, Soochow University, Jiangsu 213003, Changzhou, People’s Republic of China e-mail: [email protected] G. Luo e-mail: [email protected] H. Jiang Changzhou Women and Children Health Hospital, Changzhou 213003, China N. Xu (&) Section of Clinical Chemistry and Pharmacology, Institute of Laboratory Medicine, Lund University, 221 85 Lund, Sweden e-mail: [email protected]
Results It demonstrated that apoM expression was significantly positively correlated to the placental weight, fetal birth weight, pregestational body mass index (BMI), weight gain during pregnancy, maternal weight, maternal BMI and the mRNA levels of IGF-IR as well as IGF-IIR. The apoAI mRNA level was statistically significantly correlated to the placental weight, fetal birth weight, IGF-I and IGF-IR mRNA levels. Conclusions Binary logistic regression analysis suggested that both apoM and apoAI mRNA may considered as independent risk factors for macrosomia. The clinical significance needs further investigation. Keywords PCR
Macrosomia Placenta ApoM ApoAI
Introduction ApoM, a novel high-density lipoprotein (HDL) apolipoprotein, was initially isolated from the postprandial triglyceride-rich lipoprpteins (TGRLP) and cloned by Xu and Dahlback [1]. It is mostly expressed in the adult liver and kidney and weakly expressed in fetal liver and kidney [2]. In human, apoM has a high organ specificity during embryogenesis [3]. Wolfrum et al. [4] demonstrated that apoM, by influencing preb-HDL formation, is an important regulator of HDL metabolism, and thereby could modulate cholesterol efflux. Previous studies have demonstrated that apoM expression could be regulated by insulin and some other cytokines either in vivo or in vitro [5–8]. Furthermore, apoM could bind oxidized phospholipids, which increases the antioxidant effect of HDL [9]. ApoAI is the major structural protein of HDL and it plays an important role in the reverse cholesterol transport preventing excessive lipid accumulation.
123
300
Arch Gynecol Obstet (2015) 291:299–303
With the continual improvement of lifestyles, the average of fetal birth weight increased constantly, and the incidence of fetal macrosomia (birth weight C4,000 g) are also increased over the time. Occurrence of macrosomia has been considered not only the high risks of neonatal and maternal complications but also the health risks in their adulthood [10]. It has been demonstrated that the adolescent overweight and/or obesity was significantly correlated to the macrosomia [11]. A previous study indicated that the maternal obesity is a major risk factor for macrosomia [12] and pregnant women with overweight and/or obesity showed a relative higher serum triglyceride levels and lower high-density lipoprotein cholesterol (HDL-C) levels compared to the normal body weight pregnancy [13]. In addition, it has been reported that macrosomic newborns possess high serum HDL levels [14]. As both apoM and apoAI are the components of HDL apolipoproteins and apoAI could be expressed in the placenta [15], we hypothesized that apoM could also be expressed in the placental tissues. Moreover, we analyzed the mRNA levels of apoM and apoAI with the clinical data and other high-risk factors of fetal macrosomia for detecting whether there is correlation between them.
Methods Ethics statement The study was approved by the Human Research Ethics Committees of the Changzhou Women and Children’s Health Hospital and Third Affiliated Hospital of Soochow University. Participants provided a verbal consent to their Doctors during the physical examination. This consent was registered in the medical record of each patient. The mentioned Committees did not object the protocol since placentas we sampled are typically considered waste tissues which may find value in biomedical research. Table 1 Sequences of primers and fluorescent probes
Placental material The term placenta tissues were collected from 37 women with macrosomia (birth body weight C4,000 g) and 37 women with normal birth weight in the corresponding period were chosen as controls. They were born in Changzhou Women and Children Health Hospital from March 1 to June 30, 2008. All mothers were clinically confirmed without diabetes and other complications during the pregnancy and performed an oral glucose tolerance test (OGTT) during 24th–28th pregnant weeks with normal results. A piece of villus tissue of 1 9 1 9 1 cm size was collected from the center of placenta under aseptic condition within 5 min after the delivery of placenta. The specimen was quickly rinsed with the saline solution and the preserved in the liquid nitrogen before further examination. Total RNA extraction and real time RT-PCR Total RNA of placenta tissues were extracted using the total RNA purification kit according to the manufacture’s instructions. The concentration and purity of RNA samples were determined by spectrophotometer, and only the samples with optical density (OD) 260/280 ratios from 1.8 to 2.0 were chosen. The total RNA was reverse transcribed into cDNA using the first-stand cDNA synthetic kit according to the manufacturer’s instructions. Also, we designed primers and probes for human apoM, apoAI and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes by the Premier 5.00 (Premier Biosoft International, Palo Alto, CA, USA) (as shown in Table 1). The sequences of primers and probes for IGF-I, IGF-II, IGF-IR and IGFIIR were listed in our previously published paper [16]. Relative standard curves for all the templates were performed to compensate the efficiency of the PCR. GAPDH was used as a reference gene. Quantification of apoM and apoAI mRNA levels was relative to GAPDH mRNA levels, and was performed on a LightCycler at a final volume of 25 ll. Optimum reaction conditions were obtained with
