The EMBO Journal vol. 1 1 no.2 pp.705 - 716, 1992

In vivo topoisomerase 11 cleavage of the Drosophila histone and satellite Ill repeats: DNA sequence and structural characteristics Emmanuel Kas and Ulrich K.Laemmli Departments of Biochemistry and Molecular Biology, University of Geneva, 30, Quai Ernest-Ansermet, CH-1211 Geneva 4, Switzerland

Communicated by U.K.Laemmli

We have identified two classes of in vivo topoisomerase II cleavage sites in the Drosophila histone gene repeat. One class co-localizes with DNase I-hypersensitive regions and another novel class maps to a subset of consecutive nucleosome linker sites in the scaffold-associated region (SAR) of the histone gene loop. Prominent topoisomerase II cleavage is also observed in one of the linker regions of the two nucleosomes spanning satellite III, a centromeric SAR-like DNA sequence with a repeat length of 359 bp. At the sequence level, in vivo topoisomerase II cleavage is highly site specific. Comparison of 10 nucleosome linker sites defines an in vivo cleavage sequence whose major characteristic is a prominent GCrich core. These GC-rich cleavage sites are flanked by extensive arrays of oligo(dA) *oligo(dT) tracts characteristic of SAR sequences. Treatment of cells with distamycin selectively enhances cleavage at nucleosome linker sites of the SAR and satellite regions, suggesting that AT-rich sequences flanking cleavage sites may be involved in determining topoisomerase II activity in the cell. These observations provide evidence for the association of topoisomerase H with SARS in vivo. Key words: chromomycin/distamycin/SAR/satellite DNA/ topoisomerase II

Introduction Topoisomerases deal with the topological problems resulting from a number of reactions of DNA metabolism such as replication, recombination and transcription. Various studies have shown that type I or H topoisomerases can mutually substitute several of their topological roles (for reviews see Wang, 1987; Stemglanz, 1989). Topoisomerase however, has an essential function in the segregation of the intertwined daughter chromosomes at the end of DNA replication (DiNardo et al., 1984; Uemura and Yanagida, 1984; Holm et al., 1985). Genetic evidence from the yeast Schizosaccharomyces pombe as well as the observed effects of specific inhibitory drugs in chromosome assembly studies have suggested a role for topoisomerase II in chromosome condensation as well as decondensation (Uemura et al., 1987; Newport, 1987; Newport and Spann, 1987). Direct evidence for a role of topoisomerase II in chromosome condensation comes from recent in vitro chromosome assembly studies using mitotic extracts derived from Xenopus laevis eggs (Adachi et al., 1991). Such extracts efficiently convert added nuclei to mitotic chromosomes (Lohka and Maller, 1985; Newport H,

()Chfnrd Universitv Press

and Spann, 1987). Adachi and co-workers studied the role of topoisomerase H in this process by specific immunodepletion and subsequent complementation with purified topoisomerase II. These experiments demonstrate that, following disassembly of the membrane-lamina complex, topoisomerase II is involved in the conversion of the so-called precondensation chromosomes to the compacted mitotic chromosomes. Dosage experiments support the notion of a possible structural involvement of topoisomerase II in chromosome condensation (Adachi et al., 1991). The chromosomal scaffold is a network of protein crossties which are thought to organize the chromatin fibre into topological loops (Paulson and Laemmli, 1977). Earlier biochemical and structural studies of metaphase chromosomes identified the protein SC 1 as the major component of the metaphase scaffold, leading to speculation that SC1 might serve as a fastener for the chromatin loop (Lewis and Laemmli, 1982). More recently, SC1 was identified as topoisomerase II (Earnshaw et al., 1985; Gasser et al., 1986) and has also been shown to be a major component of the interphase nuclear matrix (Berrios et al., 1985). Topoisomerase H may exert its role in chromatin structure via interaction with the DNA elements termed scaffoldassociated regions (SARs) which are proposed to define the base of chromatin loops (for a review see Gasser and Laemmli, 1987). SARs are AT-rich sequences of several hundred base pairs which were originally identified in Drosophila (Mirkovitch et al., 1984) and have since been characterized in several organisms including human and yeast (Cockerill and Garrard, 1986; Amati and Gasser, 1988). SARs, sometimes called MARs, contain oligo(dA) * oligo(dT) tracts which are essential DNA elements for a specific SAR-scaffold interaction (Kas et al., 1989). SARs are also enriched for sequences related to the in vitro topoisomerase II cleavage consensus (Sander and Hsieh, 1985; Gasser and Laemmli, 1986; Cockerill and Garrard, 1986) and are preferentially cleaved by this enzyme in vitro (Udvardy et al., 1985; Adachi et al., 1989). Moreover, topoisomerase II preferentially aggregates SAR-containing DNA fragments via a cooperative interaction, an observation thought to be relevant to its role in chromosome condensation (Adachi et al., 1989). Because of the striking preferential binding of topoisomerase H to SAR-containing DNA observed in vitro, we have extended these studies to living cells and chromatin. Topoisomerase II is one of a few proteins for which the in vivo site of action can be studied by stabilizing a transient covalent protein - DNA intermediate (the 'cleavage complex', Nelson et al., 1984) using cytotoxic drugs such as VM26 (Chen et al., 1984). Several topoisomerase II cleavage sites have been mapped in Drosophila chromatin (Rowe et al., 1986; Udvardy et al., 1986; Villeponteau, 1989) but no consistent pattern has emerged that would support a preferential partition to SAR regions. Thus, the 705

E.Kas and U.K. Laemmli

SAR of the Drosophila histone gene repeat is a poor target for topoisomerase II cleavage in nuclei (Udvardy et al., 1986; Villeponteau, 1989). In contrast to these earlier studies, we report in this paper that SAR regions are indeed sites of topoisomerase II activity in intact cells. Most interestingly, we also observe very prominent topoisomerase II cleavage in the SAR-like satellite III (1.688 g/cm3) repeat. At the nucleotide level, in vivo topoisomerase II cleavage occurs specifically at GC-rich sites. The AT-rich in vitro consensus (Sander and Hsieh, 1985) does not appear to be used in the cell.

site 9 is strongly reduced, new sites 5' of the HI gene (site 1) and in the H3 -H4 intergenic region (site 8) are generated (compare lanes 4 and 5 of Figure IA and lanes 2 and 3 of Figure iB). Topoisomerase 11 cleaves either in nucleosomal linker DNA or in 'open' chromatin regions The in vivo cleavage pattern shown in Figure 1 reveals further interesting features. The five cleavage sites (sites 3-7) in the SAR spacer region are evenly spaced approximately every 180 nucleotides. As shown in Figure 1B, these

Results Topoisomerase /I cleavage in the Drosophila histone gene repeat We have focused our experimental analysis on the

Drosophila histone gene repeat, a unit of -5 kb whose structure in chromatin has been extensively studied (Worcel et al., 1983). Each repeat is thought to be organized as a chromatin domain delimited by a SAR localized in the intergenic spacer between the HI and H3 genes (see map in Figure 2). As defined by the scaffold attachment assay, the histone SAR is located on an AT-rich DNA fragment of a minimal length of 650 bp (Mirkovitch et al., 1984). We have used the indirect end-labelling technique to study cleavage sites in the entire histone gene repeat. The in vitro cleavage pattern observed in naked DNA reveals numerous strong cleavage sites largely concentrated in the SAR region (Figure IA, lane 2), in line with earlier observations (Udvardy et al., 1985; Adachi et al., 1989). The preferential cleavage in the SAR in vitro is due to the cooperative binding of topoisomerase II to SAR-containing DNA fragments (Adachi et al., 1989) and to the presence of numerous sequences (Cockerill and Garrard, 1986; Gasser and Laemmli, 1986) related to the in vitro topoisomerase II cleavage consensus (Sander and Hsieh, 1985). The in vivo cleavage pattern, derived from exponentially growing cells exposed to VM26, is shown in lane 4 of Figure IA. We observe a cluster of topoisomerase II cleavage sites within the HI -H3 spacer. Three of these sites (labelled 3, 4 and 5) are located within the SAR and two weaker sites (labelled 6 and 7) are detected further 3' in the spacer region toward the H3 gene. As shown in the map of Figure 2, additional cleavage sites of varying intensities (see below) were detected 5' of the histone HI gene (sites 1 and 2) and in the different intergenic regions between the core histone genes (sites 8, 9 and 10). Note that bands marked with asterisks in this and subsequent figures correspond to minor variants of the histone gene repeat detected by the probe used and are not topoisomerase II cleavage products. Comparison of the in vivo pattern (lane 4) with that observed in naked DNA (lane 2) reveals dramatic differences. Thus, most of the major in vitro cleavage sites (labelled with arrowheads in lane 1) map to DNA regions which are not cleaved in the cell. Indeed, the cleavage sites which remain in vivo represent only a small subset of weak in vitro cleavage sites. We also examined topoisomerase II cleavage under conditions of heat-shock where the activity of the histone genes is known to be altered (see Discussion). The topoisomerase II cleavage pattern changes following heatshock; while cleavage at the linker sites (sites 3-7) and at -

706

..-&- --.l

41W VW

W

-,

W..". :104.

