Epilepsy Research (2014) 108, 144—148
journal homepage: www.elsevier.com/locate/epilepsyres
SHORT COMMUNICATION
Increased CPA6 promoter methylation in focal epilepsy and in febrile seizures N. Belhedi a,b, N. Perroud c, F. Karege d, M. Vessaz e, A. Malafosse c,e, A. Salzmann c,∗ a
Laboratory of Genetic, Immunology and Human Pathologies, Department of Biology, Faculty of Sciences, Tunis, Tunisia b Neurological Department, Charles Nicolle Hospital, Tunis, Tunisia c Department of Psychiatry, University of Geneva, Geneva, Switzerland d Department of Biology, National University of Rwanda, Rwanda e Department of Genetic Medicine and Laboratory, University Hospitals of Geneva, Geneva, Switzerland Received 19 March 2013 ; received in revised form 13 September 2013; accepted 13 October 2013 Available online 24 October 2013
KEYWORDS Focal epilepsy; Febrile seizures; CPA6; DNA methylation
Summary Focal epilepsy (FE) is one of the most common forms of adult epilepsy and is usually regarded as a multifactorial disorder. Febrile seizures (FS) often appear during childhood in a subtype of FE patients, i.e. with temporal lobe epilepsy (TLE) and hippocampal sclerosis (HS). FS are the most common human convulsive event associated with fever. Genetic evidences for FS have suggested a complex mode of inheritance. Until now, to investigate genes at the genomic level, linkage analysis of familial forms and association studies have been performed, but nothing conclusive has been clearly related to FE and FS. As complex disorders, environmental factors might play a crucial role through epigenetic modification of key candidate genes such as CPA6, which encodes Carboxypeptidase A6, an extracellular protein. Therefore, we assessed DNA methylation in promoter of CPA6. In 186 FE patients and 92 FS patients compared to 93 healthy controls and 42 treated controls with antiepileptic drugs (AEDs), we found significant higher levels of methylation for epileptic patients. Methylation status were 3.4% (±3.2%) for FE cases and 4.3% (±3.5%) for FS cases, whereas healthy individuals and treated controls with AEDs showed a level of 0.8% (±2.9%) and 1.5% (±3.9%), respectively (p ≤ 0.001 for all comparisons). These results let growing evidence for DNA methylation involvment in FE and FS. © 2013 Elsevier B.V. All rights reserved.
Introduction ∗ Corresponding author at: Department of Psychiatry, Hôpital Belle-Idée, 2 ch du Petit Bel-Air, 1225 Chêne-Bourg, Switzerland. Tel.: +41 22 305 53 22; fax: +41 22 305 53 09. E-mail address: [email protected] (A. Salzmann).
Temporal lobe of epilepsy (TLE) is, in adults, the most common form of focal epilepsy (FE), which accounts for 60% of seizures (Sander et al., 1990). Hippocampal sclerosis (HS) is the most frequent pathogenic underlying
0920-1211/$ — see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.eplepsyres.2013.10.007
FE: focal epilepsy, FS: febrile seizures, AEDs: antiepileptic drugs, FHE: familial history of epilepsy, SD: standard deviation, HS: hippocampal sclerosis, and NA: number of patients, for whom no information is available. * Onset of psychiatric illness.
— — — — — — 8 (100) — — — 12.87 ± 3.44 17.00 ± 0 2 (25.0) 11 (45.8) Healthy children with FHE (n = 8) Young controls (n = 24)
6 (75.0) 13 (54.2)
17 (40.5) Treated controls with AEDs (n = 42)
25 (59.5)
60 (64.5) Controls (n = 93)
32 (34.4)
48 (52.2) FS (n = 92)
44 (47.8)
— —
— — — — —
— —
—
24.43 ± 9.33* NA: 14 — —
15 (20.8) NA: 20 — 23 (46.9) NA: 43 — 26 (53.1) NA: 43 —
— NA: 186 NA: 186
29 (16.7) NA: 12 32 (84.2) NA: 54 — 66 (35.7) NA: 1 —
14.56 ± 9.25 NA: 13 1.59 ± 1.70 NA: 57 — 90 (48.4) FE (n = 186)
96 (51.6)
32.68 ± 10.98 NA: 3 10.37 ± 13.75 NA: 7 41.91 ± 12.05 NA: 1 41.23 ± 10.12
87 (48.1) NA: 5 —
Complex FS (%) Simple FS (%) Familial history of FS/ epilepsy (%) Personal history of FS (%) HS (%) Age at onset ± SD Age at inclusion ± SD Female (%)
Unrelated patients of European ancestry (Table 1) were consecutively admitted when they met the criteria for FE to the Epilepsy Unit at Montpellier University Hospital (France). Unrelated Caucasian patients with FS (Table 1) were admitted to the paediatric emergency rooms at the University Hospitals of Geneva, Lausanne and Neuchâtel (Switzerland). When enrolled to the study, the FS cohort has already shown seizures. Moreover, FE could not be excluded later in life, but at the time of inclusion, those patients have only showed pure FS. Clinical evaluations of FE and FS patients are described in detail in the Supplementary Material. A healthy adult control group of European ancestry (Table 1) was recruited from blood donors at the University Hospitals of Geneva. After a clinical interview, only unrelated controls without a personal and/or family history of epilepsy and seizures were included. A second adult Caucasian control group was assessed, which comprise nonepileptic psychiatric individuals treated by antiepileptic drugs (AEDs) (Table 1). Two younger control groups were also considered, in order to determine if CPA6 promoter methylation status is affected by age. The first one consisted of Caucasian healthy children with a familial history of epilepsy and the second group comprised young unaffected individuals native from Rwanda (Table 1). More clinical informations are given in the Supplementary Material.
Male (%)
Study subjects
Demographic and clinical characteristics of FE and FS patients, and Caucasian controls.
