VIROLOGY
187, 464-47 1 (1992)
ln vivo Recognition
of Orf Virus Early Transcriptional in a Vaccinia Virus Recombinant
Promoters
STEPHEN B. FLEMING, ANDREW A. MERCER, KATE M. FRASER, DAVID J. LYTTLE, AND ANTHONY-I. ROBINSON’ Health Research Council of New Zealand, virus Research Unit, and Centre for Gene Research, University of Otago, P. 0. Box 56, Dunedin, New Zealand Received October 8, 1991; accepted
November
18, 1991
The 4.4-kb BarnHI-E fragment of the orf virus (OV) genome contains three discrete open reading frames designated ORF-pp, ORF-1, and ORF-3, all of which are flanked by vaccinia virus-like early transcriptional control sequences. To determine whether the vaccinia transcriptional machinery would recognize these promoters and faithfully transcribe OV genes in viva the BamHI-E fragment was inserted into the thymidine kinase (TK) locus of vaccinia virus and the recombinant used in transcription studies. Northern blotting analysis of early RNA isolated from 143B-TK- cells infected with the recombinant virus showed that OV genes were transcribed and that the three transcripts of 0.70(ORF-pp), 0.48- (ORFl), and 0.75-kb (ORF-3) were the same size as their counterparts in OV-infected cells. Analysis of the 5’ end of transcripts by Si nuclease and primer extension showed that the transcriptional start points (tsp) of ORF-pp, ORF-1, and ORF-3 in the recombinant were identical or within four nucleotides of the tsps of the same ORFs in OV. However, there were quantitative differences. ORF-1 was transcribed more efficiently in recombinant virus-infected cells than in those infected with OV and analysis of the putative promoter, 5’-AAAATTGTAAAATGTA, showed that it was similar to the 7.5-kDa early promoter of vaccinia virus. This demonstrates that the transcriptional control sequences of OV genes are recognized by vaccinia virus transcriptional factors but that quantitative differences exist suggesting that the generically different transcriptional factors have different promoter sequence requirements for maximal transcription. 0 1992 Academic Press, hc
INTRODUCTION
genes coupled to the vaccinia virus P7.5 early/late promoter (Gershon and Black, 1989). In addition to these functional assays, strong homologies have been detected between early (Cochran eta/., 1985; Pluciennczak eta/., 1985; Mars and Beaud, 1987; Vassef, 1987; Davison and Moss, 1989a) and late (Bertholet et al., 1986; Rose1 et al., 1986; Weir and Moss, 1987; Davison and Moss, 1989b) promoters of vaccinia virus and sequence elements of fowlpoxvirus (Binns eta/., 1987; Drillien eta/., 1987) capripoxvirus (Gershon and Black, 1989), and OV (Fraser et al., 1990; Fleming et al., 1991; S. B. Fleming, J. Blok, A. A. Mercer, K. M. Fraser, and A. J. Robinson, manuscript in preparation). Also conserved are the early transcriptional termination signals having the general sequence T5NT (Rohrmann et al., 1986; Yuen and Moss, 1987). Although OV early and late promoter elements and the early transcriptional termination signals resemble those in vaccinia virus the genome is otherwise G+Crich (Wittek et al., 1979; Fraser et al., 1990) in contrast to the A+T-rich genome of most other poxviruses. It was not known if the vaccinia virus transcriptional machinery would recognize these promoters in vaccinia virus recombinants containing fragments of OV DNA and faithfully transcribe OV genes. In an attempt to answer this question, at least for early promoters, viral transcripts from cells infected with a recombinant vac-
Orf virus (OV) is the type species in the parapoxvirus genus of the family Poxviridae (Matthews, 1982). For a review of the biology of OV see Robinson and Balassu (1981) and Robinson and Lyttle (1991). We are interested in using vaccinia virus recombinant technology to identify genes important in inducing a protective response to infection by OV. The strategy is to construct a set of vaccinia virus recombinants containing large overlapping fragments of the OV genome and to use these recombinants in immunological assays on the assumption that OV promoters would be recognized by the vaccinia virus transcriptional apparatus. Cross-generic recognition of early and late promoters in the poxviridae has been reported previously. Vaccinia virus promoter sequences P7.5 (early) and PLl 1 (late) have been used to express foreign genes in fowlpox virus (Boyle and Coupar, 1988) and similarly, the fowlpox virus thymidine kinase promoter has been shown to operate in vaccinia virus (Boyle and Coupar, 1986; Boyle et a/., 1987). In a transient expression system, capripoxvirus-infected cells were able to express ’ To whom correspondence dressed. 0042-6822/92
and reprint requests
$3.00
Copyright 0 i 992 by Academic Press, Inc. All rights of reproduction in any form reserved.