0

.

.

Fig. 1. In vitro and in vivo topoisomerase II cleavage in the histone gene repeat. In vitro and in vivo topoisomerase II cleavage sites were analysed by indirect end-labelling, using a probe specific for the Drosophila histone gene repeat (see Materials and methods). (A) a 5 kb cloned DNA fragment containing the entire repeat (lane 1) was incubated with 150 ng of purified toposiomerase II (lane 2) in the presence of 1 yg competitor DNA and 50 yM VM26. Cleavage reactions were performed as described in Materials and methods. DNA samples from Kc cells treated with no drugs (lane 3) or 50,tM VM26 (lanes 4 and 5) were analysed with the same probe. Samples were purified from control cells (lanes 3 and 4) or from cells subjected to heat-shock (lane 5). Strong in vitro topoisomerase II cleavage sites are indicated by arrowheads in lane 1. Major in vivo cleavage sites are numbered as shown to the right of the figure. Bands present the in vivo no-drug control in this and subsequent figures are marked with asterisks and correspond to minor variants of the histone repeat detected by the probe used rather than to topoisomerase II cleavage products. (B) DNA samples from Kc cells treated with no drugs (lane 1) or with 50 ,M VM26 (lanes 2 and 3) were electrophoresed alongside samples from nuclei digested with micrococcal nuclease (lanes 4 and 5) or DNase I (lanes 6 and 7). The DNA in lane 3 was purified from heat-shocked cells. Cleavage site 10 is obscured by the strong hybridization signal from the 5 kb full-length genomic fragment and is not visible in this exposure. Restriction enzyme digests and the probe used are as in (A).

In vivo topoisomerase 11 cleavage

nent micrococcal nuclease cleavage (see also Worcel et al., 1983). We refer to these cleavage sites as 'open sites', to differentiate them from sites localized to nucleosomal linkers (or 'linker sites'). Prominent topoisomerase II cleavage in open chromatin sites was observed in earlier studies (Yang et al., 1985; Rowe et al., 1986; Udvardy et al., 1986; Muller and Mehta, 1988; Villeponteau, 1989), and more recently in the chicken f3-globin locus by Reitman and Felsenfeld (1990). These results are diagrammed in Figure 2 and can be summarized as follows: (i) in contrast to earlier reports from other laboratories, prominent in vivo topoisomerase II activity, as detected by DNA cleavage, is observed in the histone SAR region. The weak or absent topoisomerase II cleavage activity in the histone SAR region observed by others (Udvardy et al., 1986, Villeponteau, 1989) is due to the use of isolated nuclei rather than cells in these cleavage studies (see Discussion). (ii) Cleavage sites occur either in linker DNA between phased nucleosomes in the SAR spacer region, or in open regions defined by sensitivity to DNase I or micrococcal nuclease digestion. (iii) Upon heat-shock, we observe a reduction of the intensity of topoisomerase II cleavage in the linker sites of the SAR region and at site 9, but strong intensification of cleavage of DNase Ihypersensitive regions (sites 1 and 8). (iv) The transcribed regions of the histone genes are free of major cleavage sites. (v) The in vivo and in vitro cleavage patterns are very different; the major in vitro cleavage sites localize to regions that are inaccessible in vivo, presumably because of steric hindrance by nucleosomes (Capranico et al., 1990). As a consequence, the topoisomerase II in vitro cleavage consensus sequence appears not to be operative in vivo.

five topoisomerase II cleavage sites (lane 2) comap with the major micrococcal nuclease cleavage sites observed in isolated nuclei (lanes 4 and 5). That is, topoisomerase II activity in the spacer region occurs in nucleosomal linker DNA. This chromatin region contains a number of phased nucleosomes as studied in detail by Worcel et al. (1983) and the regular topoisomerase II cleavage pattern conforms precisely to the observed nucleosome positions. In contrast, the intergenic cleavage sites 1, 2, 8 and 10 (see lanes 2 and 3 of Figure IB), co-map with open chromatin regions as defined by DNase I cleavage (Figure IB, lanes 6 and 7) and site 9 localizes to a region of promiD

D

*

*

Hl

f vt 2

hs

D

H31t H

3 4 5 6 7

j

8

~stimuted by

H2A

9

tH2B

Hi kb

10

hs

hs

Distamycin

Fig. 2. Localization of in vivo topoisomerase II cleavage sites in the histone gene repeat. The diagram shows the major histone gene repeat as a 5 kb HindlIl fragment and the localization of in vivo topoisomerase II cleavage sites as determined from the experiment in Figure 1. Arrows below the line represent cleavage sites (see Figure 1), the minimal 657 bp SAR located between the HI and H3 genes is represented by the hooked bar. The filled circles represent phased nucleosomes (Worcel et al., 1983), while vertical lines marked by asterisks above the line indicate the location of major micrococcal nuclease cuts in chromatin as determined from Figure lB, lanes 4 and 5. DNAse I-hypersensitive sites (Figure IB, lanes 6 and 7) are also shown and are represented by filled arrows above the line (labelled 'D'); topoisomerase II cleavage sites detected only in heat-shocked cells (sites 1 and 8 labelled 'hs) fall in these regions.

A

C

B 2 3 T C" A G

i2 3 GA- C '

2 3GT CA

2 3

-\1

GA TC

2 3C GA T

2 3 GAT C

,1*

__U

i W

...

I.'

.

_,

..

D"e-sla _d

lw rsrn

4

upe_srn

lower 3

4a

4

AAAAATTTGCTTTAAAGCAGCATTCAGAAA TTTTTAAACGAAATTTCGTCGTAAGTCTTT

3

4

4b

4

TTCCTCGCCACATATGCATTACCGTCTATG

AAGGAGCGGTGTATACGTAATGGCAGATAC 4a 4b

Lower strand 5a ACAGTGTCAATTGTCCCGTACGACCTCTTC TGTCACAGTTAACAGGGCATGCTGGAGAAG 5b 5a AATAATAACACATTCTTCAGTTAACACATG

TTATTATTGTGTAAGAAGTCAATTGTGTAC Sb

Fig. 3. Genomic sequencing of in vivo topoisomerase II sites. Samples from cells treated as in Figure 1 were hybridized to labelled primers 3 and 4 (see Materials and methods), extended by Taq DNA polymerase and electrophoresed on sequencing gels. Relevant regions are shown for both strands near cleavage sites 3, 4 and 5 in (A) (B) and (C) respectively (see map in Figure 2). In each panel, lane 1 contains DNA from cells treated with no drugs, lane 2 samples from cells treated with VM26, and lane 3 samples from cells treated with VM26 plus distamycin (see text). The adjacent dideoxy-terminated sequencing ladders were generated from the same primer extending a cloned DNA template. Sequences near each cleavage site(s) are given below each panel. Arrows above and below the sequence represent the position of cleavage on the upper and lower strands, respectively, as determined from these and other experiments.