Name
Sequence (50 –30 )
ApoM
Forward primer TGCCCCGGAAATGGATCTA Reverse primer CAGGGCGGCCTTCAGTT Probe FAM-CACCTGACTGAAGGGAGCACAGATCTCA-TAMRA
ApoAI
Forward primer CTGGGATAACCTGGAAAAGGAGAC Reverse primer GGAAGTCGTCCAGGTAGGGCT Probe FAM-AGATGAGCAAGGATCTGGAGGAGGTGAA-TAMRA
GAPDH
Forward primer GGAAGGTGAAGGTCGGAGTC Reverse primer CGTTCTCAGCCTTGACGGT Probe FAM-TTTGGTCGTATTGGGCGCCTG-TAMRA
123
Arch Gynecol Obstet (2015) 291:299–303
ApoM mRNA levels (% of Normal birth weight)
A
800
301
***
Correlation factor
ApoM
ApoAI
600
r 400
Placental weight (g)
200 0 Normal birth weight
Macrosomia
B ApoAI mRNA levels (% of Normal birth weight)
Table 2 The mRNA levels of apoM and apoAI in placenta tissues in correlation to other factors
500
*** 400 300 200
P
r
P
0.5134 \0.0001a
0.2805
0.0155c
a
0.2860
0.0135c
Fetal birth weight (g)
0.5359 \0.0001
Pre-gestational weight (kg)
0.1826
0.1274
Pre-gestational BMI
0.2639
Weight gain during pregnancy(kg)
-0.0054
0.9636
0.0262c
0.1532
0.1925
0.3186
0.0068b
0.0300
0.8007
Maternal weight (kg)
0.3160
0.0073b
0.0275
0.8159
Maternal BMI
0.3301
0.0049b
0.1262
0.2839
IGF-I
0.1805
0.1319
0.3090
0.0074b 0.4797
IGF-II
0.1851
0.1222
0.0834
IGF-IR IGF-IIR
0.3785 0.4331
0.0011b 0.0002a
0.4376 \0.0001a 0.1393 0.2365
a
P \ 0.001, bP \ 0.01, cP \ 0.05
100 0 Normal birth weight
Macrosomia
Fig. 1 The apoM (a) and apoAI (b) mRNA levels in placental tissues. The apoM and apoAI mRNA levels were determined by the real-time PT-PCR as described in the ‘‘Methods’’. The mRNA levels in the normal body weight were represented as 100 %. Data are represented as median with interquartile range. ***P \ 0.001 vs. normal birth weight
Binary logistic regression analyses were used to explore the risk factors in the development of macrosomia, and performed by SPSS statistical package (version 13.0, SPSS Inc., Chicago, IL, USA). Significance was established at a P value less than 0.05.
Results 2.5 ll of 10 9 PCR buffer, 2.5 ll of 25 mM MgCl2, 0.5 ll of 10 mM 4 9 dNTPs, 0.25 ll of 5 U/ll common Taq DNA polymerase, 0.1 ll of 100 lM specific sense primer, 0.1 ll of 100 lL specific antisense primer, 0.1 ll of 100 lM specific probe and 2 ll template cDNA. Finally 16.95 ll ddH2O was added to the reaction mixture. The thermal cycling conditions for all the genes included the following steps: the reaction mixture was preheated for 1 min at 95 °C. Subsequently, a 40-cycle two-step PCR was performed consisting of 5 s at 95 °C, 30 s at 60 °C (apoAI: 20 s at 62 °C, apoM and GAPDH: 15 s at 60 °C). Statistical analyses Data were expressed as median with interquartile range, and analyzed using Student’s t test (Graphpad Prism 5.0 software; GraphPad Software Inc., San Diego, CA, USA). The optimum threshold of apoM and apoAI mRNA levels for macrosomia was quantified using receiving operating characteristic (ROC) curve analysis, allowing us to provide the best sum of sensitivitiy and specificity. The positive and negative predictive values for macrosomia were examined for different thresholds of apoM and apoAI.
We have previously reported that maternal body weight gain during the pregnancy was obviously high in the macrosomia than in the normal birth weight and the increased of IGF-I, IGF-II, IGF-IR and IGF-IIR mRNA levels were positively associated with the macrosomia [16], which may be considered as the high-risk factors of macrosomia. In the present study, we found that placental tissues do express both apoM and apoAI and even the mRNA levels of apoM and apoAI were significantly increased in the placental tissues collected from the macrosomia than the tissues from the normal birth body weight (Fig. 1). Moreover, we statistically analysed apoM and apoAI mRNA levels in correlation to other known high-risk factors of macrosomia listed in the Table 2. It demonstrated that apoM expression was significantly positively correlated to the placental weight, fetal birth weight, pregestational BMI, maternal weight, maternal BMI and the mRNA levels of IGF-IR as well as IGF-IIR. Similarly, the apoAI mRNA level was statistically significantly correlated to the placental weight, fetal birth weight and mRNA levels of IGF-I as well as IGF-IR.
123
302
Arch Gynecol Obstet (2015) 291:299–303
Table 3 Binary logistic regression analysis of apoM and apoAI mRNA on macrosomia Risk factors
OR
95 % CI
P values
apoM
7.672
1.767–33.322
0.007a
apoAI
1.348
1.348–106.697
0.026b
Pregestational BMI
0.672
0.672–8.614
0.178
Weight gain during pregnancy
0.586
0.586–7.737
0.251
a
b
P \ 0.01, P \ 0.05
As shown in Table 3, when the pregestational BMI, weight gain during pregnancy, apoM and apoAI mRNA were introduced into the model as covariates, binary logistic regression analysis identified apoM (OR 0.007, 95 % CI 1.767–33.322) and apoAI (OR 0.026, 95 % CI 1.348–106.697) mRNA as independent factors significantly associated with macrosomia. No interaction was evidenced between the pregestational BMI and weight gain during pregnancy.