should be ad-
464
IN VW0 RECOGNITION
OF ORF VIRUS EARLY TRANSCRIPTIONAL
cinia virus in which the OV BarnHI-E fragment was inserted into the thymidine kinase (TK) gene of vaccinia virus were analyzed by Northern blotting, Sl nuclease, and primer extension and compared with transcripts arising from wild-type OV. The results of those analyses are reported. MATERIALS
AND METHODS
The OV strain used in these experiments was NZ-2 (Robinson et al., 1982; Mercer et a/., 1987). Virus was isolated from sheep scab material and subsequently propagated in primary bovine testis (BT) cells. The method of preparing OV for use in transcription experiments has been described (Fleming et al., 1991). Vaccinia virus, Lister strain (the origin of this strain is described in Robinson and Mercer, 1988), and the recombinant vaccinia virus were propagated in 143B-TKcells. Recombinant vaccinia virus stocks used in the transcription experiments were prepared by the method used for OV (Fleming et al., 1991). Preparation
of viral RNA
Monolayers of BT cells or 143B-TK- cells were infected with 30 PFU of OV or recombinant vaccinia virus per cell in medium containing 100 pg/ml cycloheximide. Total cellular RNA was isolated 6 hr after infection by lysing the cells in 6 M guanidinium isothiocyanate followed by sedimentation through a 5.7 M CsCl cushion (Glisin et al., 1974; Ullrich et al,, 1977). The RNA pellet was washed once with 70% ethanol, resuspended in 200 ~1 of 10 mMTris, 5 mM EDTA, 1O/oSDS, and stored as an ethanol precipitate at -20”. Transcriptional
analyses
The method of Northern analysis has been described (Fleming et al., 1991). Briefly, RNAs were electrophoresed in denaturing agarose-formaldehyde gels, blotted onto nitrocellulose membranes, and hybridized with nick-translated probes or single-stranded (ss) probes by the method of Lee-Chen and Niles (1988). For Sl analyses the method of Berk and Sharp (1977) was used with modifications (Fleming eta/., 1991). Uniformly labeled ss-DNA probes were hybridized to total RNA and digested with Sl nuclease (Amersham) at 29 or 37”. The sizes of the protected fragments were determined by electrophoresis on 6% polyacrylamide, 8 M urea sequencing gels. For primer extension analyses the method of McKnight et al. (1981) was slightly modified as described in Fleming et al. (1991). Uniformly labeled ss-DNA primers were annealed to total cellular RNA and the extension reaction was carried out with either 20 U of AMV reverse transcriptase or
465
PROMOTERS
500 U of cloned MLV reverse transcriptase (BRL, Bethesda Research Laboratories Life Technologies, Inc., Gaithersburg, MD). The extended primers were analyzed in a 6% polyacrylamide, 8 M urea sequencing gel. The sizes of the primer extension products were estimated against a sequencing ladder made by sequencing from an appropriate ss-DNA template. DNA sequencing DNA sequencing was carried out by the dideoxynucleotide chain termination method (Sanger eta/., 1977) using ss recombinant M 13 phage. The sequence of BarnHI-E containing the three ORFs analyzed is described in Mercer et al, (1989) and Fraser et al. (1990). Construction
of recombinant
vaccinia
virus
The BarnHI-E fragment of OV NZ-2 was inserted into the insertion vector, pUV1 (Falkner et al., 1987) and this construct used to produce a vaccinia virus (Lister strain) recombinant by homologous recombination at the TK locus (Mackett et al., 1984). Recombinants were selected by plaque assay in the presence of 5-bromodeoxy-uridine and stained with 5-bromo4-chloro-3-indolyl-p-galactopyranoside (X-gal). Four plaque purification steps were carried out before virus stocks were prepared in 143B-TK- cells. The identity of the recombinant was confirmed by restriction endonuclease and DNA/DNA hybridization analyses of purified viral DNA. No hybridization was seen between the BarnHI-E fragment of OV and a HindIll digest of vaccinia virus DNA. The OV DNA fragment was orientated within the insertion vector such that the ITR region of the BarnHI-E fragment was adjacent to the vaccinia virus late promoter (PLl 1) carried by pUV1 (Falkner et a/., 1987). In this orientation the transcriptionally active ORFs of BarnHI-E were in the opposite orientation to that of both the adjacent vaccinia virus late promoter (Pl 1) and the more distant early TK promoter. RESULTS Northern
blot analysis
Northern blot analysis of OV early RNA showed three bands representing transcripts from BarnHI-E (Fig. 1). Two of these bands corresponded to RNAs of 1.7(ORF G/E) and 0.48-kb (ORF-1) and a slightly broader band corresponded to RNAs of between 0.70- (ORFpp) and 0.76-kb (ORF-3) (see Fig. 2A for the location of these ORFs in BarnHI-E). RNAs represented by these bands were clearly more abundant when total RNA was prepared from 143B-TK- cells infected with OV (OV(TK-) RNA) than from BT cells infected with OV (OV(BT) RNA) at the same m.o.i. Furthermore, the
466
FLEMING
REC
ORF BT
TK
BT
TK
FIG. 1. RNA transcripts detected by Northern blot analysis in cells infected with the orf virus or a vaccinia virus recombinant containing orf virus BarnHI-E. Total RNA isolated from either BT cells (BT) or 143B-TK- cells (TK) infected with either orf virus (or-f) or recombinant vaccinia virus (ret) in the presence of cycloheximide was extracted at 6 hr p.i., separated by gel electrophoresis, and transferred to a nitrocellulose membrane. The blot was incubated under annealing conditions with a 32P-labeled, nick-translated probe of orf virus BarnHI-E. The position of RNA size markers (BRL) in kb are shown at the right-hand side of the figure and the calculated sizes of the bands in kb on the left-hand side.