707

E.Kas and U.K. Laemmli Table I. Sequence analysis of in viio cleavage sites

-6 -5 4 -3 -2 -1 +12+11+10-t9 *8+7 T A A T

C G G C T A C G T A

C G C G T

+7 +8 *9+10+11+12 -1 -2 -3 4 -5 -6

C C T C C T G A G G A

T A T A C G A T T A

A T T A

A T A T

T A T A A T

A T A T C

T A T A T A T T T A T A A A T A

A T T A T A A T

G A A G T C G C C C C G C G G G G C T G T A C C A C A T G G

G A T G A C C T A C T G

G C C G C

G

A T T A C G A T A T

+1 +2 +3 -4 +5 -+6 *6 +5 -4 +3 +2 +1

A A T T A

C C G G G C A C A T G T T C C C A G G G C G C G

G

C T G A C A

G A C T G T A A G C A G T T C G T C T G C A T T A C G T A A C G T C T A G C +A G A T

C G A C C T C G T G G A C T T C A G

G C C G A G T C T T AA C G G C G T A C A T

T A C G A T C G

T A T A C G T A

upper strand lower strand 1 (- 59)

C G C G

2 (- 109)

3 (- 502)

A T C

4a (- 682)

G G T C A

4b (- 690)

C TT C A A G AA G T T

Sa (- 868)

C A

Sb (- 892)

T T A A A A T T C A C G G T G C G T T T C A A A

G T A C

6 (-1053)

T G G C C G

7 (-1232)

C C T T A C G G A A T G

SAT (+24)

G G G G G A

-6 -5 4 -3 -2 -1

+1 +2 +3 -4 +5 *6

+7*+89+10+11+12

G

2D 0 10 20 0 0

10 40 20 0 0 30

10 10 10 30 20 0

A

10 50 0 30 30 60

10 10 10 30 20 20

10 20 20 20 30 30

34

T

30 20 40 20 70 20

20 20 40 0 20 40

40 40 50 30 30 10

38.5

C

40 30 50 30 0 20

60 30 30 70 60 10

40 30 20 20 20 60

14.5

C

C

C C T

C C

G

C C

T

T T

A T T N A T

N N

C C

C N T A

C

C

C

G T

T A

A G T N

T N N C

C

A

T

N C N N G

T

Preferred Nucleotides (upper strand)

Drosophila In Vitro Consensus

G

C

N G T

A

Nucleotide Frequency upper strand (%) 13

G T

C

T N

C

N

T

Vertebrate In Vitro Consensus

T

The sequences at histone cleavage sites 1-7 (see Figures 2 and 3) and of the satellite III cleavage site ('SAT', see Figure 6) are shown for the six nucleotides immediately 5' and 3' of the topoisomerase II cut on the upper and lower strands. Nucleotides 5' and 3' of the cut are assigned the -1 and +1 positions, respectively. The coordinate of position -1 is listed to the right of each cleavage site relative to the 5' end of the HI coding sequence or to the satellite III sequence (Figure 4 of Hsieh and Brutlag, 1979b). The upper and lower strands correspond to the polarity of the map in Figure 2 for histone sequences and, for the satellite cleavage site, to the published satellite sequence. The frequency of nucleotide occurrence at each position is shown underneath for the upper strand. Numbers to the right indicate single nucleotide frequencies in the upper strand of the 1400 bp histone HI - H3 spacer - SAR sequence (see Materials and methods for EMBL database accession number). A preferred cleavage sequence is shown below for the upper strand (see text). Because of the limited number of sites analysed, we view this sequence as an average of the cleavage sites shown rather than a 'consensus' in the strict sense of the word. For purposes of comparison, the corresponding positions of the Drosophila topoisomerase II in vitro cleavage consensus (Sander and Hsieh, 1985) and of the vertebrate in vitro consensus (Spitzner and Muller, 1988) are also shown.

708

In vivo topoisomerase 11 cleavage

Genomic sequencing of in vivo topoisomerase 11 cleavage sites To determine what other sequence elements, if any, might specify the location of in vivo cleavage sites, we collected direct sequence information for the seven in vivo cleavage sites located in the HI -H3 spacer region by primer extension (Saluz and Jost, 1989). DNA samples similar to those used for the experiments shown in Figure 1 were digested with the appropriate restricton enzymes and subjected to multiple rounds of hybridization to excess labelled primer and extension by Taq DNA polymerase (see Materials and methods for details). Extension products were purified and electrophoresed alongside dideoxy-terminated sequence ladders generated with the same primer. Representative autoradiograms are shown in Figure 3 for cleavage sites, 3, 4 and 5 located in the histone SAR. Other cleavage sites were similarly sequenced using different sets of primers (data not shown). For each panel shown in Figure 3, topoisomerase II cleavage products, corresponding to bands absent in control samples (lane 1) but present in samples treated with VM26 alone (lane 2) or VM26 plus distamycin (lane 3) were mapped relative to sequence ladders (distamycin is used in these experiments to enhance topoisomerase II cleavage activity, a phenomenon discussed in more detail below). The three panels show sequence information obtained using a single set of primers (primers 3 and 4, see Materials and methods) which were used to extend the upper and lower strands, respectively, for cleavage sites 3-5 within the histone SAR. Background bands, caused mainly by premature termination in AT-rich regions, were controlled by their presence in the no-drug control lane or by comparison with extension products of cloned DNA templates (not shown). Topoisomerase II cleavage products could be aligned with a band present in one of the four sequencing lanes, and correspond to polynucleotide chains originating at the labelled primer and terminating at the nucleotide given by the co-migrating band in the sequencing control. Note that bands arising from a termination event in the labelled extended strand correspond to the position of a cleavage site at the homologous position in the template strand. For instance, in the left panel of Figure 3A, using primer 3, the band visible in lanes 2 and 3 co-migrates with the G of 5'-GCAGCA in the extended upper strand but corresponds to cleavage at the first GpC step of the sequence 5'-TGCTGC in the lower strand (see the sequence given for both strands under the panel). Results for these sites, in addition to sequences at sites 1, 2, 6 and 7 (not shown), are summarized in Table I. As can be seen from Figure 3 and Table I, cleavage at all sites was remarkably precise, and consisted of single topoisomerase II cuts, with the exception of sites 4 and 5, which correspond to two distinct cuts on each strand. In contrast to in vitro cleavage products (Liu et al., 1983; Sander and Hsieh, 1983), topoisomerase II cleavage in vivo resulted in 5' overhangs with a six-base stagger instead of four. In one case, single-stranded cuts were separated by only two bases (site 4B in Figure 3B). This difference in the distance between cuts on opposite strands might be due to alterations in the structure of the DNA helix (e.g. bends or kinks) caused by nucleosomal packaging.

Strong in vivo topoisomerase I1 activity in the centromeric satellite ml repeat We sought to extend our analysis to a broader spectrum of genomic sequences. We reasoned that DNA sequences that are most susceptible to topoisomerase H cleavage might give rise to a discrete population of cleavage products that could be separated from the bulk of uncleaved sequences by virtue of their relative differences in size. Indeed, when undigested high molecular weight DNA from VM26-treated cells was hybridized to a labelled genomic probe, we observed a very regularly spaced topoisomerase II cleavage ladder. This is shown in Figure 4A (lane 2). The ladder was absent when the probe was briefly preincubated with excess cold genomic DNA to mask hybridization to repeated sequences (not shown). This result indicates that strong, regularly spaced topoisomerase II cleavage must occur in repeated DNA. We identified the repeated sequence by virtue of its restriction enzyme map and by hybridization to a specific probe as the 1.688 g/cm3 satellite (satellite III). This satellite, which is localized to the centromeric region of the X chromosome, represents 5 % of the Drosophila genome and is composed of a 359 bp AT-rich repeat (see Brutlag, 1980 for review). As in the case of SARs, most satellite III A * T base pairs are found in the form of homopolymeric A-tracts which constitute the essential determinants for the specific SAR-scaffold interaction (Kas et al., 1989). Given this sequence composition, we tested satellite HI repeats for their interaction with the nuclear scaffold. Figure 5 shows that although the 359 bp monomer is not scaffold-bound, dimers or multimers thereof are efficiently retained in the scaffold pellet fraction. As a control, we also show the specific interaction of the histone SAR with the nuclear scaffold (Mirkovitch et al., 1984). The topoisomerase II activity in the heterochromatic satellite III repeats was initially surprising but, given the known involvement of topoisomerase II in chromosome condensation (Adachi et al., 1991), not really unexpected. Since topoisomerase II plays an active role in the process of chromosome condensation, it might exert a similar role in the compaction of heterochromatin. The topoisomerase II cleavage pattern in satellite III is identical to that of the repeat generated by partial Hinfl digestion of a cloned satellite III multimer (compare lanes 1 and 3 in Figure 4B). Because a unique Hinfl restriction site is located in each repeat (Carlson and Brutlag, 1977), the in vivo topoisomerase II cleavage ladder is consistent with the presence of a unique and precisely positioned cleavage site every 359 bp. In Figure 4C we have compared the nucleosomal ladder generated by digestion with micrococcal nuclease (lanes 4-6) with the topoisomerase II cleavage pattern (lanes 2 and 3). This comparison shows that each 359 bp satellite repeat can accommodate two nucleosomes spaced every 180 nucleotides. In contrast, the nucleosome periodicity of bulk Drosophila chromatin is of 200 bp (data not shown). If topoisomerase II cleavage occurs in nucleosomal linker regions of satellite III repeats, as seems likely given the results shown above for cleavage sites 3-7 of the histone SAR, then only one nucleosome linker can be cleaved by topoisomerase II. We determined the sequence of the topoisomerase II -

709

E.Kas and U.K. Laemmli

C,

B

I

Histone T

PS

fop

4m

Scl eil;te -

.:

i*

*.W

ow

;.i

..4.