Discussion Fetal growth and development require not only nutrients, but also by the impact of placental function and related substances. During the pregnancy, the placenta is crucially important and it can produce different proteins [17] to ensure the fetal development. It has been reported that placenta could synthesize apoB [18], apoAI [15], apoL [19] and LDL-receptor [20]. It has been reported that VLDL/ ApoE receptor could play an important role in the uptake of triglyceride-rich lipoprotein particles by transporting maternal lipids across the placenta [21], and fetal macrosomia was associated with the maternal plasma levels of cholesterol and triglycerides [22]. Cholesterol is required for fetal growth, and maternal lipoproteins provide nutrients to the fetus via the placenta [23, 24]. Accordingly, expressions of apolipoproteins and LDL receptor in the placenta may also involve in the lipids and lipoproteins transfer in placenta, and further affect fetal growth. Moreover, we found that expressions of apoM and apoAI mRNA in placenta were significantly correlated to the occurrence of macrosomia. With this result, we demonstrated that apoM mRNA levels in the placenta of macrosomia appear to be increased while the pregestational BMI, maternal weight or maternal BMI is increased. It has been previously reported that the macrosomia could increase the risk of obesity in adulthood [25], which suggests that adult obesity may not only be a result of non-healthy lifestyle due to unbalanced diet and inadequate activity, but it may also be propagated and enhanced at a much earlier stage of life because of an abnormal metabolic milieu in uterus
123
during gestation [26]. It seems that vicious cycle between macrosomia and obesity might be contributed. In our previously report [16] demonstrated that IGF-IR, IGF-IIR and IGF-II mRNA levels were significantly increased in the placenta tissues with macrosomia compare to the tissues with normal birth weight, which suggests that over-expression of these genes may considered as the highrisk factors of macrosomia. Previous reports suggested that IGFs have been implicated as regulators of fetal growth [27], and regulated tissue growth and differentiation [28]. Placental IGF-II is a major modulator of placental and control the placental supply of maternal nutrients to fetal [29] and IGF-IR gene mutations could alter the function of IGF-I receptors leading to retarded intrauterine and subsequent growth of fetal [30]. In addition, our previously report that IGF-IR was a risk factor for macrosomia [16], which increased would promote fetal growth and even lead to the development of macrosomia. The majority of the physiological actions of the IGFs are believed to occur via activation of the IGF receptor [31]. Significant correlations between these high-risk factors of macrosomia and the apoM mRNA level as well as apoAI indicate that both apoM and apoAI mRNA might be mediated via the IGF receptor pathway. We hypothesize that the over-expression of apoM and apoAI would associated with the expression of IGF receptor and may affect fetal growth. In the present study, we demonstrated a significant correlation between mRNA levels of apoM and apoAI in placental tissues and the occurrence of fetal macrosomia. This is, however, not sufficient to draw the conclusion that overexpression of apoM or apoAI could be used as the predictive markers of fetal macrosomia, which needs more solid evidences. In our future studies, we will investigate protein levels of apoM and apoAI in the maternal circulation and in the placenta tissues. It will provide more useful information for predicting fetal macrosomia and for reducing the risk for birth-related problems. Conflict of interest The authors declared that we have no conflicts of interest to this work. We have had full control of all primary data and that we agree to allow the Journal to review their data if requested.
References 1. Xu N, Dahlback B (1999) A novel human apolipoprotein (apoM). J Biol Chem 274:31286–31290 2. Zhang XY, Dong X, Zheng L, Luo GH, Liu YH (2003) Specific tissue expression and cellular localization of human apolipoprotein M as determined by in situ hybridization. Acta Histochem 105:67–72 3. Zhang XY, Jiao GQ, Hurtig M, Dong X, Zheng L, Luo GH, Nilsson-Ehle P, Ye Q, Xu N (2004) Expression pattern of
Arch Gynecol Obstet (2015) 291:299–303
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
apolipoprotein M during mouse and human embryogenesis. Acta Histochem 106:123–128. doi:10.1016/j.acthis.2003.11.004 Wolfrum C, Poy MN, Stoffel M (2005) Apolipoprotein M is required for prebeta-HDL formation and cholesterol efflux to HDL and protects against atherosclerosis. Nat Med 11:418–422. doi:10.1038/nm1211 Xu N, Zhang XY, Dong X, Ekstrom U, Ye Q, Nilsson-Ehle P (2002) Effects of platelet-activating factor, tumor necrosis factor, and interleukin-1alpha on the expression of apolipoprotein M in HepG2 cells. Biochem Biophys Res Commun 292:944–950. doi:10.1006/bbrc.2002.6755 Xu N, Hurtig M, Zhang XY, Ye Q, Nilsson-Ehle P (2004) Transforming growth factor-beta down-regulates apolipoprotein M in HepG2 cells. Biochim Biophys Acta 1683:33–37. doi:10. 1016/j.bbalip.2004.04.001 Xu N, Nilsson-Ehle P, Ahren B (2006) Suppression of apolipoprotein M expression and secretion in alloxan-diabetic mouse: partial reversal by insulin. Biochem Biophys Res Commun 342:1174–1177. doi:10.1016/j.bbrc.2006.02.022 Zhang X, Zhu Z, Luo G, Zheng L, Nilsson-Ehle P, Xu N (2008) Liver X receptor agonist downregulates hepatic apoM expression in vivo and in vitro. Biochem Biophys Res Commun 371:114–117. doi:10.1016/j.bbrc.2008.04.017 Elsoe S, Ahnstrom J, Christoffersen C, Hoofnagle AN, Plomgaard P, Heinecke JW, Binder CJ, Bjorkbacka H, Dahlback B, Nielsen LB (2012) Apolipoprotein M binds oxidized phospholipids and increases the antioxidant effect of HDL. Atherosclerosis 221:91–97. doi:10.1016/j.atherosclerosis.2011.11.031 Lu Y, Zhang J, Lu X, Xi W, Li Z (2011) Secular trends of macrosomia in southeast China, 1994–2005. BMC Public Health 11:818. doi:10.1186/1471-2458-11-818 LA Seidman DS, Stevenson DK, Sivan E, Gale R, Shemer J (1998) Macrosomia does not predict overweight in late adolescence in infants of diabetic mothers. Acta Obstetricia et Gynecol Scandinavica 77:58–62 Thornburg LL (2011) Antepartum obstetrical complications associated with obesity. Semin Perinatol 35:317–323. doi:10. 