0.48-kb transcript, while barely detectable in OV(BT) RNA (Fig. 1, lane l), was prominent in OV(TK-) RNA (Fig. 1, lane 2). To determine if OV genes are transcribed in cells infected with the recombinant vaccinia virus containing the BarnHI-E fragment of OV DNA total RNA prepared from both 143B-TK- cells (rVV(TK-) RNA) and from BT cells (rW(Bt) RNA) infected with the recombinant virus were electrophoresed in parallel with OV(BT) RNA and OV(TK-) RNA and probed with radiolabeled BarnHI-E DNA (Fig. 1, lanes 3 and 4). Three bands were detected in recombinant-derived RNA and these had similar mobilities to those detected in OV derived RNA. However, the relative band densities varied within and between lanes. In lane 1 and lane 2 (OV-derived RNA) the 0.70-0.76-kb transcripts are clearly more abundant than the 0.48-kb transcripts in contrast with the recombinant-derived RNA (lanes 3 and 4) where the 0.48-kb and 0.70-0.76-kb transcripts are of similar abundance. The 1.7-kb band is more prominant in the OV(BT) RNA and OV(TK-) RNA (lanes 1 and 2) than in the rVV(BT) RNA and rVV(TK-) RNA (lanes 3 and 4). The finding of a 1.7-kb transcript in the rVV RNA was unexpected as a complete open reading frame which could give rise to a transcript of this size is not present in the BarnHI-E insert in the recombinant. As discussed below the 1.7-kb band in recombinant-derived RNA is likely to be read-through transcription from the ORF-pp promoter.
ET AL.
A Northern blotting procedure using ss-probes and OV-derived RNA was used to map the positions of early transcripts arising from the non-ITR portion of the BarnHI-E fragment (Fig. 2). It has been shown previously that there is only one early, transcriptionally active ORF in the ITR, ORF-3, to which the 0.76-kb transcript has been mapped (Fleming et al,, 1991). A ssprobe spanning the region between nucleotides 454-2233 (probe 1 in Fig. 2A) revealed three bands corresponding to mRNAs of 1.7-, 0.70-, and 0.48-kb and indicated that they are all transcribed head-to-tail in a rightward direction toward the end of the OV genome (Fig. 2B). The 0.76-kb mRNA transcribed from ORF-3 (Fleming et al., 1991) has been shown to be transcribed in the same direction. The three non-ITR transcripts correspond in size to ORF-pp, ORF-1, and ORF-G/E, allowing for the addition of a 200-300 poly(A) tract to each. It was a prediction that these transcripts would be early genes given the similarity of their A+T-rich flanking sequences to those found flanking other poxvirus early genes (Fraser eta/., 1990; J. S. Sullivan, A. A. Mercer, K. M. Fraser, and A. J. Robinson, unpublished data). Probes specific for each ORF were used in Northern blotting experiments to map the 1.7-, 0.70-, and 0.48-kb early transcripts (Fig. 2). This confirmed the results suggested above, namely, that the 1.7-kb transcript maps to ORF-G/E, which originates in BarnHI-G and terminates 1035 nucleotides into BarnHI-E, that the 0.70-kb transcript maps to ORF-pp (Mercer et al., 1989) which is located between nucleotides 1058-l 576, and that the 0.48-kb transcript maps to ORF-1 which is located between nucleotides 1504-l 879 (Fraser et a/., 1990). Northern blot analysis of recombinant-derived RNA, revealed that the 0.76-, 0.70-, and 0.48-kb transcripts map to the same ORFs as in OV-derived RNA (Fig. 2C). The 1.7-kb transcript was detected by probes 1, 6, and 7, but was not detected by probes 3 and 8, indicating that this mRNA is also transcribed in a rightward direction but, unlike the 1.7-kb transcript detected in OVderived RNA which maps to ORF-G/E, this transcript maps to a region spanned by ORF-pp and ORF-1. Unfortunately, probe 5 which had been used for Northern analysis of OV-derived RNA was lost and probe 8 which lies immediately adjacent to probe 5 was therefore used for Northern analysis of recombinantderived RNA. The 5’ ends of ORF-pp transcripts
ORF-pp, which spans a region in BarnHI-E from nucleotide 1058 to 1576 and has an initiation codon at 1 100 (Mercer et a/,, 1989; Fig. 4), codes for a polypep-
IN WI/O RECOGNITION
OF ORF VIRUS EARLY TRANSCRIPTIONAL
I kb
I
0
2
1 2
j
3
44
B 1
234567
1
2
C 3
4
8
6
7
FIG. 2. Mapping of early transcripts within the orf virus BarnHI-E fragment in orf virus-infected cells and in cells infected with a vaccinia virus recombinant containing the orf virus BarnHI-E fragment. (A) Map showing the location of the single-stranded (ss) MlB/orf virus recombinant DNA probes used in the analysis. The top line represents the orfvirus NZ-2 genome showing the location of BarnHI restriction endonuclease cleavage sites (Mercer et al., 1987). The relative positions of probes derived from the BarnHI-E fragment are shown numbered 1 to 8 on the expanded map below the genome map. Probes complementary to rightward transcripts are shown above the line and those complementary to leftward transcripts below the line. Probe 6 corresponds to double-stranded (ds) DNA and was labeled with 32P by nick-translation. The location of the 5’end of probe 7 was not known and is therefore shown as a broken line. ORFs which were transcriptionally active are labeled and shown as arrowed lines. The location of the inverted terminal repeat is indicated with a vertical dotted line and a heavy arrow. (B) Northern analysis. Total RNA isolated from TK- cells infected with orf virus in the presence of cycloheximide was extracted at 6 hr p.i, separated by electrophoresis in an agarose/formaldehyde gel, and transferred to a nitrocellulose membrane. Strips cut from this membrane were incubated under annealing conditions, first with a recombinant Ml 3