.--

--

* t Fig. 4. Extensive topoisomerase II cleavage activity in heterochromatic satellite III DNA. DNA samples from cells treated with drugs as indicated above each panel (50 ltM VM26 or VM26 plus 25 iLM distamycin, 'DIST' or 25 itM chromomycin, 'CHR') were electrophoresed without prior restriction enzyme digestion (A and B) or after digestion with HindIIL, which does not cleave most of the 359 bp repeats (C), and hybridized to total Drosophila genomic DNA (A) or to a cloned 359 bp satellite III repeat (B and C). In (B) lane 1 shows a partial Hinfl digest of plasmid clone pDm23 (Carlson and Brutlag, 1977), which contains 16 copies of the 359 bp satellite repeat; samples from lanes 5 and 6 are from cells subjected to heat-shock. Lanes 4-6 in (C) show DNA samples from nuclei digested with increasing amounts of micrococcal nuclease. (D) below shows a sliding base-composition analysis of satellite III for three adjacent HaeIII 359 bp monomers. The location of each unique topoisomerase II cleavage site, as determined in Figure 6, is given by the arrows above the diagram; shaded rectangles represent nucleosomes, assuming that these are phased and that topoisomerase II cleaves in linker sequences (see text).

cleavage site in satellite HI and found a unique and precisely positioned double-stranded cut in a prominently GC-rich region of the AT-rich repeat with a core consisting of five consecutive Cs followed by a T (Figure 6 and Table I). As was the case for the histone repeat, we found that topoisomerase II cleavage resulted in a six base stagger. The satellite III cleavage site is flanked on either side by ATrich sequences related by dyad symmetry (Figure 6). Interestingly, these AT-rich sequences were reported several years ago to constitute a specific binding site for a protein found in early Drosophila embryos (Hsieh and Brutlag, 1979a,b; Brutlag, 1980). In the diagram of Figure 4D, which depicts the putative nucleosomal structure and the location of the topoisomerase [I cleavage site of the satellite repeat, we have also included 710

2>

Fig. 5. Satellite III repeats are bound to the nuclear scaffold. Nuclear scaffolds were digested with EcoRI, XhoI plus HindlIl or with HaeIII alone to detect scaffold-bound DNA fragments in the histone and satellite III repeats, respectively (see Materials and methods). Shown are total (T), scaffold pellet (P) and supernatant (S) DNA fractions. The 1.3 kb histone SAR fragment as well as a 3.25 kb SAR from a minor variant of the histone gene repeat are indicated by filled and clear arrowheads, respectively (Mirkovitch et al., 1984). Satellite III monomers (1 X) and multimers generated by complete HaeIII digestion (Hsieh and Brutlag, 1979b) are indicated by the numbers to the right of the panel. Interbands correspond to minor variants of the repeat. a base composition plot. This diagram illustrates the notion that topoisomerase II cleavage occurs at GC-rich spikes of this highly AT-rich region. A similar partition also holds true for the cleavage sites of the histone SAR region and appears to be a hallmark of most major in vivo topoisomerase II cleavage sites (see below).

Sequence comparison of the in vivo topoisomerase 11 cleavage sites Alignment of sequences consisting of nine bases on either side of the cleavage site (Table I) did not reveal a simple topoisomerase II cleavage consensus. Scoring for each position nucleotide occurrences 2 50 % (or two nucleotides occurring at a combined frequency of 70% or more), there appeared to be several preferred nucleotides at a number of positions, for instance C at -4, T at -2, A at -1, and C at +1, +4, +5 and +12. At those positions where it is enriched, the occurrence of C is three to five times more frequent than in the surrounding 1400 bp intergenic SAR region. In contrast, based on analysis of the 20 singlestranded sequences shown, C was never found at the -2 position. These preferences were confirmed by analysis of dinucleotide frequencies (not shown); for instance, TA (at positions -2/ -1) occurs five times more frequently than in the 1400 bp Hl -H3 spacer region, AC (at 1/+1) seven times more frequently and CC (at +4/+5) 17 times more frequently. Based on these analyses, it is possible to extrapolate a preferred cleavage sequence as shown in Table I. Note that certain cleavage sites exhibit several mismatches at otherwise well-conserved positions and that selection of either the upper or lower strand of each sequence to maximize homology did not result in a better alignment. For this reason, and considering the relatively small sample size, the sequence shown in Table I should be viewed as a composite illustrating features common to the in vivo cleavage sites rather than as a 'consensus'. The sequence determined for the satellite III cleavage site conforms quite closely to the preferred cleavage sequence -

In vivo topoisomerase ll

l

2 3_

4A

cleavage

T

_w W. ..

3

i

HaeIII

342

I G + G GGAAATTAAATTTTTTGGCCACATTTTGCAAATTTT GATGACCCCCCTCCTTACAA AAAATGCGAAAATTGATCCAAAAATTAATTTCC CCTTTAATTTAAAAAACCGGTGTAAAACGTTTAAAA CTACTGGGGGGAGGAATGTT TTTTACGCTTTTAACTAGGTTTTTAATTAAAGG

T

c

71

CIL

Fig. 6. Genomic sequencing of the satellite III topoisomerase II cleavage site. Genomic sequencing was performed as described in Materials and methods using primers extending the upper and lower strands. DNA samples are the same as those shown in Figure 3 except that sequencing ladders were directly generated from genomic DNA templates. DNA contained in lane I in the left panel (upper strand) is underloaded. The sequence of the cleavage site is shown below the autoradiograms. Heavy arrows above and below the sequence represent cleavage sites on the upper and lower strands, respectively. Boxed sequences on either side of the cleavage site indicate the positions of palindromic regions of the satellite DNA (see text). The location of the unique HaeIII site, corresponding to coordinate + 1 of the satellite III sequence is also shown. Variations in the nucleotide sequence have previously been noted at positions 9 and 29 (Hsieh and Brutlag, 1979b); direct genomic sequencing reveals a greater level of sequence heterogeneity, which does not affect the results presented here. For simplicity we have consistently used the sequence published in Figure 4 of Hsieh and Brutlag (1979b).

listed in Table I, but the latter bears little, if any, relationship Drosophila in vitro cleavage consensus also shown in the table: the most conspicuous difference between them is their base composition. In contrast to the AT-rich in vitro consensus, the in vivo cleavage sequences contain a very GCrich core around the cutting site. We note that this characteristic relates them more closely to the potentially GCrich in vitro vertebrate topoisomerase II cleavage consensus also shown in the Table (Spitzner and Muller, 1988). In summary, sequencing of in vivo topoisomerase II cleavage sites in the histone SAR region as well as in satellite III repeats reveal very precise cutting by the enzyme. The strong in vitro sites are not used as primary cutting sites in vivo. Sequence analysis of 10 in vivo cleavage sites does not generate a consensus but reveals a biased sequence incorporating a GC-rich core embedded in AT-rich surroundings. The restriction of in vivo topoisomerase II cleavage to a subset of nucleosomal linkers and to DNase I-hypersensitive regions together with the observed bias for a GC-rich cleavage core suggest that features of both chromatin structure and DNA sequence govern the activity of this enzyme in the cell. to the

Modulation of topoisomerase 11 activity by distamycin, chromomycin and heat-shock We asked whether in vivo cleavage sites for topoisomerase II generally contain GC spikes. This important question was answered in the experiments described in the next section. While performing these experiments we discovered several noteworthy parameters which affect topoisomerase II cleavage activity in vivo. Distamycin is known to bind preferentially to the minor groove of oligo(dA) *oligo(dT) tracts (Van Dyke et al., 1982; Fox and Waring, 1984) such as those found in SARs (Kas

et al., 1989) and we previously demonstrated that cleavage by topoisomerase II in SARs can be suppressed by titration with distamycin (Adachi et al., 1989). Conversely, chromomycin, a drug with a strong preference for binding to GC-rich sequences (Van Dyke and Dervan, 1983; Fox and Howarth, 1985), would be expected to suppress topoisomerase HI cleavage in GC-rich regions. This is indeed the case as exemplified in the satellite III region. Addition of chromomycin to cell cultures completely suppressed the satellite III cleavage ladder (Figure 4A and B, lanes 4 and 7, respectively) in perfect agreement with the direct sequence information reported above which revealed a GC-rich core for in

vivo

cleavage sites.