Subjects and methods
Table 1
feature of this illness (Falconer et al., 1964). Moreover, patients with TLE and HS often showed febrile seizures (FS) (Falconer et al., 1964), that are the most common convulsive event during early childhood (Consensus Statement, 1980) and account for 5% of the general population (Hauser, 1994). We previously showed, that CPA6 gene is involved in familial cases of FS and TLE (Salzmann et al., 2012) and in patients with sporadic FE (Sapio et al., 2013). This gene encodes a carboxypeptidase, which is an exopeptidase that remove amino acids from the C-termini of proteins by hydrolysis (Lyons et al., 2008). CPA6 is expressed in mouse brain (Fontenele-Neto et al., 2005) and plays a role in neuropeptide cleavage. To date, only a few findings have shown involvement of epigenetic mechanisms in epilepsy. It was found that the hippocampus of TLE patients exhibited higher levels of methylation in Reelin promoter compared to control hippocampi (Kobow et al., 2009). Additionally, level of DNA methyltransferase, which catalyzes DNA methylation, was found increased in brain tissues of TLE patients compared to controls (Zhu et al., 2012). A recent study investigated a mouse model and found significant DNA methylation changes after status epilepticus (Miller-Delaney et al., 2012). Since FE and FS are complex disorders, epigenetic alteration of candidate genes could appear due to environmental factors, such as previous seizures. Consequently, we hypothesized that DNA methylation status of CPA6 might be associated to FE and FS. Thereby, we assessed the epigenetic contribution of CPA6 in epileptic pathogenicity.
145
Personal history of epilepsy
CPA6 promoter methylation
N. Belhedi et al. Ex I
5’
Ex II
Ex III
Ex IV
Ex VI
Ex VIII
Ex IX
TGA
146 Ex X
6 CpGs
3’ ATG
Ex V
Ex VII
Ex XI
CPA6 promoter –162
TAATAGCAACTTCCCTTCCTCAGCTGCCTGAACTTTTTTTTTCCCTTGTAGCTGGAGAGAAGTGTCACATTTTGCTCACTCTCAACC TTCCTCG1CCCACCCCCTTCCCG2GAGAACCTGTGCG3GTGTGTAGAGGGTGCTGTGAGCCACCTCCAGCCTCG4GGTGGCTGCTTAAG TAACTTTCAACTCCTCTCTTCTTAACACTATGAAGTGTCTCG5GGAAGCG6CAGGGGCCAGGCAGCTGCTTTCCTGCCTCTTTGCTGG +1 +45 CTCTTTTTGAAGATTCTGCAAC
Figure 1 CPA6 CpGs assessed in FE, FS and control groups (based on Ensembl genome browser (http://www. ensembl.org/index.htm). The PCR region from nucleotides −162 to +45 (numbers relating to the TSS are considered as +1) of the 5 -end of the CPA6 gene. Bold square boxes: localization of the primers used for amplification of bisulfite-treated DNA; highlighted grey: CpGs analyzed; underlined: TFBS reported by UCSC genome browser (http://genome.ucsc.edu/index.html) (UCSC refs: V$PAX4 03 and V$CEBP C).
The study was approved by the ethics committee of University Hospitals of Geneva. Informed written consent was obtained from all participants.
Genomic DNA from peripheral blood leukocytes was bisulfite-modified and methylation status was identified by high-resolution melt (HRM) assay. We used methylated and unmethylated commercial DNAs as standards, to create a range of methylated and unmethylated allele dilutions. We identified 6 CpGs around the translation start site (TSS), which are located in the promoter, from −162 to +45 (numbers relating to the TSS are considered as +1) of the 5 -end of the CPA6 gene (Fig. 1). Linear regressions were used to test for association between CPA6 methylation levels and clinical phenotype. PCR plus HRM conditions and statistical analysis are described in detail in the Supplementary Material.
Results Results were evaluated in percentage of DNA methylation level of CPA6 promoter (mean values ± standard deviation) (Fig. 2). There was significant difference in methylation status between the four clinical adult groups (F(3, 409) = 21.77; p = 4.25 × 10−13 ). FE and FS patients had significantly higher methylation status of the CPA6 promoter region than controls: 3.4% ± 3.2% vs 0.8% ± 2.9%, p = 5.1 × 10−10 and 4.3% ± 3.5% vs 0.8% ± 2.9%, p = 4.2 × 10−12 , respectively. FE and FS patients also displayed higher methylation status than treated controls (1.5% ± 3.9%): p = 0.001 and p = 0.0001, respectively. Of note there was no significant difference in methylation status of the CPA6 promoter region between treated controls and controls (p = 0.259). As there was a significant correlation (Pearson’s r = −0.19; p = 0.0001) between age and methylation status of the CPA6 promoter region, age was added as a covariate in the statistical model (Supplementray Fig. S1). Gender was also added as a covariate as there was a significant difference in gender between groups. Adding age and gender
** ; ## ; § § ; $ $
7 6 % Methylation
DNA methylation analysis
*; #;§;$
8
5 4 3 2 1 0 Treated Healthy Young Controls Controls Children Controls with AEDs with FHE
FE
FS
Figure 2 Histograms of the mean values (±SD) for percentage (%) of methylation in controls, treated controls with AEDs, healthy children with FHE, young controls, FE and FS patients. *FE vs Controls: p = 5.1 × 10−10 ; # FE vs Treated controls with AEDs: p = 0.001; § FE vs Healthy children with FHE: p = 0.004; $ FE vs Young controls: p = 1.11 × 10−7 ; **FS vs Controls: p = 4.2 × 10−12 ; ## FS vs Treated controls with AEDs: p = 0.0001; §§ FS vs Healthy children with FHE: p = 0.018; $$ FS vs Young controls: p = 3.67 × 10−6 .