PROMOTERS
467
tide with sequence homology to an ORF in certain retroviruses (McClure et al., 1988), vaccinia virus F2L (Slabaugh and Roseman, 1989), and to Escherichia co/i dUTPase (McGeoch, 1990). Immediately upstream of the initiation codon is the sequence 5’-GAAAGTGTAAATTGTA, assumed to be an early promoter. S 1 nuclease analysis. OV(TK-) RNA or rVV(TK-) RNA was hybridized to a uniformly labeled probe (spanning nucleotides 880-1220, Fig. 3) and digested with nuclease Sl . Analysis of the protected fragments against the sequence from which the Sl probe was derived revealed four major protected fragments for OV(TK-) RNA, but only one with rVV(TK-) RNA. The protected fragment for the rVV(TK-) RNA was the same size as the shortest found with OV(TK-) RNA and identified a transcriptional start point (tsp) at nucleotide 1076, 24 nucleotides upstream from the ORF-pp ATG and 15 nucleotides downstream from the right end of the promoter-like sequence (Fig. 4). The other three major protected fragments found with OV(TK-) RNA most likely resulted from the protection of the Sl probe by 3’ ends of the adjacent 1.7-kb transcript (ORF-G/E). The shorter two of these mapped to positions 25 and 51 nucleotides downstream from the sequence 5’TTITTCT located at nucleotides 1038-1044 (Fig. 4) and probably represented major termination points of the 1.7-kb transcript. The absence of these larger protected fragments in rVV(TK-) RNA is consistent with the truncation of the ORF-G/E in the recombinant, such that it lacks a promoter at its 5’ end. The longest fragment seen in OV(TK-) RNA is the same size as the Sl probe and most likely arose as a result of complete protection of the probe by unterminated mRNA. Primer-extension analysis. A labeled primer 99 nucleotides in length and complementary to an internal region of the 0.70-kb transcript was synthesised from an M 13 recombinant template. The primer extension products were analyzed on a sequencing gel against a sequence of the template from which the primer was derived. OV(TK-) RNA and rVV(TK-) RNA each gave only one major band and these were of identical size (Fig. 3). The tsp measured by this method mapped to nucleotide 1076, in agreement with the result found by Sl analysis.
probe and then with 32P-labeled M 13 DNA. The numbers shown above the lanes correspond to the probe numbers in (A). The size markers shown in kb were obtained from BRL and the positions and sizes in kb of the relative bands are indicated with arrows. (C) Northern analysis of total RNA isolated from TK- cells infected with recombinant vaccinia virus and analyzed as in (B). The lane numbers correspond to the probe numbers in (A). The size markers and band sizes are shown as for(B) except the extra band at 0.76 is indicated.
468
FLEMING
ET AL.
PE ORF-pp
880 BBB cl::-
’ Bgl II
ACGTI
1121 I Xmn I
1220 I
ACGTl23
2
n BB
I
*PRIMER r
ISI
PROBE
PE
ORF 1
123
ACGT1234
ACGT
LPRIMER ISI PROBE
PE
Sl
ORF3
AGCT12
Sph
3
AGCTl
23
I
*PRIMER -‘SI
PROBE
FIG. 3. Sl nuclease and primer extension mapping of the 5’ ends of transcripts. Single-stranded 3*P-labeled probes were used for both Sl nuclease and primer extension analysis and were synthesised from recombinant M 13 DNA templates. Line diagrams show the strategies used for making probes to map mRNAs transcribed from ORF-pp, ORF-1, and ORF-3, respectively. The solid line represents a single-stranded fragment of orf virus DNA derived from BarnHI-E (Fraser et a/., 1990) and in the case of ORF-3 this line is flanked by M 13 DNA sequences represented by diagonally slashed lines. The arrowed open line represents a radiolabeled strand synthesized from orf virus-specific primers (stippled box) in ORF-pp and ORF-1 and from an Ml 3 forward sequencing primer (stippled box) in ORF-3. The ds-DNA product was digested in ORF-pp with eitherBg/ll for Sl mapping (Sl probe) orXmnl for primer extension; in ORF-1 with Kspl for Sl mapping orAvaIl for primer extension; in ORF-3 with either BarnHI, utilizing the BamHl site in the cassette for Sl mapping or the sphl site within the sequence for primer extension. Following digestion, the ds-DNA products were denatured, separated in a polyacrylamide gel, and recovered by electrophoresis. The approxi-
IN VW0 RECOGNITION
OF ORF VIRUS EARLY TRANSCRIPTIONAL