As a control, we also studied the effect of distamycin which specifically binds AT-rich DNA. When added to cells, this drug did not cause an alteration of the cleavage pattern, but, interestingly, led to an enhancement of cleavage in the satellite III repeat (Figure 4A and B, compare lanes 2 and 3 and lanes 3 and 4, respectively). This enhancement of cleavage by distamycin is apparent in Figure 4 from the increased intensity of the cleavage bands as well as the extension of the digestion ladder to lower repeat units including the 359 bp monomer. Also included in Figure 4 is the topoisomerase II cleavage pattern of satellite III in heat-shocked cells. Heat-shock led to a very strong diminution of the satellite HI cleavage pattern (Figure 4B, compare lanes 3 and 5) as previously observed for sites 3-7 of the histone SAR (Figure 1). Most interestingly, addition of distamycin to the heat-shocked cells restored the prominent satellite III cleavage ladder (Figure 4B, lane 6). Qualitatively similar results regarding the effect of these drugs as well as heat-shock were observed for the cleavage sites located in the histone repeat. Chromomycin suppressed cleavage at most of the linker and open sites (Figure 7A, 711

E.Kas and U.K. Laemmli

The GC-rich core is a general feature of in vivo topoisomerase 11 cleavage sites To test whether topoisomerase II cleavage in vivo generally occurs at GC-rich sites in Drosophila chromatin, we performed the following experiment. In order to avoid DNA shearing during isolation, cells treated as above were encapsulated in agarose before lysis. Plugs of purified DNA were then subjected to field inversion gel electrophoresis (FIGE, Carle et al., 1986), transferred to nylon membranes and hybridized to a total genomic DNA probe. The autoradiograph shown in Figure 7B shows that little or no DNA entered the gel in the sample from control cells or migrated at limiting mobility (lane 1). In contrast, addition of VM26 led to a large reduction in the molecular weight of the cellular DNA, yielding topoisomerase II cleavage products of 100-300 kb average size (lane 2). The presence of distamycin (lane 3) did not cause an additional reduction in the DNA fragment size. In contrast, treatment of cells with chromomycin had a dramatic effect, completely abolishing topoisomerase II cleavage and yielding DNA fragments of an average size similar to that in the control drug-free sample (lane 4). Thus, the inhibition of topoisomerase H cleavage by chromomycin that we observe in the satellite III and histone gene repeats also applies to bulk genomic DNA sequences. In view of the known sequence specificity of chromomycin binding to DNA, it is therefore probable that most genomic topoisomerase II cleavage sites, including those located in AT-rich SARs, occur in or near sequences locally enriched in G C base

P '

j

*

IfI la

is

IW'IWW..

a

"W .0

"lo

IIAW.

a.00- #AW,

Fig. 7. The effect of sequence-specific DNA minor groove binders on topoisomerase II cleavage. In vivo topoisomerase II cleavage sites were analysed as in Figure 1. In (A) lanes 1-6 contain DNA samples from Kc cells treated with no drugs (lane 1), 50 ltM VM26 (lanes 2 and 4), VM26 plus 25 yM distamycin (lanes 3 and 5) or VM26 plus 25 ,uM chromomycin (lane 6). Samples were purified from control cells (lanes 1, 2, 3 and 6) or from cells subjected to heat-shock (lanes 4 and 5). In vivo cleavage sites are numbered as in preceding figures. Cleavage site 10 is not clearly visible in this exposure. (B) cells treated with no drugs (lane 1), VM26 alone (lane 2), or VM26 plus distamycin (lane 3) or chromomycin (lane 4) were embedded in agarose before lysis and the DNA fractionated by FIGE before hybridization to a labelled total genomic DNA probe (the radioactive hybridization signal is indistinguishable from the ethidium bromide-stained gel and considerably easier to see). Numbers (in kbp) to the left of the panel indicate the positions of molecular weight markers (bacteriophage X digested with HindIII or EcoRI and X multimers). Hybridization to repeated sequences was suppressed by hybridization of the probe to excess cold genomic DNA (Ardeshir et al., 1983).

lane 6). Note that although total cleavage activity is strongly reduced in the presence of chromomycin, two new sites were observed in the SAR region. These sites might be quite ATrich and are consequently not titrated by the concentration of chromomycin used. Thus, the drug does not block all topoisomerase II cleavage activity in treated cells. Distamycin, however, enhanced cleavage activity at the linker but not the open sites. We have found the extent of cleavage stimulation to be somewhat variable, ranging, for the experiment shown in Figure 7A, between 3- and 7-fold for the different linker sites (compare lanes 2 and 3). This enhancement is particularly evident for the linker sites in heat-shocked cells where distamycin largely restored cleavage in the SAR spacer region (compare lanes 4 and 5). Under other experimental conditions, an even greater stimulation is observed as reported in detail elsewhere (E.Kas, L.Poljak, Y.Adachi and U.K.Laemmli, submitted). -

712

pairs.

Discussion Topoisomerase 11 cleaves in the nucleosomal linkers of the histone SAR and of satellite ill repeats This paper presents a detailed analysis of in vivo topoisomerase II activity aimed at characterizing determinants of DNA sequence or of chromatin structure that affect the activity of this enzyme in the cell. In addition, these studies provide a foundation for the further analysis of the role of this enzyme in chromosome condensation. We focused our effort on the histone gene cluster and, by serendipity, on the satellite III repeat. The histone gene cluster, which is -5 kb in size, contains all five histone genes and serves as a model chromatin loop or domain whose analysis is facilitated by its 100-fold tandem repetition. While our analysis relies upon the use of VM26, it is unlikely that the topoisomerase II cleavage products we detect in living cells correspond to a subset of cleavage sites selected by the drug. We have obtained identical results in vivo using the inhibitor m-AMSA (Nelson et al., 1984), although the two drugs enhance cleavage at different sites in vitro (see Darby et al., 1986; E.Kas, unpublished results). Two classes of topoisomerase II cleavage sites can be distinguished. One class has been previously observed by a number of laboratories and consists of open sites that co-localize with DNase I-hypersensitive or open chromatin regions (Rowe et al., 1986; Muller and Mehta, 1988; Reitman and Felsenfeld, 1990). The other novel class maps to a select number of consecutive nucleosome linker sites (sites 3-7, Figure 2) in the H1 -H3 intergenic region encompassing the SAR of the histone gene repeat. This -

In vivo topoisomerase 11 cleavage

scaffold-associated region of 650 bp operationally defines the base of the histone gene loop (Mirkovitch et al., 1984). In contrast to our observations, previous studies on topoisomerase II cleavage in chromatin have shown weak or no cleavage in the histone SAR, although cleavage was readily detected at open sites (Udvardy et al., 1986; Villeponteau, 1989). These conflicting results are due to the use of isolated nuclei rather than cells by these authors. As will be reported in detail elsewhere, nuclei are, under standard experimental conditions, selectively poor substrates for cleavage at the nucleosomal linker sites of the histone SAR and satellite III repeats. This loss of cleavage is due to the preferential association of histone HI to these linker DNAs during nuclear isolation and subsequent incubations. Selective extraction of H 1 from nuclei results in a large and specific activation of topoisomerase II cleavage at these sites (Kas et al., submitted). Our primary interest in these experiments stems from the notion that topoisomerase II may exert its role in chromosome structure and dynamics enzymatically or structurally via interaction with SAR sequences (Adachi et al., 1989, 1991). Topoisomerase II highly selectively binds, aggregates and cleaves SARs in vitro (Adachi et al., 1989; Sperry et al., 1989). Although very marked differences are noted when in vivo and in vitro cleavage patterns are compared, the finding that the histone SAR is a site of clustered topoisomerase II cleavage in the cell provides support for the existence of a selective SAR-topoisomerase II interaction in vivo. The results observed with satellite III DNA are most compelling in this respect. The 359 bp satellite Ill monomer resembles SAR sequences with which it shares a high A + T content (69 %) largely distributed in oligo(dA) - oligo(dT) tracts; these tracts constitute the important sequence determinants for the specific SAR-scaffold interaction (Kas et al., 1989). Our current view is that A-tracts distributed over several hundred base pairs constitute a SAR. Indeed, the satellite multimers (but not the 359 bp monomer) are bound to nuclear scaffolds (Figure 5). The prominant topoisomerase II cleavage ladder observed in satellite III DNA convincingly demonstrates that this region is a major in vivo target for topoisomerase II at nucleosomal linker sites. Based on its repeat length, sequence complexity and the presence of oligo(dA) * oligo(dT) tracts, which differentiate it from other Drosophila AT-rich repeats, satellite III resembles alphoid satellites of higher eucaryotes, and it will be of interest to extend these analyses to other types of DNA repeats and to other species. What is the role of topoisomerase II in the presumably transcriptionally inert satellite III chromatin? This satellite is found in the centromeric heterochromatin of the X chromosome (for a review, see Brutlag, 1980). The satellite III cleavage result suggest that topoisomerase II might be involved in compaction of heterochromatin as well as chromosome condensation. The interaction of topoisomerase II with specialized centromeric DNA sequences might nucleate as well as establish the polarity for the subsequent molecular events that lead to mitotic chromosome condensation. If topoisomerase II is implicated in the compaction of heterochromatin, then future experiments might identify it as belonging to the class of gene products acting as modifiers of position effect variegation (for review see Eissenberg, 1989; Pirotta, 1990). -