1053/j.semperi.2011.05.015 Dujovne CA, Zavoral JH, Rowe E, Mendel CM (2001) Effects of sibutramine on body weight and serum lipids: a double-blind, randomized, placebo-controlled study in 322 overweight and obese patients with dyslipidemia. Am Heart J 142:489–497. doi:10.1067/mhj.2001.117510 Merzouk H, Khan NA (2003) Implication of lipids in macrosomia of diabetic pregnancy: can n-3 polyunsaturated fatty acids exert beneficial effects? Clin Sci (Lond) 105:519–529. doi:10.1042/ CS20030143 Richardson B, Palgunachari MN, Anantharamaiah GM, Richards RG, Azrolan N, Wiginton D, Handwerger S (1996) Human placental tissue expresses a novel 22.7 kDa apolipoprotein A-I-like protein. Biochemistry 35:7580–7585. doi:10.1021/bi9526950 Jiang H, Xun P, Luo G, Wang Q, Cai Y, Zhang Y, Yu B (2009) Levels of insulin-like growth factors and their receptors in placenta in relation to macrosomia. Asia Pac J Clin Nutr 18:171–178 Gharesi-Fard B, Zolghadri J, Kamali-Sarvestani E (2010) Proteome differences of placenta between pre-eclampsia and normal pregnancy. Placenta 31:121–125. doi:10.1016/j.placenta.2009.11. 004 Madsen EM, Lindegaard ML, Andersen CB, Damm P, Nielsen LB (2004) Human placenta secretes apolipoprotein B-100-
303
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
containing lipoproteins. J Biol Chem 279:55271–55276. doi:10. 1074/jbc.M411404200 Page NM, Butlin DJ, Lomthaisong K, Lowry PJ (2001) The human apolipoprotein L gene cluster: identification, classification, and sites of distribution. Genomics 74:71–78. doi:10.1006/ geno.2001.6534 Wittmaack FM, Gafvels ME, Bronner M, Matsuo H, McCrae KR, Tomaszewski JE, Robinson SL, Strickland DK, Strauss JF 3rd (1995) Localization and regulation of the human very low density lipoprotein/apolipoprotein-E receptor: trophoblast expression predicts a role for the receptor in placental lipid transport. Endocrinology 136:340–348. doi:10.1210/endo.136.1.7828550 Gafvels ME, Caird M, Britt D, Jackson CL, Patterson D, Strauss JF 3rd (1993) Cloning of a cDNA encoding a putative human very low density lipoprotein/apolipoprotein E receptor and assignment of the gene to chromosome 9pter-p23. Somat Cell Mol Genet 19:557–569 Grissa O, Ategbo JM, Yessoufou A, Tabka Z, Miled A, Jerbi M, Dramane KL, Moutairou K, Prost J, Hichami A, Khan NA (2007) Antioxidant status and circulating lipids are altered in human gestational diabetes and macrosomia. Transl Res 150:164–171. doi:10.1016/j.trsl.2007.03.007 Woollett LA (2005) Maternal cholesterol in fetal development: transport of cholesterol from the maternal to the fetal circulation. Am J Clin Nutr 82:1155–1161 Wyne KL, Woollett LA (1998) Transport of maternal LDL and HDL to the fetal membranes and placenta of the Golden Syrian hamster is mediated by receptor-dependent and receptor-independent processes. J Lipid Res 39:518–530 Dabelea D, Pettitt DJ, Hanson RL, Imperatore G, Bennett PH, Knowler WC (1999) Birth weight, type 2 diabetes, and insulin resistance in Pima Indian children and young adults. Diabetes Care 22:944–950 Catalano PM (2003) Obesity and pregnancy–the propagation of a viscous cycle? J Clin Endocrinol Metab 88:3505–3506. doi:10. 1210/jc.2003-031046 Hill WC, Pelle-Day G, Kitzmiller JL, Spencer EM (1989) Insulin-like growth factors in fetal macrosomia with and without maternal diabetes. Horm Res 32:178–182 Han VK, Matsell DG, Delhanty PJ, Hill DJ, Shimasaki S, Nygard K (1996) IGF-binding protein mRNAs in the human fetus: tissue and cellular distribution of developmental expression. Horm Res 45:160–166 Constancia M, Hemberger M, Hughes J, Dean W, FergusonSmith A, Fundele R, Stewart F, Kelsey G, Fowden A, Sibley C, Reik W (2002) Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature 417:945–948. doi:10.1038/ nature00819 Abuzzahab MJ, Schneider A, Goddard A, Grigorescu F, Lautier C, Keller E, Kiess W, Klammt J, Kratzsch J, Osgood D, Pfaffle R, Raile K, Seidel B, Smith RJ, Chernausek SD (2003) IGF-I receptor mutations resulting in intrauterine and postnatal growth retardation. N Engl J Med 349:2211–2222. doi:10.1056/ NEJMoa010107 LeRoith D, Werner H, Beitner-Johnson D, Roberts CT Jr (1995) Molecular and cellular aspects of the insulin-like growth factor I receptor. Endocr Rev 16:143–163. doi:10.1210/edrv-16-2-143
123
MATERNAL-FETAL MEDICINE
Increased mRNA levels of apolipoprotein M and apolipoprotein AI in the placental tissues with fetal macrosomia Yang Yu • Guang-hua Luo • Jun Zhang • Hua Jiang • Jiang Wei • Yuan-ping Shi • Xiao-ying Zhang • Ning Xu
Received: 17 March 2014 / Accepted: 26 August 2014 / Published online: 7 September 2014 Ó Springer-Verlag Berlin Heidelberg 2014
Abstract Purpose The present study examined mRNA levels of apolipoprotein M (apoM) and apolipoprotein AI (apoAI) in the term placental tissues obtained from 37 women with normal birth weight neonates and from 37 women with macrosomic neonates (birth body weight C4,000 g), and further discussed possible clinical significance of these observations. Methods The mRNA levels of apoM and apoAI in the placental tissues were determined by the real time RTPCR, which demonstrated that both apoM and apoAI mRNA levels were significantly higher in the placentas from macrosomia than those from normal birth. Moreover, we analyzed the overexpressions of apoM and apoAI with the clinical data. Meanwhile we examined several known risk factors of macrosomia including the mRNA levels of insulin-like growth factor I (IGF-I), IGF-II, insulin-like growth factor I receptor (IGF-IR) and IGF-IIR.