The 5’ ends of ORF-I transcripts ORF-1 spans a region from nucleotide 1645 to 1889 with an initiation codon at 1663 (Fraser et al., 1990). Immediately upstream of the initiation codon is the sequence 5’-AAAATTGTAAAATGTA, assumed to be the promoter of the ORF-1 gene. Sl n&ease analysis. OV(TK-) RNA and rVV(TK-) RNA were hybridized separately to a uniformly labeled ss-DNA probe which spanned nucleotides 1504-l 879 and each gave rise to a single major protected fragment of equal size after Sl digestion (Fig. 3). This result gave a tsp at nucleotide 1612, 51 nucleotides upstream from the ATG of ORF-1 and 18 nucleotides downstream from the putative promoter (Fig. 4). Primer-extension analysis. A labeled primer 98 nucleotides in length and complementary to an internal region of the 0.48-kb mRNA was synthesized from an Ml 3 DNA recombinant template. Primer extension products of OV and recombinant virus RNA gave only one major band in each assay and the extension products were of the same size. The tsp by the primer extension method mapped to nucleotide 1612, the same result as that obtained by Sl nuclease analysis. The 5’ ends of ORF-3 transcripts ORF-3 spans a region in BarnHI-E from nucleotides 2573 to 32 17 with an initiation codon at 2735. ORF-3 crosses the ITR junction at nucleotide 2617 (Fraser et al., 1990). The 5’ end of OV(BT) RNA transcribed from ORF-3 has been mapped by Sl nuclease and primerextension to nucleotide 2654 and nucleotide 2655, respectively (Fleming et a/., 1991). In the experiments now reported, the 5’end analysis was performed using rVV(TK-) RNA and compared with OV(BT) RNA. Sl nuclease analysis. The size of the major protected fragment for rVV(TK-) RNA was 192 nucleotides (Fig. 3) which mapped the tsp to nucleotide 2658, 77 nucleotides upstream from the ORF-3 ATG and 14 nucleotides downstream from the sequence 5’GCAAAGTGAAAAAGGA (Fig. 4). This tsp is four nucleotides downstream from that mapped in OV(BT) RNA (2654). Primer-extension analysis. rVV(TK-) RNA mapped the tsp to nucleotide 2655. The difference in the tsp
PROMOTERS
469
between OV(BT) RNA and rVV(TK-) RNA seen in Sl nuclease analysis was not apparent using the primer extension method where the tsps were identical.
DISCUSSION This study has shown that OV early promoters are recognized by vaccinia virus transcriptional factors. ORF-pp, ORF-1, and ORF-3 were faithfully transcribed in the recombinant virus. Little difference in transcript sizes was found between OV and the recombinant virus and tsps were shown to be identical or, in one case, within four nucleotides. The result also infers that OV transcription termination sequences are recognized by vaccinia virus transcription termination factors, assuming the poly(A) tails of equivalent transcripts are of similar length. A comparison of the relative densities of bands obtained by Northern blotting showed that OV genes are transcribed efficiently in cells infected with the recombinant virus and that at least one OV gene (ORF-1) may be transcribed more efficiently from the recombinant than from the OV genome. Another finding that emerged was the high yields of OV early RNA isolated from nonpermissive 143B-TK- cells compared with BT cells infected at the same m.o.i. in the presence of cycloheximide. It could be that because BT cells are primary cells and are likely to be a heterogenous population, a proportion of these cells do not become infected. Alternatively, the level of transcription may be enhanced in nonpermissive cells. Only primary cells of bovine, ovine, and human cells have been recorded as being permissive for OV and, generally, cells of other species and cell lines are nonpermissive (Robinson and Balassu, 1982) although some strains of virus have been adapted to vero cells (Hussain and Burger, 1989) and will grow in MRC-5 cells (R. Drillien, personal communication). The reason for this is not known and, as far as we are aware, the stage of the cell cycle at which the block occurs has not been investigated. It is not clear why nonpermissive 143B-TK- cells gave a higher yield of viral RNA, although a block at the level of DNA replication might be expected to give this result. These or other nonpermissive cell lines could be more
mate size, position of 5’ ends, and direction of transcription of transcripts are indicated by the arrow above each map. Sl mapping (Sl): Total RNA was annealed with the single-stranded Sl probes shown, digested with Sl nuclease, and the products were electrophoresed in a polyactylamide gel in parallel with standard sequencing reactions. Lanes A, C, G, and T, standard sequencing reactions; lane 1, undigested Si probe. In ORF-pp and ORF-1; lane 2, Sl products from RNA isolated from mock-infected cells; lane 3, RNA from orf virus-infected cells; lane 4, RNA from recombinant vaccinia virus-infected cells. In ORF-3; lane 2, Sl products from RNA isolated from orf virus-infected cells and lane 3, RNA from recombinant vaccinia virus-infected cells. Primer extension mapping (PE): Total RNA was annealed with the primers shown, extended with AMV reverse transcriptase, and the products were electrophoresed in a polyactylamide gel in parallel with standard sequencing reactions, Lanes A, G, C, and T, standard sequencing reactions; lane 1, primer extension products of RNA isolated from mock-infected cells; lane 2, RNA isolated from orf virus-infected cells; lane 3, RNA isolated from recombinant vaccinia virus-infected cells.