Chromatin structure and DNA sequence features govern topoisomerase 11 cleavage activity DNase I-hypersensitive regions are usually associated with transcriptional activity of genes, generally serving as entry or binding sites for the different non-histone proteins which make up the transcriptional machinery. Although topoisomerases could possibly be involved in establishing the transcriptional potential of chromatin, they appear not to be directly involved in the process of transcription but in the regulation of transcription-dependent torsional stress (Liu and Wang, 1987; Brill and Sternglanz, 1988). An open chromatin configuration appears to be a necessary (Capranico et al., 1990) but not sufficient condition for cleavage at these sites. Studies from other laboratories have shown that strong topoisomerase II cleavage occurs in nuclease-hypersensitive regions but not all hypersensitive regions are cleaved by this enzyme in vivo (Muller and Mehta, 1988; Reitman and Felsenfeld, 1990). In this context, we note that heat-shock induces a complex alteration of the cleavage pattern in the histone repeat which is indicative of cellular regulation of topoisomerase II activity. The appearance of heat shock-dependent sites in open chromatin regions near the 5' ends of the histone genes may be related to the curious phenomenon of transcriptional activation of the Drosophila histone genes by heat-shock (Burckhardt and Birnstiel, 1978). Interestingly, while heat-shock induces cleavage at new open sites (1 and 8), cleavage at the linker sites of the SAR is strongly diminished. An equally strong reduction is observed for cleavage in satellite III repeats; in both cases, cleavage can be restored by treatment with distamycin (see below). Topoisomerase II cleavage at nucleosomal linker sites is not solely a consequence of chromatin accessibility as classically defined by micrococcal nuclease digestion. Restriction of topoisomerase II cleavage by nucleosomes has been previously suggested by the study of Capranico et al. (1990), using SV40 DNA reconstituted with core histones in vitro. Cleavage occurs only at a subset of such linker sites in the intergenic histone SAR region and we do not observe strong cleavage in coding regions of the histone genes. Cleavage at linker sites may be in part reinforced by the phased nucleosomes found in the SAR region (Worcel et al., 1983), but this cannot be the primary reason for the observed selectivity. This is best exemplified by the satellite 11 results. Drosophila satellite III repeats are packaged into nucleosomes, as determined by detailed two-dimensional mapping experiments (Levinger and Varshavsky, 1982a,b). The periodicity of the satellite III nucleosomal ladder generated by micrococcal nuclease is of 180 bp, half the value of the repeat length (Figure 4C). Thus, each satellite repeat can be thought to contain two nucleosomes which are phased relative to the topoisomerase II cleavage site as depicted in the diagram of Figure 4D, resulting in a ladder with a periodicity of 359 bp. Although we have not analysed nucleosome phasing in satellite HI repeats, the site-specific topoisomerase II pattern observed there must be due to cleavage at one but not the other nucleosomal linker found in each repeat. Sequences near the topoisomerase II cleavage site and those found 180 bp away are accessible to microccocal nuclease (see Figure 4C), DNase I (data not shown) and to restriction enzymes (Kas et al., submitted), indicating that these regions indeed correspond to internucleosomal linker DNA. Thus, topoisomerase II cleavage 713

E.Kas and U.K. Laemmli occurs at only some linker sites and enhanced cleavage at these sites cannot be explained solely by nucleosome phasing.

DNA sequence and topoisomerase 11 cleavage Topoisomerase II cleavage occurs in vivo at non-random sequences which are clearly unrelated to the Drosophila ATrich in vitro consensus (Sander and Hsieh, 1985). This point is evident from a simple comparison of the in vivo versus in vitro cleavage patterns of the Drosophila histone genes

(Figure lA).

Our determination of the sequence of 10 in vivo cleavage sites confirms that they are localized to GC-rich spikes embedded in very AT-rich regions. Since topoisomerase II binds preferentially to AT-rich blocks of DNA in vitro

(Adachi et al., 1989), oligo(dA) oligo(dT) tracts surrounding cleavage sites may position topoisomerase II for efficient cleavage. Cleavage at GC-rich sequences appears to be the hallmark of most genomic cleavage sites as shown by the dramatic suppression of topoisomerase II activity by chromomycin (Figure 7B). Note that chromomycin does not inhibit DNA cleavage by topoisomerase II in vitro; rather, titration of G C base pairs by the drug redistributes the enzyme to AT-rich sequences (Adachi et al., 1989). Other causes that might explain the inhibition of topoisomerase II cleavage by chromomycin (e.g. drug-induced changes in DNA or chromatin conformation) cannot entirely be ruled out at present. But the fact that several in vivo cleavage sites located in the histone SAR correspond to sequences specifically bound by the drug in vitro (Kis et al., 1989) most likely indicates that chromomycin binding to GC-rich cleavage sites is a predominant cause of cleavage inhibition and strongly supports our conclusions. The biased sequence composition recognized by topoisomerase II also accounts for the preferred nucleotides found at several positions of the cleavage sites we have analysed. Based on this analysis a preferred cleavage

sequence can be derived as shown in Table I. While several sites do not conform well to this composite sequence, it is likely that some aspect of it is recognized by topoisomerase II. One recognizable structural feature might be DNA curvature resulting from embedding blocks of dG * dC base pairs within AT-rich sequences (Wu and Crothers, 1984). Such a mode of recognition has recently been shown to be

operative

in vitro

(Howard

et

al., 1991).

The geometry of the topoisomerase II double-stranded cut at all but one of the sites sequenced in this study shows a six base stagger, in contrast to the four base stagger observed in vitro (Liu et al., 1983; Sander and Hsieh, 1983). We do not yet know whether this difference is due to DNA sequence alone or if it is specific to chromatin. Since topoisomerase II appears to cut both strands of DNA sequentially and shows a sequence preference for first-strand scission (Lee et al., 1989; Zechiedrich et al., 1989), the exact position of cleavage on the second stand might be determined by its position relative to the protein. It is therefore possible that, in chromatin, a different stagger might occur as a result of alterations in the structure of the DNA helix arising from modulation in groove width upon nucleosomal packaging (Drew and Travers, 1983). Our observation that distamycin selectively enhances cleavage in vivo at SAR and satellite sites suggests that oligo(dA) -oligo(dT) tracts flanking the GC-rich sites are somehow involved in the regulation of topoisomerase II 714

interactions with SAR sequences. The observation that treatment with the drug largely restores cleavage at these sites in heat-shocked cells (Figure 4B and 6A) provides additional support for this notion. Distamycin might enhance cleavage by altering DNA structure at or near cleavage sites (Fesen and Pommier, 1989). Alternatively, the drug might displace dA * dT-specific DNA binding proteins which sterically hinder cleavage at the nucleosomal linkers of the SAR. Experiments reported elsewhere strongly support this notion (Kas et al., submitted) and suggest that other proteins might facilitate topoisomerase II cleavage in much the same manner as distamycin. In this light, it is quite remarkable that the satellite cleavage site is flanked on either side by AT-rich sequences shown several years ago to constitute a specific binding site for a Drosophila protein (Hsieh and Brutlag, 1979a, 1980).