Y. Yu (&) G. Luo (&) J. Zhang J. Wei Y. Shi X. Zhang Comprehensive Laboratory, Third Affiliated Hospital, Soochow University, Jiangsu 213003, Changzhou, People’s Republic of China e-mail: [email protected] G. Luo e-mail: [email protected] H. Jiang Changzhou Women and Children Health Hospital, Changzhou 213003, China N. Xu (&) Section of Clinical Chemistry and Pharmacology, Institute of Laboratory Medicine, Lund University, 221 85 Lund, Sweden e-mail: [email protected]
Results It demonstrated that apoM expression was significantly positively correlated to the placental weight, fetal birth weight, pregestational body mass index (BMI), weight gain during pregnancy, maternal weight, maternal BMI and the mRNA levels of IGF-IR as well as IGF-IIR. The apoAI mRNA level was statistically significantly correlated to the placental weight, fetal birth weight, IGF-I and IGF-IR mRNA levels. Conclusions Binary logistic regression analysis suggested that both apoM and apoAI mRNA may considered as independent risk factors for macrosomia. The clinical significance needs further investigation. Keywords PCR
Macrosomia Placenta ApoM ApoAI
Introduction ApoM, a novel high-density lipoprotein (HDL) apolipoprotein, was initially isolated from the postprandial triglyceride-rich lipoprpteins (TGRLP) and cloned by Xu and Dahlback [1]. It is mostly expressed in the adult liver and kidney and weakly expressed in fetal liver and kidney [2]. In human, apoM has a high organ specificity during embryogenesis [3]. Wolfrum et al. [4] demonstrated that apoM, by influencing preb-HDL formation, is an important regulator of HDL metabolism, and thereby could modulate cholesterol efflux. Previous studies have demonstrated that apoM expression could be regulated by insulin and some other cytokines either in vivo or in vitro [5–8]. Furthermore, apoM could bind oxidized phospholipids, which increases the antioxidant effect of HDL [9]. ApoAI is the major structural protein of HDL and it plays an important role in the reverse cholesterol transport preventing excessive lipid accumulation.
123
300
Arch Gynecol Obstet (2015) 291:299–303
With the continual improvement of lifestyles, the average of fetal birth weight increased constantly, and the incidence of fetal macrosomia (birth weight C4,000 g) are also increased over the time. Occurrence of macrosomia has been considered not only the high risks of neonatal and maternal complications but also the health risks in their adulthood [10]. It has been demonstrated that the adolescent overweight and/or obesity was significantly correlated to the macrosomia [11]. A previous study indicated that the maternal obesity is a major risk factor for macrosomia [12] and pregnant women with overweight and/or obesity showed a relative higher serum triglyceride levels and lower high-density lipoprotein cholesterol (HDL-C) levels compared to the normal body weight pregnancy [13]. In addition, it has been reported that macrosomic newborns possess high serum HDL levels [14]. As both apoM and apoAI are the components of HDL apolipoproteins and apoAI could be expressed in the placenta [15], we hypothesized that apoM could also be expressed in the placental tissues. Moreover, we analyzed the mRNA levels of apoM and apoAI with the clinical data and other high-risk factors of fetal macrosomia for detecting whether there is correlation between them.
Methods Ethics statement The study was approved by the Human Research Ethics Committees of the Changzhou Women and Children’s Health Hospital and Third Affiliated Hospital of Soochow University. Participants provided a verbal consent to their Doctors during the physical examination. This consent was registered in the medical record of each patient. The mentioned Committees did not object the protocol since placentas we sampled are typically considered waste tissues which may find value in biomedical research. Table 1 Sequences of primers and fluorescent probes
Placental material The term placenta tissues were collected from 37 women with macrosomia (birth body weight C4,000 g) and 37 women with normal birth weight in the corresponding period were chosen as controls. They were born in Changzhou Women and Children Health Hospital from March 1 to June 30, 2008. All mothers were clinically confirmed without diabetes and other complications during the pregnancy and performed an oral glucose tolerance test (OGTT) during 24th–28th pregnant weeks with normal results. A piece of villus tissue of 1 9 1 9 1 cm size was collected from the center of placenta under aseptic condition within 5 min after the delivery of placenta. The specimen was quickly rinsed with the saline solution and the preserved in the liquid nitrogen before further examination. Total RNA extraction and real time RT-PCR Total RNA of placenta tissues were extracted using the total RNA purification kit according to the manufacture’s instructions. The concentration and purity of RNA samples were determined by spectrophotometer, and only the samples with optical density (OD) 260/280 ratios from 1.8 to 2.0 were chosen. The total RNA was reverse transcribed into cDNA using the first-stand cDNA synthetic kit according to the manufacturer’s instructions. Also, we designed primers and probes for human apoM, apoAI and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) genes by the Premier 5.00 (Premier Biosoft International, Palo Alto, CA, USA) (as shown in Table 1). The sequences of primers and probes for IGF-I, IGF-II, IGF-IR and IGFIIR were listed in our previously published paper [16]. Relative standard curves for all the templates were performed to compensate the efficiency of the PCR. GAPDH was used as a reference gene. Quantification of apoM and apoAI mRNA levels was relative to GAPDH mRNA levels, and was performed on a LightCycler at a final volume of 25 ll. Optimum reaction conditions were obtained with