470
FLEMING
convenient than primary cells for studying OV early transcriptional events. In general, the sequences of the three OV early promoters examined fit well with the consensus sequence of vaccinia virus early promoters (Fig. 5) and the degree to which they diverge from that consensus is within the range of divergence found between individual vaccinia virus early promoters (Davison and Moss, 1989a). Davison and Moss (1989a) showed that an A residue 13 nucleotides upstream from the initiation site (-13) is of considerable importance for the function of vaccinia virus early promoters. When the sequences of the putative promoters of ORF-pp, ORF-1, and ORF-3 are aligned with the 7.5-kDa promoter so that each has an A residue at the 3’end of a sequence that has maximal homology with essential nucleotides in the critical region, the ORF-1 promoter shows almost complete identity (10 out of 11 nucleotides) with those nucleotides essential for strong promoter activity. A similar analysis of the ORF-pp promoter revealed 9 out of 11 nucleotides corresponding to essential nucleotides within the critical region while ORF-3 showed the least homology. The demonstration that these OV early promoters are recognized by vaccinia virus transcriptional factors is in keeping with this conservation of sequence. Furthermore, with the qualification that there are quantitative differences in RNA transcription, it suggests that early genes encoding immunologically functional OV
ORF-pp
s,' 1031 1041 1051 1061 1071 y 1081 CCCCTGATTTTTCTGGAGAGTGTAAATTGTACACCCCGTAGTC~ATCGGCCGCTCGCC 1091 2001 ACCCTAGCCATG
Critical region -28
region -13
7.5-kD promoter
AAAAgTaGAAAataTA
strong
AAAAATTGAAAAACTA
promoter
Initiation region
SpaCeK
12
-2
TTCTAATTTA;
-1 t6 : : TGCACGG
SI
ORF-pp
GAAAGTGTAAATTGTA
CACCCCGTAGT
0 CGATCGG 2
ORF-1
AAAATTGTAAAATGTA
GCTTCTTTTTA
ORF-3
GCAAAGTGAAAAAGGA
SI 0 CCGCCTAGCAG A
"; TTCGAGA a TCGAGAC
FIG. 5. Alignment of orf virus early promoter sequences with structural elements of the vaccinia virus 7.5.kDa early promoter and the critical region of a synthetic vaccinia virus strong early promoter (Davison and Moss, 1989a). Within the critical region of the 7.5.kDa promoter, nucleotides are designated as either essential (upper case) or not essential (lower case) for strong promoter activity. Transcription start points in orf virus early promoters determined by Sl mapping are shown as circles and by primer extension mapping as triangles.
proteins will be expressed from vaccinia virus recombinants carrying large fragments of OV DNA, without the need to locate individual orf virus genes and place them under the control of vaccinia virus promoters. In addition, evidence from sequence and transcriptional data (S. B. Fleming, J. Blok, A. A. Mercer, K. M. Fraser, and A. J. Robinson, manuscript in preparation) and transient assays (D. J. Lyttle and A. J. Robinson, unpublished data) indicate that late genes will also be expressed. REFERENCES
ORFl
51
1571 1581 1591 1601 1619 1621 ATCAGCTAATCAAAATTGTATGTAGCTTCTTTTTATTC~AGAGTCTCGCACAGTTGC 1641 1651 1661 1631 GTAGATAACACTAATTACAACACATTTAATCATG ORF3
ET AL.
Sl
0 2621 2631 2641 2651 . 2661 2671 GCCACGGAGCAAAGTGAGACCGCCTAGCA~TCGAGACCCTCCCGCCGCAGCCGCG 2681 2691 2701 2711 fj 2721 2731 GACACCCCACACCCGCCTTCCACCCGCCAGACG' AACACCGCAGCCAACAAGCATG
FIG. 4. Nucleotide sequences of the promoter regions of ORF-pp, ORF-1, and ORF-3. Transcriptional start points determined by Sl mapping in orf virus are shown as solid circles and in recombinant vaccinia virus as open circles. Primer extension tsps in orf virus are shown as solid triangles and in recombinant vaccinia virus as open triangles. The last digit of numerals are aligned with the corresponding nucleotide. The sequences likely to be the “critical regions” (Davison and Moss, 1989a) of the early promoters are underlined. The ATG shown at the end of each sequence is the first translation start codon.