as covariates did not modify the strength of the association p = 3.0 × 10−9 and p = 1.2 × 10−7 for the comparison between FE and controls and FS and controls respectively and p = 0.002 and p = 0.002 for the comparison between FE and treated controls and FS and treated controls respectively. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.eplepsyres.2013.10.007. As age showed a significant correlation with methylation status of the CPA6 promoter region and may still possibly influence the above analyses despite adjustment on age. FE and FS patients were compared to two additional samples
CPA6 promoter methylation of young controls: healthy children with a familial history of epilepsy (n = 8, age = 12.87 ± 3.44) and a group of young unaffected individuals native from Rwanda all aged 17 years old (n = 24). The methylation levels in these two groups were of 0.62% ± 1.77% and 0.21% ± 1.02%, respectively. FE and FS patients had significantly higher methylation status of the CPA6 promoter region than these two groups of young controls: p = 0.004 and p = 1.11 × 10−7 for the comparison of FE patients and p = 0.018 and p = 3.67 × 10−6 for the comparison of FS patients (Fig. 2). We also assessed methylation level of FS patients showing complex FS (4.7% ± 3.4%) vs FS patients with simple FS (4.6% ± 3.8%), which is not significant. Comparisons of CPA6 methlyation of FE patients with personal history of FS (3.4% ± 3.5%) vs FE patients without FS (3.3% ± 3.1%) and FE with HS (3.3% ± 3.4%) vs FE without HS (3.4% ± 3.1%) were also not significant. All these results suggest that an epileptic seizure, regardless the type or the subtype (FS and/or FE), might leave an epigenetic mark on DNA.
Discussion CPA6 gene has been recently related to epilepsy. Two previous studies revealed, in FE patients, four rare missense mutations and a significant association with a common marker in CPA6 (Salzmann et al., 2012; Sapio et al., 2013). All these genetic variants putatively affect enzymatic activity and protein levels (Salzmann et al., 2012; Sapio et al., 2013). Another study also demonstrated that CPA6 protein cleaves angiotensin I into angiotensin II and may act on brain development and neuronal migration (Lyons et al., 2008). CPA6 also inactivates neurotensin, which plays a role in thermal regulation, stress, and depression (Lyons et al., 2008). The aim of the present study was to compare methylation status of CPA6 promoter between FE and FS patients and healthy controls. We observed in FE and FS affected people a modest, but significant increase of DNA methylation level, which may contribute to a real functional effect on disease phenotype. In epigenetic epilepsy field, this is the first time that such results have been found in blood samples. In a previous study, we were not able to find any CPA6 mutations in FS patients (Salzmann et al., 2012). This lack of results could not exclude an epigenetic mechanism which may modulate the disease phenotype. The present analyzed promoter region shows some transcription factors binding site (TFBS) (Fig. 1), which contain more CpGs within their recognition sequence than the bulk genome (Kobow & Blumcke, 2012). Methylation of these CpGs could contribute to silencing gene expression (Momparler, 2003). Consequently, our results might lead to a defect in CPA6 expression, but we were not able to assess this aspect because of a lack of patient blood samples. To date, only a few studies have been done on DNA methylation related to epilepsy. Recently, protein levels of DNA methyltransferase (DNMT) enzymes which catalyze and also conserve DNA methylation level after cell division, were found increased in anterior temporal neocortex of TLE patients compared to control samples (Zhu et al., 2012). This variation to the normal protein level could lead to aberrant promoter methylation of genes (Momparler, 2003). Moreover, adenosine kinase, which contributes to
147 the maintenance of transmethylation in the cell, was found increased in astrocytes of TLE patients (Aronica et al., 2011). Consequently, the present results, which showed an increased level of DNA methylation on CPA6 promoter in FE and FS patients, could be due also to a disregulation of DNMT enzymes and/or adenosine kinase. Although DNA methylation status is recognized as tissue specific, Illingworth et al. observed a weak difference in frequencies of methylated CpG between blood and brain (Illingworth et al., 2008). In the present study, we evaluated DNA methylation level in peripheral blood leucocytes, instead of brain tissue, as it would be required for neurological diseases. In previous published data, we already established, that blood cells can be used as a successful evidence for measuring DNA methylation level. We found significant higher amounts of DNA methylation in peripheral blood of borderline personality disorder patients in promoter of NRC31, a glucocorticoid receptor gene (Perroud et al., 2011) and in promoter of BDNF, brain-derived neurotrophic factor gene (Perroud et al., 2013). We also found higher level of DNA methylation in peripheral blood of schizophrenia and bipolar patients in the promoter of the serotonin receptor 5HTR1A gene (Carrard et al., 2011). Recently, Smith et al. showed that, AEDs taken by pregnant mothers influence DNA methylation in umbilical cord blood of their neonates (Smith et al., 2012). Moreover, another study suggested that valproate could induce the decrease of global methylation in lymphomonocytes of epileptic patients (Tremolizzo et al., 2012). In the present study, we could exclude a putative effect of AEDs on DNA methylation level in peripherical blood cells of epileptic patients. Regarding the present results, age also did not affect CPA6 promoter methylation level. Kobow and Blümcke suggest that experimental and human TLE have shown aberrant epigenetic chromatin modifications, which could be precipitate by injuries as much as seizures by themselves (Kobow & Blumcke, 2012). These events may induce epigenetic alterations and thereby aggravate the epileptogenic condition (Kobow & Blumcke, 2012). Consequently, regarding our results, seizures by themselves in FE and FS patients could lead to an epigenetic effect on DNA, which modifies the level methylation of CPA6 promoter. Altogether, these outcomes may explain the wide distribution of DNA methylation level for the present epileptic patients. To date no convincing FE and FS susceptibility genes have emerged from classical genetic studies. Therefore, other mechanisms could suggest the relationship between seizures and DNA defects, like epigenetic misregulation of genes. Currently, DNA methylation function in epileptogenesis remains unclear and future studies are needed to determine exactly how and why this epigenetic process may show differences between epileptic patients and healthy controls. Moreover, this field of expertise opens a new area for discovering novel disease biomarkers, as well as for designing innovative strategies for AEDs therapy.