Name
Sequence (50 –30 )
ApoM
Forward primer TGCCCCGGAAATGGATCTA Reverse primer CAGGGCGGCCTTCAGTT Probe FAM-CACCTGACTGAAGGGAGCACAGATCTCA-TAMRA
ApoAI
Forward primer CTGGGATAACCTGGAAAAGGAGAC Reverse primer GGAAGTCGTCCAGGTAGGGCT Probe FAM-AGATGAGCAAGGATCTGGAGGAGGTGAA-TAMRA
GAPDH
Forward primer GGAAGGTGAAGGTCGGAGTC Reverse primer CGTTCTCAGCCTTGACGGT Probe FAM-TTTGGTCGTATTGGGCGCCTG-TAMRA
123
Arch Gynecol Obstet (2015) 291:299–303
ApoM mRNA levels (% of Normal birth weight)
A
800
301
***
Correlation factor
ApoM
ApoAI
600
r 400
Placental weight (g)
200 0 Normal birth weight
Macrosomia
B ApoAI mRNA levels (% of Normal birth weight)
Table 2 The mRNA levels of apoM and apoAI in placenta tissues in correlation to other factors
500
*** 400 300 200
P
r
P
0.5134 \0.0001a
0.2805
0.0155c
a
0.2860
0.0135c
Fetal birth weight (g)
0.5359 \0.0001
Pre-gestational weight (kg)
0.1826
0.1274
Pre-gestational BMI
0.2639
Weight gain during pregnancy(kg)
-0.0054
0.9636
0.0262c
0.1532
0.1925
0.3186
0.0068b
0.0300
0.8007
Maternal weight (kg)
0.3160
0.0073b
0.0275
0.8159
Maternal BMI
0.3301
0.0049b
0.1262
0.2839
IGF-I
0.1805
0.1319
0.3090
0.0074b 0.4797
IGF-II
0.1851
0.1222
0.0834
IGF-IR IGF-IIR
0.3785 0.4331
0.0011b 0.0002a
0.4376 \0.0001a 0.1393 0.2365
a
P \ 0.001, bP \ 0.01, cP \ 0.05
100 0 Normal birth weight
Macrosomia
Fig. 1 The apoM (a) and apoAI (b) mRNA levels in placental tissues. The apoM and apoAI mRNA levels were determined by the real-time PT-PCR as described in the ‘‘Methods’’. The mRNA levels in the normal body weight were represented as 100 %. Data are represented as median with interquartile range. ***P \ 0.001 vs. normal birth weight
Binary logistic regression analyses were used to explore the risk factors in the development of macrosomia, and performed by SPSS statistical package (version 13.0, SPSS Inc., Chicago, IL, USA). Significance was established at a P value less than 0.05.
Results 2.5 ll of 10 9 PCR buffer, 2.5 ll of 25 mM MgCl2, 0.5 ll of 10 mM 4 9 dNTPs, 0.25 ll of 5 U/ll common Taq DNA polymerase, 0.1 ll of 100 lM specific sense primer, 0.1 ll of 100 lL specific antisense primer, 0.1 ll of 100 lM specific probe and 2 ll template cDNA. Finally 16.95 ll ddH2O was added to the reaction mixture. The thermal cycling conditions for all the genes included the following steps: the reaction mixture was preheated for 1 min at 95 °C. Subsequently, a 40-cycle two-step PCR was performed consisting of 5 s at 95 °C, 30 s at 60 °C (apoAI: 20 s at 62 °C, apoM and GAPDH: 15 s at 60 °C). Statistical analyses Data were expressed as median with interquartile range, and analyzed using Student’s t test (Graphpad Prism 5.0 software; GraphPad Software Inc., San Diego, CA, USA). The optimum threshold of apoM and apoAI mRNA levels for macrosomia was quantified using receiving operating characteristic (ROC) curve analysis, allowing us to provide the best sum of sensitivitiy and specificity. The positive and negative predictive values for macrosomia were examined for different thresholds of apoM and apoAI.
We have previously reported that maternal body weight gain during the pregnancy was obviously high in the macrosomia than in the normal birth weight and the increased of IGF-I, IGF-II, IGF-IR and IGF-IIR mRNA levels were positively associated with the macrosomia [16], which may be considered as the high-risk factors of macrosomia. In the present study, we found that placental tissues do express both apoM and apoAI and even the mRNA levels of apoM and apoAI were significantly increased in the placental tissues collected from the macrosomia than the tissues from the normal birth body weight (Fig. 1). Moreover, we statistically analysed apoM and apoAI mRNA levels in correlation to other known high-risk factors of macrosomia listed in the Table 2. It demonstrated that apoM expression was significantly positively correlated to the placental weight, fetal birth weight, pregestational BMI, maternal weight, maternal BMI and the mRNA levels of IGF-IR as well as IGF-IIR. Similarly, the apoAI mRNA level was statistically significantly correlated to the placental weight, fetal birth weight and mRNA levels of IGF-I as well as IGF-IR.
123
302
Arch Gynecol Obstet (2015) 291:299–303
Table 3 Binary logistic regression analysis of apoM and apoAI mRNA on macrosomia Risk factors
OR
95 % CI
P values
apoM
7.672
1.767–33.322
0.007a
apoAI
1.348
1.348–106.697
0.026b
Pregestational BMI
0.672
0.672–8.614
0.178
Weight gain during pregnancy
0.586
0.586–7.737
0.251
a
b
P \ 0.01, P \ 0.05
As shown in Table 3, when the pregestational BMI, weight gain during pregnancy, apoM and apoAI mRNA were introduced into the model as covariates, binary logistic regression analysis identified apoM (OR 0.007, 95 % CI 1.767–33.322) and apoAI (OR 0.026, 95 % CI 1.348–106.697) mRNA as independent factors significantly associated with macrosomia. No interaction was evidenced between the pregestational BMI and weight gain during pregnancy.