BERK, A. J., and SHARP, P. A. (1977). Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of Sl endonuclease-digested hybrid. Cell 12, 721-732. BERTHOLET,C., STOCCO, P., MEIR, E. V., and WITTEK, R. (1986). Functional analysis of the 5’ flanking sequence of a vaccinia virus late gene. EMBO/. 5,1951-1957. BINNS, M., STENZLER, L., TOMLEY, F., CAMPBELL, J., and BOURSNELL, M. (1987). Identification by a random sequencing strategy of the fowlpoxvirus DNA polymerase gene, its nucleotide sequence and comparison with other viral DNA polymerases. Nucleic Acids Res. 15, 6563-6573. BOYLE, D. B., and COUPAR, B. E. H. (1986). Identification and cloning of the fowlpox virus thymidine kinase gene using vaccinia virus. J. Gen. viral. 67, 1591-l 600. BOYLE, D. B., COUPAR, B. E. H., GIBBS, L. J., SEIGMAN, L. J., and BOTH, G. W. (1987). Fowlpox virus thymidine kinase and nucleotide sequence and relationships to other thymidine kinases. Virology 156, 355-365. BOYLE, D. B., and COUPAR, B. E. H. (1988). Construction of fowlpox viruses as vectors for poultry vaccines. Virus Res. 10, 343-356. COCHRAN, M. A., PUCKET~,C., and Moss, B. (1985). In vitro mutagen-
IN V/l'0
RECOGNITION
OF ORF VIRUS EARLY TRANSCRIPTIONAL
esis of the promoter region for a vaccinia virus gene: Evidence for early and late regulatory signals. J. Viral. 54, 30-37. DAVISON,A. I., and Moss, B. (1989a). Structure of vaccinia virus early promoters. 1. Mol. Biol. 210, 749-769. DAVISON, A. J., and Moss, B. (1989b). Structure of vaccinia virus late promoters. J. Mol. Biol. 210, 77 l-764. DRILLIEN, R., SPEHNER,D., VILLEVAL, D., and LECOCQ,J. (1987). Similar genetic organization between a region of fowlpox virus DNA and the vaccinia virus HindIll J fragment despite divergent location of the thymidine kinase gene. Virology 160, 203-209. FALKNER, F. G., CHAKRAEIARTI,S., and Moss, B. (1987). pUV1: a new vaccinia virus insertion and expression vector. Nucleic Acids Res. 15,7192. FLEMING, S. B., FRASER, K. M., MERCER, A. A., and ROBINSON, A. J. (1991). Vaccinia virus-like early transcriptional control sequences flank an early gene in orf virus. Gene 97, 207-212. FRASER,K. M., HILL, D. F., MERCER, A. A., and ROBINSON,A. J. (1990). Sequence analysis of the inverted terminal repetition in the genome of the parapoxvirus, orf virus. Virology 176, 379-389. GERSHON, P. D., and BLACK, D. N. (1989). A capripoxvirus pseudogene whose only intact homologs are in other poxvirus genomes. Virology 172, 350-354. GLISIN, V., CRKVENJAKOV,R., and BYUS, C. (1974). Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 13, 2633-2637. HUSSAIN, K. A., and BURGER,D. (1989). Invivo and in vitro characteristics of contagious ecthyma virus isolates: host response mechanism. Vet. Microbial. 19, 23-36. LEE-CHEN, C. Y., and NILES, E. G. (1988). Transcription and translation of the 13 genes in the vaccinia virus HindIll D fragment. Virology163,52-63. MACKETT, M., SMITH, G. L., and Moss, B. (1984). A general method for the production and selection of infectious vaccinia virus recombinants expressing foreign genes. J. Viral. 49, 857-864. MARS, M., and BEAUD, G. (1987). Characterization of vaccinia virus early promoters and evaluation of their informational content. J. MO/. Biol. 198, 6 19-63 1. MATTHEWS, R. E. F. (1982). Classification and nomenclature of viruses. lntervirology 17, l-l 99. MCCLURE, M. A., JOHNSON, M. S., FENG D.-F., and DOOLITTLE, R. F. (1988). Sequence comparisons of retroviral proteins: relative rates of change and general phylogeny. Proc. Nat/, Acad. Sci. USA 85, 2469-2473. MCGEOCH, D. J. (1990). Protein sequence comparisons show that the “pseudoprotease” encoded by poxviruses and certain retroviruses belong to the deoxyuridine triphosphatase family. Nucleic AcidsRes. 18,4105-4110. MCKNIGHT, S. L., GAVIS, E. R., KINGSBURY,R., and AXEL, R. (1981). Analysis of transcriptional regulatory signals of the HSV thymidine
PROMOTERS
471
kinase gene: Identification of an upstream control region. Cell 25, 385-398. MERCER,A. A., FRASER,K., BARNS, G., and ROBINSON,A. J. (1987). The structure and cloning of orf virus DNA. Virology 157, 1-l 2. MERCER, A. A., FRASER,K. M., STOCKWELL,P. A., and ROBINSON,A. 1. (1989). A homologue of retroviral pseudoproteases in the parapoxvirus, orf virus. Virology 172, 665-668. PLUCIENNICZAK,A., SCHROEDER, E., ZETTLEMEISSI,G., and STREECK, R. E. (1985). Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome. Nucleic Acids Res. 13, 985-998. ROBINSON,A. J., and BALASSU,T. C. (1981). Contagious pustular dermatitis (orf). Vet. Bull. 51, 771-782. ROBINSON,A. J., ELLIS, G., and BALASSU,T. (1982). The genome of ori virus: restriction endonuclease analysis of viral DNA isolated from lesions of orf virus in sheep. Arch. Viral. 71, 43-55. ROBINSON, A. J., and MERCER, A. A. (1988). Or-f virus and vaccinia virus do not cross protect sheep. Arch. Viral. 101, 255-259. ROBINSON,A. J., and LYT~-LE,D. J. (1991). Parapoxviruses: their biology and potential as recombinant vaccines. In “Poxviruses as Vaccine Vectors” (M. M. Binns and G. L. Smith, Eds.). CRC Press, Boca Raton, FL. ROHRMANN, G., YUEN, L., and Moss, B. (1986). Transcription of vaccinia virus early genes by enzymes isolated from vaccinia virus virions terminates downstream of a regulatory sequence. Cell46, 1029-l 035. ROSEL, L. J., EARL, P. L., WEIR, J. P., and Moss, B. (1986). Conserved TAAATG sequence at the transcriptional and translational initiation sites of vaccinia virus late genes deduced by structural and functional analysis of the HindIll H genome fragment. 1. Viral. 60, 436-449. SANGER, F., NICKLEN, S., and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Nat/. Acad. Sci. USA 74,5463-5467. SLABAUGH,M. B., and ROSEMAN, N. A. (1989). Retroviral protease-like gene in the vaccinia virus genome. Proc. Nat/. Acad. Sci. USA 86, 4152-4155. ULLRICH, A., SHINE, J., CHIRGWIN, J., PICTET, R., TISCHER, E., RUTTER, W. J., and GOODMAN, H. M. (1977). Rat insulin genes: construction of plasmids containing the coding sequences. Science 196, 1313-1319. VASSEF,A. (1987). Conserved sequences near the early transcription start sites of vaccinia virus. Nucleic Acids Res. 15, 1427-l 443. WEIR, J. P., and MOSS, B. (1987). Determination of the transcriptional regulatory region of a vaccinia virus late gene. 1. Viral. 61, 75-80. WITTEK, R., KUENZLE,C. C., and WYLER, R. (1979). High C+G content in parapoxvirus DNA. J. Gen. W-o/. 43, 231-234. YUEN, L., and Moss, B. (1987). Oligonucleotide sequence signaling transcription termination of vaccinia virus early genes. Proc. Nat/. Acad. Sci. USA 84, 6417-6421.