References Aronica, E., Zurolo, E., Iyer, A., de Groot, M., Anink, J., Carbonell, C., van Vliet, E.A., Baayen, J.C., Boison, D., Gorter, J.A., 2011.
148 Upregulation of adenosine kinase in astrocytes in experimental and human temporal lobe epilepsy. Epilepsia 52, 1645—1655. Carrard, A., Salzmann, A., Malafosse, A., Karege, F., 2011. Increased DNA methylation status of the serotonin receptor 5HTR1A gene promoter in schizophrenia and bipolar disorder. J. Affect. Disord. 132, 450—453. Consensus Statement, 1980. Febrile seizures: long-term management of children with fever-associated seizures. Pediatrics 66, 1009—1012. Falconer, M.A., Serafetinides, E.A., Corsellis, J.A., 1964. Etiology and pathogenesis of temporal lobe epilepsy. Arch. Neurol. 10, 233—248. Fontenele-Neto, J.D., Kalinina, E., Feng, Y., Fricker, L.D., 2005. Identification and distribution of mouse carboxypeptidase A-6. Brain Res. Mol. Brain Res. 137, 132—142. Hauser, W.A., 1994. The prevalence and incidence of convulsive disorders in children. Epilepsia 35 (Suppl. 2), S1—S6. Illingworth, R., Kerr, A., Desousa, D., Jorgensen, H., Ellis, P., Stalker, J., Jackson, D., Clee, C., Plumb, R., Rogers, J., Humphray, S., Cox, T., Langford, C., Bird, A., 2008. A novel CpG island set identifies tissue-specific methylation at developmental gene loci. PLoS Biol. 6, e22. Kobow, K., Blumcke, I., 2012. The emerging role of DNA methylation in epileptogenesis. Epilepsia 53 (Suppl. 9), 11—20. Kobow, K., Jeske, I., Hildebrandt, M., Hauke, J., Hahnen, E., Buslei, R., Buchfelder, M., Weigel, D., Stefan, H., Kasper, B., Pauli, E., Blumcke, I., 2009. Increased reelin promoter methylation is associated with granule cell dispersion in human temporal lobe epilepsy. J. Neuropathol. Exp. Neurol. 68, 356—364. Lyons, P.J., Callaway, M.B., Fricker, L.D., 2008. Characterization of carboxypeptidase A6, an extracellular matrix peptidase. J. Biol. Chem. 283, 7054—7063. Miller-Delaney, S.F., Das, S., Sano, T., Jimenez-Mateos, E.M., Bryan, K., Buckley, P.G., Stallings, R.L., Henshall, D.C., 2012. Differential DNA methylation patterns define status epilepticus and epileptic tolerance. J. Neurosci. 32, 1577—1588. Momparler, R.L., 2003. Cancer epigenetics. Oncogene 22, 6479—6483.
N. Belhedi et al. Perroud, N., Paoloni-Giacobino, A., Prada, P., Olie, E., Salzmann, A., Nicastro, R., Guillaume, S., Mouthon, D., Stouder, C., Dieben, K., Huguelet, P., Courtet, P., Malafosse, A., 2011. Increased methylation of glucocorticoid receptor gene (NR3C1) in adults with a history of childhood maltreatment: a link with the severity and type of trauma. Transl. Psychiatry 1, e59. Perroud, N., Salzmann, A., Prada, P., Nicastro, R., Hoeppli, M.E., Furrer, S., Ardu, S., Krejci, I., Karege, F., Malafosse, A., 2013. Response to psychotherapy in borderline personality disorder and methylation status of the BDNF gene. Transl. Psychiatry 3, e207. Salzmann, A., Guipponi, M., Lyons, P.J., Fricker, L.D., Sapio, M., Lambercy, C., Buresi, C., Ouled Amar Bencheikh, B., Lahjouji, F., Ouazzani, R., Crespel, A., Chaigne, D., Malafosse, A., 2012. Carboxypeptidase A6 gene (CPA6) mutations in a recessive familial form of febrile seizures and temporal lobe epilepsy and in sporadic temporal lobe epilepsy. Hum. Mutat. 33, 124—135. Sander, J.W., Hart, Y.M., Johnson, A.L., Shorvon, S.D., 1990. National general practice study of epilepsy: newly diagnosed epileptic seizures in a general population. Lancet 336, 1267—1271. Sapio, M.R., Salzmann, A., Vessaz, M., Crespel, A., Lyons, P.J., Malafosse, A., Fricker, L.D., 2013. Naturally occurring carboxypeptidase A6 mutations: effect on enzyme function and association with epilepsy. J. Biol. Chem. 287, 42900—42909. Smith, A.K., Conneely, K.N., Newport, D.J., Kilaru, V., Schroeder, J.W., Pennell, P.B., Knight, B.T., Cubells, J.F., Stowe, Z.N., Brennan, P.A., 2012. Prenatal antiepileptic exposure associates with neonatal DNA methylation differences. Epigenetics 7 (5), 1—6. Tremolizzo, L., Difrancesco, J.C., Rodriguez-Menendez, V., Riva, C., Conti, E., Galimberti, G., Ruffmann, C., Ferrarese, C., 2012. Valproate induces epigenetic modifications in lymphomonocytes from epileptic patients. Prog. Neuropsychopharmacol. Biol. Psychiatry 39, 47—51. Zhu, Q., Wang, L., Zhang, Y., Zhao, F.H., Luo, J., Xiao, Z., Chen, G.J., Wang, X.F., 2012. Increased expression of DNA methyltransferase 1 and 3a in human temporal lobe epilepsy. J. Mol. Neurosci. 46, 420—426.