Discussion Fetal growth and development require not only nutrients, but also by the impact of placental function and related substances. During the pregnancy, the placenta is crucially important and it can produce different proteins [17] to ensure the fetal development. It has been reported that placenta could synthesize apoB [18], apoAI [15], apoL [19] and LDL-receptor [20]. It has been reported that VLDL/ ApoE receptor could play an important role in the uptake of triglyceride-rich lipoprotein particles by transporting maternal lipids across the placenta [21], and fetal macrosomia was associated with the maternal plasma levels of cholesterol and triglycerides [22]. Cholesterol is required for fetal growth, and maternal lipoproteins provide nutrients to the fetus via the placenta [23, 24]. Accordingly, expressions of apolipoproteins and LDL receptor in the placenta may also involve in the lipids and lipoproteins transfer in placenta, and further affect fetal growth. Moreover, we found that expressions of apoM and apoAI mRNA in placenta were significantly correlated to the occurrence of macrosomia. With this result, we demonstrated that apoM mRNA levels in the placenta of macrosomia appear to be increased while the pregestational BMI, maternal weight or maternal BMI is increased. It has been previously reported that the macrosomia could increase the risk of obesity in adulthood [25], which suggests that adult obesity may not only be a result of non-healthy lifestyle due to unbalanced diet and inadequate activity, but it may also be propagated and enhanced at a much earlier stage of life because of an abnormal metabolic milieu in uterus
123
during gestation [26]. It seems that vicious cycle between macrosomia and obesity might be contributed. In our previously report [16] demonstrated that IGF-IR, IGF-IIR and IGF-II mRNA levels were significantly increased in the placenta tissues with macrosomia compare to the tissues with normal birth weight, which suggests that over-expression of these genes may considered as the highrisk factors of macrosomia. Previous reports suggested that IGFs have been implicated as regulators of fetal growth [27], and regulated tissue growth and differentiation [28]. Placental IGF-II is a major modulator of placental and control the placental supply of maternal nutrients to fetal [29] and IGF-IR gene mutations could alter the function of IGF-I receptors leading to retarded intrauterine and subsequent growth of fetal [30]. In addition, our previously report that IGF-IR was a risk factor for macrosomia [16], which increased would promote fetal growth and even lead to the development of macrosomia. The majority of the physiological actions of the IGFs are believed to occur via activation of the IGF receptor [31]. Significant correlations between these high-risk factors of macrosomia and the apoM mRNA level as well as apoAI indicate that both apoM and apoAI mRNA might be mediated via the IGF receptor pathway. We hypothesize that the over-expression of apoM and apoAI would associated with the expression of IGF receptor and may affect fetal growth. In the present study, we demonstrated a significant correlation between mRNA levels of apoM and apoAI in placental tissues and the occurrence of fetal macrosomia. This is, however, not sufficient to draw the conclusion that overexpression of apoM or apoAI could be used as the predictive markers of fetal macrosomia, which needs more solid evidences. In our future studies, we will investigate protein levels of apoM and apoAI in the maternal circulation and in the placenta tissues. It will provide more useful information for predicting fetal macrosomia and for reducing the risk for birth-related problems. Conflict of interest The authors declared that we have no conflicts of interest to this work. We have had full control of all primary data and that we agree to allow the Journal to review their data if requested.
References 1. Xu N, Dahlback B (1999) A novel human apolipoprotein (apoM). J Biol Chem 274:31286–31290 2. Zhang XY, Dong X, Zheng L, Luo GH, Liu YH (2003) Specific tissue expression and cellular localization of human apolipoprotein M as determined by in situ hybridization. Acta Histochem 105:67–72 3. Zhang XY, Jiao GQ, Hurtig M, Dong X, Zheng L, Luo GH, Nilsson-Ehle P, Ye Q, Xu N (2004) Expression pattern of
Arch Gynecol Obstet (2015) 291:299–303
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
apolipoprotein M during mouse and human embryogenesis. Acta Histochem 106:123–128. doi:10.1016/j.acthis.2003.11.004 Wolfrum C, Poy MN, Stoffel M (2005) Apolipoprotein M is required for prebeta-HDL formation and cholesterol efflux to HDL and protects against atherosclerosis. Nat Med 11:418–422. doi:10.1038/nm1211 Xu N, Zhang XY, Dong X, Ekstrom U, Ye Q, Nilsson-Ehle P (2002) Effects of platelet-activating factor, tumor necrosis factor, and interleukin-1alpha on the expression of apolipoprotein M in HepG2 cells. Biochem Biophys Res Commun 292:944–950. doi:10.1006/bbrc.2002.6755 Xu N, Hurtig M, Zhang XY, Ye Q, Nilsson-Ehle P (2004) Transforming growth factor-beta down-regulates apolipoprotein M in HepG2 cells. Biochim Biophys Acta 1683:33–37. doi:10. 