Materials and methods In vivo topoisomerase 11 cleavage assays Suspension cultures of exponentially growing Kc cells (-3-4 x 10l cells/mi at 25°C) were treated with 50 AM VM26 (a gift from Bristol -Myers) for 20 min. Where indicated, cells were first treated with 25 ,LM distamycin (Sigma) or chromomycin (Fluka) for 30 min before addition of VM26. Heat-shocked cells were grown at a temperature of 37°C for 20 min before addition of VM26 and continued incubation at the elevated temperature. Treatment with distamycin or chromomycin was performed during the initial incubation at 37°C. Aliquots of 2 x 108 cells were pelleted for 5 min at 800 g and lysed in 5 ml of 20 mM Tris-HCl pH 8.0, 1% SDS, followed by addition of EDTA to 15 mM and proteinase K to 400 jig/ml. The lysate was incubated at 37°C for 16 h with gentle shaking. DNA was purified by organic extraction and ethanol precipitation, RNase-treated and repurified.

Digestion of isolated nuclei and of nuclear scaffolds Nuclei were prepared as described (Mirkovitch et al., 1984) from exponentially growing Kc cells. One A260 unit of nuclei in 150 Al digestion buffer (20 mM Tris-HCl, pH 7.4, 20 mM KCI, 70 mM Nacl, 10 mM MgCl2, 2.5 mM CaC12, 0.05 mM spermine, 0.125 mM spermidine, 0.1% digitonin, 0.5 mM DTT, 100 units/ml Trasylol, 0.2 mM PMSF) was digested with 0.2 U micrococcal nuclease (Sigma) or 0.2 U DNase I (DPFF grade, Worthington) for 0.5-2 min at 30°C. Purified DNA samples were processed as described below for Southern blot analysis. For the experiment shown in Figure 3, nuclear scaffolds prepared as described by Mirkovitch et al. (1984) were digested with EcoRI, AoI plus HindIII or with HaeLI alone to detect scaffold-bound fragments in the histone gene and satellite III repeats, respectively. Equal amounts (250 ng each) of total, bound and supernatant DNA fractions were electrophoresed on a 1.2% agarose gel and hybridized to a probe spanning the histone gene repeat or to a satellite III 359 bp probe.

In vitro topoisomerase 11 cleavage of DNA Plasmid clone Dm506 (a 5 kb HindIII fragment containing the large histone gene repeat from Drosophila melanogaster cloned into the HindlIl site of pBR322) was digested with HindlIl and incubated with various amounts of purified S.pombe topoisomerase II in the presence of sonicated salmon sperm competitor DNA. Cleavage reactions were performed exactly as described previously (Adachi et al., 1989). Purified DNA samples were analysed by Southern blotting alongside samples from in vivo cleavage reactions.

Gel electrophoresis and Southern blotting Purified DNA samples were digested with HindlIl and electrophoresed through 1.2% 23 cm agarose gels overnight at 65 V in I x TBE buffer. After ethidium bromide staining the gels were treated with 0.4 N NaOH, equilibrated in transfer buffer (12 mM Tris, 6 mM sodium acetate, 0.3 mM EDTA, pH 7.5) and electroblotted onto nylon membranes (Hybond N+, Amersham). The DNA was fixed onto the membranes by treatment with NaOH according to the manufacturer's instructions. Following a brief rinse in 5 x SSPE, pH 7.4, filters were prehybridized in sealed plastic bags containing 0. 1 ml/cm2 of membrane of 3 x SSPE, pH 7.4, 5 x Denhardt's, 1% SDS, 6 M urea (ultra-pure grade, ICN), 50 Ag/ml

In vivo topoisomerase 11 cleavage

sonicated denatured salmon sperm DNA and 8 % dextran sulphate (Pharmacia) for 1-2 h at 42°C. Cleavage products were detected by indirect end-labelling using a 300 bp HindIll-PstI fragment spanning the 5' coding region of the HI gene. Hybridization probes generated by the random primer labelling procedure (Feinberg and Vogelstein, 1983) were added to the bags together with fresh salmon sperm carrier DNA and hybridizations were performed for 14- 18 h at 42°C. We find that urea at a concentration of 6 M advantageously replaces formamide in hybridizations carried out at 42°C. Filters were washed in 0.1 x SSPE, 0.1% SDS at 65°C. Band intensities were quantified by densitometer scanning of exposed films. For FIGE, Kc cells treated with drugs as described above were embedded in agarose as described by Filipski et al. (1990), except that cell suspensions were drawn into 2 mm diameter PVC tubing. All wash solutions contained the same concentrations of drugs (VM26, distamycin or chromomycin) used to treat the cells. Aliquots of 2 x 108 Kc cells were embedded in a 400 A1 volume. For electrophoresis, 8 mm long agarose plugs (containing - 2.5 1zg of genomic DNA) were inserted into the wells of a 0.8% agarose gel cast in 0.5 x TBE running buffer. Samples were allowed to run into the gel for 10 min at 150 V after which time FIGE was performed for 16 h at 150 V at room temperature using program S of a PPI-200 programmable power inverter (MJ Research, Cambridge, MA). Southern blotting was as described above, except that the gels were treated for 5 min in 0.25 N HCI before the denaturation step. Filters were hybridized to total Drosophila genomic DNA probes labelled as described above. For the experiment shown in Figure 7B, hybridization to repeated DNA sequences was blocked by preincubation of the probe with excess cold genomic DNA (Ardeshir et al., 1983). For the experiments shown in Figure 4, genomic DNA samples were electrophoresed onto 1.2% agarose gels without prior digestion with restriction enzymes or after digestion with HindIl. Hybridizations to genomic probes (without selective reannealing of repeated sequences) or to cloned satellite probes were performed as described above.

Genomic sequencing of topoisomerase 11 cleavage sites The genomic sequencing procedure of Saluz and Jost (1989) was used with only minor modifications. 27mer primers were synthesized as described from complementary 33mers and 9mers in the presence of a sufficient amount of [ca32P]dATP (Amersham, >-3000 Ci/mmol). Labelled primers were gel-purified. One primer used for extension in the histone SAR - spacer region consisted of a 33mer that was end-labelled with [-y-32P]ATP and polynucleotide kinase (primer 2) and primers used for analysis of the satellite III repeat were end-labelled 27mers (see below). Preliminary histone sequence information used for selection of primers is from Goldberg (1979) and from unpublished data kindly provided by Paul Schedl and collaborators. A 1400 bp sequence, determined from several experiments similar to those shown in Figure 3 was obtained and has been entered in the EMBL Nucleotide Sequence Database under the accession number X60225 (D. Melanogaster HI H3 DNA). This sequence extends from positions +32 to -1368 relative to the ATG of the HI gene (position + 1). The end of the coding region of the H3 gene is 38 bases beyond position -1368. Six different primers with the following sequence coordinates were used for extension through the H1 -H3 spacer region. Primer 1, +31 to +5 (upper strand); primer 2, -418 to -386 (lower strand); primer 3, -392 to -418 (upper strand); primer 4, -1020 to -994 (lower strand); primer 5, -994 to -1020 (upper strand); primer 6, -1354 to -1328 (lower strand). The DNA sequence used for analysis of the 359 bp satellite III repeat is from Figure 4 of Hsieh and Brutlag (1979b). End-labelled primers used for genomic sequencing had sequence coordinates 273-299 (primer 1, upper strand) and 299-273 (primer 2, lower strand). Genomic DNA samples from cells treated as described above were digested with the appropriate restriction enzymes. For use with primers 1 and 2 of the histone HI -H3 spacer region, samples were digested with MboI, which cuts at positions +94 and -527. For use with primers 3 and 4, samples were digested with Hinfl, which cuts at positions -352 and - 1046. Finally, for use with primers 5 and 6, samples were digested with SspI and PstI, which cut at positions -963 and -1539, respectively. For use with satellite primer 1, DNA samples were digested with HindIII, which does not cleave most of the 359 bp repeats; for use with primer 2, samples were digested with DdeI, which cleaves at position 299. Primer extensions were carried out as described by Saluz and Jost (1989) using 1 ztg of digested DNA and 1-5 x 106 c.p.m. labelled primer per sample. Taq DNA polymerase (2.5 U) (Perkin Elmer-Cetus) was added to 100 11 reactions in the buffer recommended by the manufacturer supplemented with 4.5 mM MgCl2 (final concentration) and 10 AM of each deoxynucleotide (Boehringer Mannheim). In some experiments, Taq DNA polymerase (Boehringer Mannheim) was used in the reaction buffer supplied by the manufacturer and 4.5 mM MgCl2 with equally satisfactory results. Samples were subjected to 20-30 cycles of 1 min denaturation at 95°C,

2 min hybridization at 61 °C and 3 min extension at 72°C in a Perkin ElmerCetus DNA thermal cycler. Sequencing ladders were generated from similarly digested, appropriately diluted cloned DNA templates or from genomic DNA templates. Reaction mixtures were prepared exactly as above, except that extensions were carried out in the presence of 400 JIM ddATP, 300 AM ddCTP, 100 ltM ddGTP or 600 uM ddTTP (Boehringer Mannheim). Purified DNA samples were electrophoresed on thin sequencing

gels.