journal homepage: www.elsevier.com/locate/epilepsyres
SHORT COMMUNICATION
Increased CPA6 promoter methylation in focal epilepsy and in febrile seizures N. Belhedi a,b, N. Perroud c, F. Karege d, M. Vessaz e, A. Malafosse c,e, A. Salzmann c,∗ a
Laboratory of Genetic, Immunology and Human Pathologies, Department of Biology, Faculty of Sciences, Tunis, Tunisia b Neurological Department, Charles Nicolle Hospital, Tunis, Tunisia c Department of Psychiatry, University of Geneva, Geneva, Switzerland d Department of Biology, National University of Rwanda, Rwanda e Department of Genetic Medicine and Laboratory, University Hospitals of Geneva, Geneva, Switzerland Received 19 March 2013 ; received in revised form 13 September 2013; accepted 13 October 2013 Available online 24 October 2013
KEYWORDS Focal epilepsy; Febrile seizures; CPA6; DNA methylation
Summary Focal epilepsy (FE) is one of the most common forms of adult epilepsy and is usually regarded as a multifactorial disorder. Febrile seizures (FS) often appear during childhood in a subtype of FE patients, i.e. with temporal lobe epilepsy (TLE) and hippocampal sclerosis (HS). FS are the most common human convulsive event associated with fever. Genetic evidences for FS have suggested a complex mode of inheritance. Until now, to investigate genes at the genomic level, linkage analysis of familial forms and association studies have been performed, but nothing conclusive has been clearly related to FE and FS. As complex disorders, environmental factors might play a crucial role through epigenetic modification of key candidate genes such as CPA6, which encodes Carboxypeptidase A6, an extracellular protein. Therefore, we assessed DNA methylation in promoter of CPA6. In 186 FE patients and 92 FS patients compared to 93 healthy controls and 42 treated controls with antiepileptic drugs (AEDs), we found significant higher levels of methylation for epileptic patients. Methylation status were 3.4% (±3.2%) for FE cases and 4.3% (±3.5%) for FS cases, whereas healthy individuals and treated controls with AEDs showed a level of 0.8% (±2.9%) and 1.5% (±3.9%), respectively (p ≤ 0.001 for all comparisons). These results let growing evidence for DNA methylation involvment in FE and FS. © 2013 Elsevier B.V. All rights reserved.
Introduction ∗ Corresponding author at: Department of Psychiatry, Hôpital Belle-Idée, 2 ch du Petit Bel-Air, 1225 Chêne-Bourg, Switzerland. Tel.: +41 22 305 53 22; fax: +41 22 305 53 09. E-mail address: [email protected] (A. Salzmann).
Temporal lobe of epilepsy (TLE) is, in adults, the most common form of focal epilepsy (FE), which accounts for 60% of seizures (Sander et al., 1990). Hippocampal sclerosis (HS) is the most frequent pathogenic underlying
0920-1211/$ — see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.eplepsyres.2013.10.007
FE: focal epilepsy, FS: febrile seizures, AEDs: antiepileptic drugs, FHE: familial history of epilepsy, SD: standard deviation, HS: hippocampal sclerosis, and NA: number of patients, for whom no information is available. * Onset of psychiatric illness.
— — — — — — 8 (100) — — — 12.87 ± 3.44 17.00 ± 0 2 (25.0) 11 (45.8) Healthy children with FHE (n = 8) Young controls (n = 24)
6 (75.0) 13 (54.2)
17 (40.5) Treated controls with AEDs (n = 42)
25 (59.5)
60 (64.5) Controls (n = 93)
32 (34.4)
48 (52.2) FS (n = 92)
44 (47.8)
— —
— — — — —
— —
—
24.43 ± 9.33* NA: 14 — —
15 (20.8) NA: 20 — 23 (46.9) NA: 43 — 26 (53.1) NA: 43 —
— NA: 186 NA: 186
29 (16.7) NA: 12 32 (84.2) NA: 54 — 66 (35.7) NA: 1 —
14.56 ± 9.25 NA: 13 1.59 ± 1.70 NA: 57 — 90 (48.4) FE (n = 186)
96 (51.6)
32.68 ± 10.98 NA: 3 10.37 ± 13.75 NA: 7 41.91 ± 12.05 NA: 1 41.23 ± 10.12
87 (48.1) NA: 5 —
Complex FS (%) Simple FS (%) Familial history of FS/ epilepsy (%) Personal history of FS (%) HS (%) Age at onset ± SD Age at inclusion ± SD Female (%)
Unrelated patients of European ancestry (Table 1) were consecutively admitted when they met the criteria for FE to the Epilepsy Unit at Montpellier University Hospital (France). Unrelated Caucasian patients with FS (Table 1) were admitted to the paediatric emergency rooms at the University Hospitals of Geneva, Lausanne and Neuchâtel (Switzerland). When enrolled to the study, the FS cohort has already shown seizures. Moreover, FE could not be excluded later in life, but at the time of inclusion, those patients have only showed pure FS. Clinical evaluations of FE and FS patients are described in detail in the Supplementary Material. A healthy adult control group of European ancestry (Table 1) was recruited from blood donors at the University Hospitals of Geneva. After a clinical interview, only unrelated controls without a personal and/or family history of epilepsy and seizures were included. A second adult Caucasian control group was assessed, which comprise nonepileptic psychiatric individuals treated by antiepileptic drugs (AEDs) (Table 1). Two younger control groups were also considered, in order to determine if CPA6 promoter methylation status is affected by age. The first one consisted of Caucasian healthy children with a familial history of epilepsy and the second group comprised young unaffected individuals native from Rwanda (Table 1). More clinical informations are given in the Supplementary Material.
Male (%)
Study subjects
Demographic and clinical characteristics of FE and FS patients, and Caucasian controls.