1016/j.bbalip.2004.04.001 Xu N, Nilsson-Ehle P, Ahren B (2006) Suppression of apolipoprotein M expression and secretion in alloxan-diabetic mouse: partial reversal by insulin. Biochem Biophys Res Commun 342:1174–1177. doi:10.1016/j.bbrc.2006.02.022 Zhang X, Zhu Z, Luo G, Zheng L, Nilsson-Ehle P, Xu N (2008) Liver X receptor agonist downregulates hepatic apoM expression in vivo and in vitro. Biochem Biophys Res Commun 371:114–117. doi:10.1016/j.bbrc.2008.04.017 Elsoe S, Ahnstrom J, Christoffersen C, Hoofnagle AN, Plomgaard P, Heinecke JW, Binder CJ, Bjorkbacka H, Dahlback B, Nielsen LB (2012) Apolipoprotein M binds oxidized phospholipids and increases the antioxidant effect of HDL. Atherosclerosis 221:91–97. doi:10.1016/j.atherosclerosis.2011.11.031 Lu Y, Zhang J, Lu X, Xi W, Li Z (2011) Secular trends of macrosomia in southeast China, 1994–2005. BMC Public Health 11:818. doi:10.1186/1471-2458-11-818 LA Seidman DS, Stevenson DK, Sivan E, Gale R, Shemer J (1998) Macrosomia does not predict overweight in late adolescence in infants of diabetic mothers. Acta Obstetricia et Gynecol Scandinavica 77:58–62 Thornburg LL (2011) Antepartum obstetrical complications associated with obesity. Semin Perinatol 35:317–323. doi:10. 1053/j.semperi.2011.05.015 Dujovne CA, Zavoral JH, Rowe E, Mendel CM (2001) Effects of sibutramine on body weight and serum lipids: a double-blind, randomized, placebo-controlled study in 322 overweight and obese patients with dyslipidemia. Am Heart J 142:489–497. doi:10.1067/mhj.2001.117510 Merzouk H, Khan NA (2003) Implication of lipids in macrosomia of diabetic pregnancy: can n-3 polyunsaturated fatty acids exert beneficial effects? Clin Sci (Lond) 105:519–529. doi:10.1042/ CS20030143 Richardson B, Palgunachari MN, Anantharamaiah GM, Richards RG, Azrolan N, Wiginton D, Handwerger S (1996) Human placental tissue expresses a novel 22.7 kDa apolipoprotein A-I-like protein. Biochemistry 35:7580–7585. doi:10.1021/bi9526950 Jiang H, Xun P, Luo G, Wang Q, Cai Y, Zhang Y, Yu B (2009) Levels of insulin-like growth factors and their receptors in placenta in relation to macrosomia. Asia Pac J Clin Nutr 18:171–178 Gharesi-Fard B, Zolghadri J, Kamali-Sarvestani E (2010) Proteome differences of placenta between pre-eclampsia and normal pregnancy. Placenta 31:121–125. doi:10.1016/j.placenta.2009.11. 004 Madsen EM, Lindegaard ML, Andersen CB, Damm P, Nielsen LB (2004) Human placenta secretes apolipoprotein B-100-
303
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
containing lipoproteins. J Biol Chem 279:55271–55276. doi:10. 1074/jbc.M411404200 Page NM, Butlin DJ, Lomthaisong K, Lowry PJ (2001) The human apolipoprotein L gene cluster: identification, classification, and sites of distribution. Genomics 74:71–78. doi:10.1006/ geno.2001.6534 Wittmaack FM, Gafvels ME, Bronner M, Matsuo H, McCrae KR, Tomaszewski JE, Robinson SL, Strickland DK, Strauss JF 3rd (1995) Localization and regulation of the human very low density lipoprotein/apolipoprotein-E receptor: trophoblast expression predicts a role for the receptor in placental lipid transport. Endocrinology 136:340–348. doi:10.1210/endo.136.1.7828550 Gafvels ME, Caird M, Britt D, Jackson CL, Patterson D, Strauss JF 3rd (1993) Cloning of a cDNA encoding a putative human very low density lipoprotein/apolipoprotein E receptor and assignment of the gene to chromosome 9pter-p23. Somat Cell Mol Genet 19:557–569 Grissa O, Ategbo JM, Yessoufou A, Tabka Z, Miled A, Jerbi M, Dramane KL, Moutairou K, Prost J, Hichami A, Khan NA (2007) Antioxidant status and circulating lipids are altered in human gestational diabetes and macrosomia. Transl Res 150:164–171. doi:10.1016/j.trsl.2007.03.007 Woollett LA (2005) Maternal cholesterol in fetal development: transport of cholesterol from the maternal to the fetal circulation. Am J Clin Nutr 82:1155–1161 Wyne KL, Woollett LA (1998) Transport of maternal LDL and HDL to the fetal membranes and placenta of the Golden Syrian hamster is mediated by receptor-dependent and receptor-independent processes. J Lipid Res 39:518–530 Dabelea D, Pettitt DJ, Hanson RL, Imperatore G, Bennett PH, Knowler WC (1999) Birth weight, type 2 diabetes, and insulin resistance in Pima Indian children and young adults. Diabetes Care 22:944–950 Catalano PM (2003) Obesity and pregnancy–the propagation of a viscous cycle? J Clin Endocrinol Metab 88:3505–3506. doi:10. 1210/jc.2003-031046 Hill WC, Pelle-Day G, Kitzmiller JL, Spencer EM (1989) Insulin-like growth factors in fetal macrosomia with and without maternal diabetes. Horm Res 32:178–182 Han VK, Matsell DG, Delhanty PJ, Hill DJ, Shimasaki S, Nygard K (1996) IGF-binding protein mRNAs in the human fetus: tissue and cellular distribution of developmental expression. Horm Res 45:160–166 Constancia M, Hemberger M, Hughes J, Dean W, FergusonSmith A, Fundele R, Stewart F, Kelsey G, Fowden A, Sibley C, Reik W (2002) Placental-specific IGF-II is a major modulator of placental and fetal growth. Nature 417:945–948. doi:10.1038/ nature00819 Abuzzahab MJ, Schneider A, Goddard A, Grigorescu F, Lautier C, Keller E, Kiess W, Klammt J, Kratzsch J, Osgood D, Pfaffle R, Raile K, Seidel B, Smith RJ, Chernausek SD (2003) IGF-I receptor mutations resulting in intrauterine and postnatal growth retardation. N Engl J Med 349:2211–2222. doi:10.1056/ NEJMoa010107 LeRoith D, Werner H, Beitner-Johnson D, Roberts CT Jr (1995) Molecular and cellular aspects of the insulin-like growth factor I receptor. Endocr Rev 16:143–163. doi:10.1210/edrv-16-2-143
123