Acknowledgements We are grateful to Drs Tao-shih Hsieh and Douglas Brutlag for gifts of cloned Drosophila satellite DNA. We thank Drs Yasuhisa Adachi, Brian Davis and Leonora Poljak for stimulating discussions and for critical reading of the manuscript and Drs Henry Krisch and Ueli Schibler for comments on the manuscript. We also thank O.Jenni and F.Bujard-Ebener for preparation of the figures. Unpublished sequence information for the histone SAR was kindly made available by Dr Paul Schedl. This work was supported by the Swiss National Fund and by the Canton of Geneva.

References Adachi,Y., Kas,E. and Laemmli,U.K. (1989) EMBO J., 8. 3997-4006. Adachi,Y., Luke,M. and Laemmli,U.K. (1991) Cell, 64, 137-148. Amati,B.B. and Gasser,S.M. (1988) Cell, 54, 967-978. Ardeshir,F., Giulotto,E., Zieg,J., Brison,O., Liao,W.S.L. and Stark,G. (1983) Mol. Cell. Biol., 3, 2076-2088. Berrios,M., Osheroff,N. and Fisher,P.A. (1985) Proc. Natl. Acad. Sci. USA, 82, 4142-4146. Brill,S.J. and Sternglanz,R. (1988) Cell, 54, 403-411. Brutlag,D.L. (1980) Annu. Rev. Genet., 14, 121-144. Burckhardt,J. and Birnstiel,M.L. (1978) J. Mol. Biol., 118, 61-79. Capranico,G., Jaxel,C., Roberge,M., Kohn,K.W. and Pommier,Y. (1990) Nucleic Acids Res., 18, 4553-4559. Carle,G.F., Frank,M. and Olson,M.V. (1986) Science, 232, 65-68. Carlson,M. and Brutlag,D. (1977) Cell, 11, 371-381. Chen,G.L., Yang,L. Rowe,T.C., Halligan,B.D., Tewey,K.M. and Liu,L.F. (1984) J. Biol. Chem., 259, 13560-13566. Cockerill,P.N. and Garrard,W.T. (1986) Cell, 44, 273-282. Darby,M.K., Herrera,R.E., Vosberg,H.-P. and Nordheim,A. (1986) EMBO J., 5, 2257-2265. DiNardo,S., Voelkel,K. and Sternglanz,R. (1984) Proc. Natl. Acad. Sci. USA, 81, 2616-2620. Drew,H.R. and Travers,A.A. (1985) J. Mol. Biol., 186, 773-790. Earnshaw,W.C., Halligan,B., Cooke,C.A., Heck,M.S. and Liu,L.F. (1985) J. Cell Biol., 100, 1706-1715. Eissenberg,J.C. (1989) BioEssays, 11, 14-17. Feinberg,A.P. and Vogelstein,B. (1983) Anal. Biochem., 132, 6-13. Fesen,M. and Pommier,Y. (1989) J. Biol, Chem., 264, 11354-11359. Filipski,J., Leblanc,J., Youdale,T., Sikorska,M. and Walker,P.R. (1990) EMBO J., 9, 1319-1327. Fox,K.R. and Howarth,N.R. (1985) Nucleic Acids Res., 13, 8695-8714. Fox,K.R. and Waring,M.J. (1984) Nucleic Acids Res., 12, 9271-9285. Gasser,S.M. and Laemmii,U.K. (1986) EMBO J., 5, 511-518. Gasser,S.M. and Laemmli,U.K. (1987) Trends Genet., 3, 16-21. Gasser,S.M., Laroche,T., Falquet,J., Boy de La Tour,E. and Laemmli,U.K. (1986) J. Mol. Biol., 188, 613-629. Goldberg,M.L. (1979) Doctoral thesis, Stanford University. Holm,C., Goto,T., Wang,J.C. and Bostein,D. (1985) Cell, 41, 553-563. Howard,M.T., Lee,M.P., Hsieh,T.-S. and Griffiths,J.D. (1991) J. Mol. Biol., 217, 53-62. Hsieh,T.-s. Brutlag,D.L. (1979a) Proc. Natl. Acad. Sci. USA, 76, 726-730. Hsieh,T.-s. and Brutlag,D. (1979b) J. Mol. Biol., 135, 465-481. Kas,E., Izaurralde,E. and Laemmli,U.K. (1989) J. Mol. Biol., 210, 587-599. Lee,M.P., Sander,M. and Hsieh,T.-s. (1989) J. Biol. Chem., 264, 13510-13518. Levinger,L. and Varshavsky,A. (1982a) Cell, 28, 375-385. Levinger,L. and Varshavsky,A. (1982b) Proc. Natl. Acad. Sci. USA, 79, 7152-7156. Lewis,C.D. and Laemmli,U.K. (1982) Cell, 29, 171-181. Liu,L.F. and Wang,J.C. (1987) Proc. Natl. Acad. Sci. USA, 84, 7024-7027. Liu,L.F., Rowe,T.C., Yang,L., Tewey,K.M. and Chen,G.L. (1983) J. Biol. Chem., 258, 15365-15370.

715

E.Kas and U.K. Laemmli

Lohka,M.J. and Maller,J.L. (1985) J. Cell Biol., 101, 518-523. Mirkovitch,J., Mirault,M.-E. and Laemmli,U.K. (1984) Cell, 39, 223 -232. Muller,M.T. and Mehta,V.B. (1988) MoL Cell. Biol., 8, 3661-3669. Nelson,E.M., Tewey,K.M. and Liu,L.F. (1984) Proc. Natl. Acad. Sci. USA, 81, 1361-1365. Newport,J. (1987) Cell, 48, 205-217. Newport,J. and Spann,T. (1987) Cell, 48, 219-230. Paulson,J.R. and Laemmli,U.K. (1977) Cell, 12, 817-828. Pirotta,V. (1990) BioEssays, 12, 409-414. Reitman,M. and Felsenfeld,B. (1990) Mol. Cell. Biol., 2774-2786. Rowe,T.C., Wang,J.C. and Liu,L.F. (1986) Mo. Cell. Biol., 6, 985-992. Saluz,H. and Jost,J.-P. (1989) Proc. Natl. Acad. Sci. USA, 86, 2602-2606. Sander,M. and Hsieh,T.-s. (1983) J. Biol. Chem., 258, 8421-8428. Sander,M. and Hsieh,T.-s. (1985) Nucleic Acids Res., 13, 1057-1072. Sperry,A.O., Blasquez,V.C. and Garrard,W.T. (1989) Proc. Natl. Acad. Sci. USA, 86, 5497-5501. Spitzner,J.R. and Muller,M.T. (1988) Nucleic Acids Res., 16, 5533-5556. Sternglanz,R. (1989) Curr. Opin. Cell Biol., 1, 533-535. Udvardy,A., Schedl,P., Sander,M. and Hsieh,T.-s. (1985) Cell, 40, 933-941. Udvardy,A., Schedl,P., Sander,M. and Hsieh,T.-S. (1986) J. Mol. Biol., 191, 231-246. Uemura,T.M. and Yanagida,M. (1984) EMBO J., 3, 1737-1744. Uemura,T., Ohkura,H., Adachi,Y., Morino,K., Shiozaki,K. and Yanagida,M. (1987) Cell, 50, 917-925. Van Dyke,M.W. and Dervan,P.B. (1983) Biochemistry, 22, 2373 -2377. Van Dyke,M.W., Hertzberg,R.P. and Dervan,P.B. (1982) Proc. Natl. Acad. Sci. USA, 79, 5470-5474. Villeponteau,B. (1989) Biochem. Biophys. Res. Commun., 162, 232 -237. Wang,J.C. (1987) Biochim. Biophys. Acta, 909, 1-9. Worcel,A., Gargiulo,G., Jessee,B., Udvardy,A., Louis,C. and Schedl,P. (1983) Nucleic Acids Res., 11, 421-439. Wu,H.M. and Crothers,D.M. (1984) Nature, 308, 509-513. Yang,L., Rowe,T.C., Nelson,E.M. and Liu,L.F. (1985) Cell, 41, 127-132. Zechiedrich,E.L., Christiansen,K., Andersen,A.H., Westergaard,O. and Osheroff,N. (1989) Biochemistry, 28, 6229-6236. Received on July 12, 1991; revised on October 31, 1991

716