Subjects and methods
Table 1
feature of this illness (Falconer et al., 1964). Moreover, patients with TLE and HS often showed febrile seizures (FS) (Falconer et al., 1964), that are the most common convulsive event during early childhood (Consensus Statement, 1980) and account for 5% of the general population (Hauser, 1994). We previously showed, that CPA6 gene is involved in familial cases of FS and TLE (Salzmann et al., 2012) and in patients with sporadic FE (Sapio et al., 2013). This gene encodes a carboxypeptidase, which is an exopeptidase that remove amino acids from the C-termini of proteins by hydrolysis (Lyons et al., 2008). CPA6 is expressed in mouse brain (Fontenele-Neto et al., 2005) and plays a role in neuropeptide cleavage. To date, only a few findings have shown involvement of epigenetic mechanisms in epilepsy. It was found that the hippocampus of TLE patients exhibited higher levels of methylation in Reelin promoter compared to control hippocampi (Kobow et al., 2009). Additionally, level of DNA methyltransferase, which catalyzes DNA methylation, was found increased in brain tissues of TLE patients compared to controls (Zhu et al., 2012). A recent study investigated a mouse model and found significant DNA methylation changes after status epilepticus (Miller-Delaney et al., 2012). Since FE and FS are complex disorders, epigenetic alteration of candidate genes could appear due to environmental factors, such as previous seizures. Consequently, we hypothesized that DNA methylation status of CPA6 might be associated to FE and FS. Thereby, we assessed the epigenetic contribution of CPA6 in epileptic pathogenicity.
145
Personal history of epilepsy
CPA6 promoter methylation
N. Belhedi et al. Ex I
5’
Ex II
Ex III
Ex IV
Ex VI
Ex VIII
Ex IX
TGA
146 Ex X
6 CpGs
3’ ATG
Ex V
Ex VII
Ex XI
CPA6 promoter –162
TAATAGCAACTTCCCTTCCTCAGCTGCCTGAACTTTTTTTTTCCCTTGTAGCTGGAGAGAAGTGTCACATTTTGCTCACTCTCAACC TTCCTCG1CCCACCCCCTTCCCG2GAGAACCTGTGCG3GTGTGTAGAGGGTGCTGTGAGCCACCTCCAGCCTCG4GGTGGCTGCTTAAG TAACTTTCAACTCCTCTCTTCTTAACACTATGAAGTGTCTCG5GGAAGCG6CAGGGGCCAGGCAGCTGCTTTCCTGCCTCTTTGCTGG +1 +45 CTCTTTTTGAAGATTCTGCAAC
Figure 1 CPA6 CpGs assessed in FE, FS and control groups (based on Ensembl genome browser (http://www. ensembl.org/index.htm). The PCR region from nucleotides −162 to +45 (numbers relating to the TSS are considered as +1) of the 5 -end of the CPA6 gene. Bold square boxes: localization of the primers used for amplification of bisulfite-treated DNA; highlighted grey: CpGs analyzed; underlined: TFBS reported by UCSC genome browser (http://genome.ucsc.edu/index.html) (UCSC refs: V$PAX4 03 and V$CEBP C).
The study was approved by the ethics committee of University Hospitals of Geneva. Informed written consent was obtained from all participants.
Genomic DNA from peripheral blood leukocytes was bisulfite-modified and methylation status was identified by high-resolution melt (HRM) assay. We used methylated and unmethylated commercial DNAs as standards, to create a range of methylated and unmethylated allele dilutions. We identified 6 CpGs around the translation start site (TSS), which are located in the promoter, from −162 to +45 (numbers relating to the TSS are considered as +1) of the 5 -end of the CPA6 gene (Fig. 1). Linear regressions were used to test for association between CPA6 methylation levels and clinical phenotype. PCR plus HRM conditions and statistical analysis are described in detail in the Supplementary Material.
Results Results were evaluated in percentage of DNA methylation level of CPA6 promoter (mean values ± standard deviation) (Fig. 2). There was significant difference in methylation status between the four clinical adult groups (F(3, 409) = 21.77; p = 4.25 × 10−13 ). FE and FS patients had significantly higher methylation status of the CPA6 promoter region than controls: 3.4% ± 3.2% vs 0.8% ± 2.9%, p = 5.1 × 10−10 and 4.3% ± 3.5% vs 0.8% ± 2.9%, p = 4.2 × 10−12 , respectively. FE and FS patients also displayed higher methylation status than treated controls (1.5% ± 3.9%): p = 0.001 and p = 0.0001, respectively. Of note there was no significant difference in methylation status of the CPA6 promoter region between treated controls and controls (p = 0.259). As there was a significant correlation (Pearson’s r = −0.19; p = 0.0001) between age and methylation status of the CPA6 promoter region, age was added as a covariate in the statistical model (Supplementray Fig. S1). Gender was also added as a covariate as there was a significant difference in gender between groups. Adding age and gender
** ; ## ; § § ; $ $
7 6 % Methylation
DNA methylation analysis
*; #;§;$
8
5 4 3 2 1 0 Treated Healthy Young Controls Controls Children Controls with AEDs with FHE
FE
FS
Figure 2 Histograms of the mean values (±SD) for percentage (%) of methylation in controls, treated controls with AEDs, healthy children with FHE, young controls, FE and FS patients. *FE vs Controls: p = 5.1 × 10−10 ; # FE vs Treated controls with AEDs: p = 0.001; § FE vs Healthy children with FHE: p = 0.004; $ FE vs Young controls: p = 1.11 × 10−7 ; **FS vs Controls: p = 4.2 × 10−12 ; ## FS vs Treated controls with AEDs: p = 0.0001; §§ FS vs Healthy children with FHE: p = 0.018; $$ FS vs Young controls: p = 3.67 × 10−6 .
as covariates did not modify the strength of the association p = 3.0 × 10−9 and p = 1.2 × 10−7 for the comparison between FE and controls and FS and controls respectively and p = 0.002 and p = 0.002 for the comparison between FE and treated controls and FS and treated controls respectively. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.eplepsyres.2013.10.007. As age showed a significant correlation with methylation status of the CPA6 promoter region and may still possibly influence the above analyses despite adjustment on age. FE and FS patients were compared to two additional samples
CPA6 promoter methylation of young controls: healthy children with a familial history of epilepsy (n = 8, age = 12.87 ± 3.44) and a group of young unaffected individuals native from Rwanda all aged 17 years old (n = 24). The methylation levels in these two groups were of 0.62% ± 1.77% and 0.21% ± 1.02%, respectively. FE and FS patients had significantly higher methylation status of the CPA6 promoter region than these two groups of young controls: p = 0.004 and p = 1.11 × 10−7 for the comparison of FE patients and p = 0.018 and p = 3.67 × 10−6 for the comparison of FS patients (Fig. 2). We also assessed methylation level of FS patients showing complex FS (4.7% ± 3.4%) vs FS patients with simple FS (4.6% ± 3.8%), which is not significant. Comparisons of CPA6 methlyation of FE patients with personal history of FS (3.4% ± 3.5%) vs FE patients without FS (3.3% ± 3.1%) and FE with HS (3.3% ± 3.4%) vs FE without HS (3.4% ± 3.1%) were also not significant. All these results suggest that an epileptic seizure, regardless the type or the subtype (FS and/or FE), might leave an epigenetic mark on DNA.
Discussion CPA6 gene has been recently related to epilepsy. Two previous studies revealed, in FE patients, four rare missense mutations and a significant association with a common marker in CPA6 (Salzmann et al., 2012; Sapio et al., 2013). All these genetic variants putatively affect enzymatic activity and protein levels (Salzmann et al., 2012; Sapio et al., 2013). Another study also demonstrated that CPA6 protein cleaves angiotensin I into angiotensin II and may act on brain development and neuronal migration (Lyons et al., 2008). CPA6 also inactivates neurotensin, which plays a role in thermal regulation, stress, and depression (Lyons et al., 2008). The aim of the present study was to compare methylation status of CPA6 promoter between FE and FS patients and healthy controls. We observed in FE and FS affected people a modest, but significant increase of DNA methylation level, which may contribute to a real functional effect on disease phenotype. In epigenetic epilepsy field, this is the first time that such results have been found in blood samples. In a previous study, we were not able to find any CPA6 mutations in FS patients (Salzmann et al., 2012). This lack of results could not exclude an epigenetic mechanism which may modulate the disease phenotype. The present analyzed promoter region shows some transcription factors binding site (TFBS) (Fig. 1), which contain more CpGs within their recognition sequence than the bulk genome (Kobow & Blumcke, 2012). Methylation of these CpGs could contribute to silencing gene expression (Momparler, 2003). Consequently, our results might lead to a defect in CPA6 expression, but we were not able to assess this aspect because of a lack of patient blood samples. To date, only a few studies have been done on DNA methylation related to epilepsy. Recently, protein levels of DNA methyltransferase (DNMT) enzymes which catalyze and also conserve DNA methylation level after cell division, were found increased in anterior temporal neocortex of TLE patients compared to control samples (Zhu et al., 2012). This variation to the normal protein level could lead to aberrant promoter methylation of genes (Momparler, 2003). Moreover, adenosine kinase, which contributes to
147 the maintenance of transmethylation in the cell, was found increased in astrocytes of TLE patients (Aronica et al., 2011). Consequently, the present results, which showed an increased level of DNA methylation on CPA6 promoter in FE and FS patients, could be due also to a disregulation of DNMT enzymes and/or adenosine kinase. Although DNA methylation status is recognized as tissue specific, Illingworth et al. observed a weak difference in frequencies of methylated CpG between blood and brain (Illingworth et al., 2008). In the present study, we evaluated DNA methylation level in peripheral blood leucocytes, instead of brain tissue, as it would be required for neurological diseases. In previous published data, we already established, that blood cells can be used as a successful evidence for measuring DNA methylation level. We found significant higher amounts of DNA methylation in peripheral blood of borderline personality disorder patients in promoter of NRC31, a glucocorticoid receptor gene (Perroud et al., 2011) and in promoter of BDNF, brain-derived neurotrophic factor gene (Perroud et al., 2013). We also found higher level of DNA methylation in peripheral blood of schizophrenia and bipolar patients in the promoter of the serotonin receptor 5HTR1A gene (Carrard et al., 2011). Recently, Smith et al. showed that, AEDs taken by pregnant mothers influence DNA methylation in umbilical cord blood of their neonates (Smith et al., 2012). Moreover, another study suggested that valproate could induce the decrease of global methylation in lymphomonocytes of epileptic patients (Tremolizzo et al., 2012). In the present study, we could exclude a putative effect of AEDs on DNA methylation level in peripherical blood cells of epileptic patients. Regarding the present results, age also did not affect CPA6 promoter methylation level. Kobow and Blümcke suggest that experimental and human TLE have shown aberrant epigenetic chromatin modifications, which could be precipitate by injuries as much as seizures by themselves (Kobow & Blumcke, 2012). These events may induce epigenetic alterations and thereby aggravate the epileptogenic condition (Kobow & Blumcke, 2012). Consequently, regarding our results, seizures by themselves in FE and FS patients could lead to an epigenetic effect on DNA, which modifies the level methylation of CPA6 promoter. Altogether, these outcomes may explain the wide distribution of DNA methylation level for the present epileptic patients. To date no convincing FE and FS susceptibility genes have emerged from classical genetic studies. Therefore, other mechanisms could suggest the relationship between seizures and DNA defects, like epigenetic misregulation of genes. Currently, DNA methylation function in epileptogenesis remains unclear and future studies are needed to determine exactly how and why this epigenetic process may show differences between epileptic patients and healthy controls. Moreover, this field of expertise opens a new area for discovering novel disease biomarkers, as well as for designing innovative strategies for AEDs therapy.
References Aronica, E., Zurolo, E., Iyer, A., de Groot, M., Anink, J., Carbonell, C., van Vliet, E.A., Baayen, J.C., Boison, D., Gorter, J.A., 2011.
148 Upregulation of adenosine kinase in astrocytes in experimental and human temporal lobe epilepsy. Epilepsia 52, 1645—1655. Carrard, A., Salzmann, A., Malafosse, A., Karege, F., 2011. Increased DNA methylation status of the serotonin receptor 5HTR1A gene promoter in schizophrenia and bipolar disorder. J. Affect. Disord. 132, 450—453. Consensus Statement, 1980. Febrile seizures: long-term management of children with fever-associated seizures. Pediatrics 66, 1009—1012. Falconer, M.A., Serafetinides, E.A., Corsellis, J.A., 1964. Etiology and pathogenesis of temporal lobe epilepsy. Arch. Neurol. 10, 233—248. Fontenele-Neto, J.D., Kalinina, E., Feng, Y., Fricker, L.D., 2005. Identification and distribution of mouse carboxypeptidase A-6. Brain Res. Mol. Brain Res. 137, 132—142. Hauser, W.A., 1994. The prevalence and incidence of convulsive disorders in children. Epilepsia 35 (Suppl. 2), S1—S6. Illingworth, R., Kerr, A., Desousa, D., Jorgensen, H., Ellis, P., Stalker, J., Jackson, D., Clee, C., Plumb, R., Rogers, J., Humphray, S., Cox, T., Langford, C., Bird, A., 2008. A novel CpG island set identifies tissue-specific methylation at developmental gene loci. PLoS Biol. 6, e22. Kobow, K., Blumcke, I., 2012. The emerging role of DNA methylation in epileptogenesis. Epilepsia 53 (Suppl. 9), 11—20. Kobow, K., Jeske, I., Hildebrandt, M., Hauke, J., Hahnen, E., Buslei, R., Buchfelder, M., Weigel, D., Stefan, H., Kasper, B., Pauli, E., Blumcke, I., 2009. Increased reelin promoter methylation is associated with granule cell dispersion in human temporal lobe epilepsy. J. Neuropathol. Exp. Neurol. 68, 356—364. Lyons, P.J., Callaway, M.B., Fricker, L.D., 2008. Characterization of carboxypeptidase A6, an extracellular matrix peptidase. J. Biol. Chem. 283, 7054—7063. Miller-Delaney, S.F., Das, S., Sano, T., Jimenez-Mateos, E.M., Bryan, K., Buckley, P.G., Stallings, R.L., Henshall, D.C., 2012. Differential DNA methylation patterns define status epilepticus and epileptic tolerance. J. Neurosci. 32, 1577—1588. Momparler, R.L., 2003. Cancer epigenetics. Oncogene 22, 6479—6483.
N. Belhedi et al. Perroud, N., Paoloni-Giacobino, A., Prada, P., Olie, E., Salzmann, A., Nicastro, R., Guillaume, S., Mouthon, D., Stouder, C., Dieben, K., Huguelet, P., Courtet, P., Malafosse, A., 2011. Increased methylation of glucocorticoid receptor gene (NR3C1) in adults with a history of childhood maltreatment: a link with the severity and type of trauma. Transl. Psychiatry 1, e59. Perroud, N., Salzmann, A., Prada, P., Nicastro, R., Hoeppli, M.E., Furrer, S., Ardu, S., Krejci, I., Karege, F., Malafosse, A., 2013. Response to psychotherapy in borderline personality disorder and methylation status of the BDNF gene. Transl. Psychiatry 3, e207. Salzmann, A., Guipponi, M., Lyons, P.J., Fricker, L.D., Sapio, M., Lambercy, C., Buresi, C., Ouled Amar Bencheikh, B., Lahjouji, F., Ouazzani, R., Crespel, A., Chaigne, D., Malafosse, A., 2012. Carboxypeptidase A6 gene (CPA6) mutations in a recessive familial form of febrile seizures and temporal lobe epilepsy and in sporadic temporal lobe epilepsy. Hum. Mutat. 33, 124—135. Sander, J.W., Hart, Y.M., Johnson, A.L., Shorvon, S.D., 1990. National general practice study of epilepsy: newly diagnosed epileptic seizures in a general population. Lancet 336, 1267—1271. Sapio, M.R., Salzmann, A., Vessaz, M., Crespel, A., Lyons, P.J., Malafosse, A., Fricker, L.D., 2013. Naturally occurring carboxypeptidase A6 mutations: effect on enzyme function and association with epilepsy. J. Biol. Chem. 287, 42900—42909. Smith, A.K., Conneely, K.N., Newport, D.J., Kilaru, V., Schroeder, J.W., Pennell, P.B., Knight, B.T., Cubells, J.F., Stowe, Z.N., Brennan, P.A., 2012. Prenatal antiepileptic exposure associates with neonatal DNA methylation differences. Epigenetics 7 (5), 1—6. Tremolizzo, L., Difrancesco, J.C., Rodriguez-Menendez, V., Riva, C., Conti, E., Galimberti, G., Ruffmann, C., Ferrarese, C., 2012. Valproate induces epigenetic modifications in lymphomonocytes from epileptic patients. Prog. Neuropsychopharmacol. Biol. Psychiatry 39, 47—51. Zhu, Q., Wang, L., Zhang, Y., Zhao, F.H., Luo, J., Xiao, Z., Chen, G.J., Wang, X.F., 2012. Increased expression of DNA methyltransferase 1 and 3a in human temporal lobe epilepsy. J. Mol. Neurosci. 46, 420—426.