187, 464-47 1 (1992)
ln vivo Recognition
of Orf Virus Early Transcriptional in a Vaccinia Virus Recombinant
Promoters
STEPHEN B. FLEMING, ANDREW A. MERCER, KATE M. FRASER, DAVID J. LYTTLE, AND ANTHONY-I. ROBINSON’ Health Research Council of New Zealand, virus Research Unit, and Centre for Gene Research, University of Otago, P. 0. Box 56, Dunedin, New Zealand Received October 8, 1991; accepted
November
18, 1991
The 4.4-kb BarnHI-E fragment of the orf virus (OV) genome contains three discrete open reading frames designated ORF-pp, ORF-1, and ORF-3, all of which are flanked by vaccinia virus-like early transcriptional control sequences. To determine whether the vaccinia transcriptional machinery would recognize these promoters and faithfully transcribe OV genes in viva the BamHI-E fragment was inserted into the thymidine kinase (TK) locus of vaccinia virus and the recombinant used in transcription studies. Northern blotting analysis of early RNA isolated from 143B-TK- cells infected with the recombinant virus showed that OV genes were transcribed and that the three transcripts of 0.70(ORF-pp), 0.48- (ORFl), and 0.75-kb (ORF-3) were the same size as their counterparts in OV-infected cells. Analysis of the 5’ end of transcripts by Si nuclease and primer extension showed that the transcriptional start points (tsp) of ORF-pp, ORF-1, and ORF-3 in the recombinant were identical or within four nucleotides of the tsps of the same ORFs in OV. However, there were quantitative differences. ORF-1 was transcribed more efficiently in recombinant virus-infected cells than in those infected with OV and analysis of the putative promoter, 5’-AAAATTGTAAAATGTA, showed that it was similar to the 7.5-kDa early promoter of vaccinia virus. This demonstrates that the transcriptional control sequences of OV genes are recognized by vaccinia virus transcriptional factors but that quantitative differences exist suggesting that the generically different transcriptional factors have different promoter sequence requirements for maximal transcription. 0 1992 Academic Press, hc
INTRODUCTION
genes coupled to the vaccinia virus P7.5 early/late promoter (Gershon and Black, 1989). In addition to these functional assays, strong homologies have been detected between early (Cochran eta/., 1985; Pluciennczak eta/., 1985; Mars and Beaud, 1987; Vassef, 1987; Davison and Moss, 1989a) and late (Bertholet et al., 1986; Rose1 et al., 1986; Weir and Moss, 1987; Davison and Moss, 1989b) promoters of vaccinia virus and sequence elements of fowlpoxvirus (Binns eta/., 1987; Drillien eta/., 1987) capripoxvirus (Gershon and Black, 1989), and OV (Fraser et al., 1990; Fleming et al., 1991; S. B. Fleming, J. Blok, A. A. Mercer, K. M. Fraser, and A. J. Robinson, manuscript in preparation). Also conserved are the early transcriptional termination signals having the general sequence T5NT (Rohrmann et al., 1986; Yuen and Moss, 1987). Although OV early and late promoter elements and the early transcriptional termination signals resemble those in vaccinia virus the genome is otherwise G+Crich (Wittek et al., 1979; Fraser et al., 1990) in contrast to the A+T-rich genome of most other poxviruses. It was not known if the vaccinia virus transcriptional machinery would recognize these promoters in vaccinia virus recombinants containing fragments of OV DNA and faithfully transcribe OV genes. In an attempt to answer this question, at least for early promoters, viral transcripts from cells infected with a recombinant vac-
Orf virus (OV) is the type species in the parapoxvirus genus of the family Poxviridae (Matthews, 1982). For a review of the biology of OV see Robinson and Balassu (1981) and Robinson and Lyttle (1991). We are interested in using vaccinia virus recombinant technology to identify genes important in inducing a protective response to infection by OV. The strategy is to construct a set of vaccinia virus recombinants containing large overlapping fragments of the OV genome and to use these recombinants in immunological assays on the assumption that OV promoters would be recognized by the vaccinia virus transcriptional apparatus. Cross-generic recognition of early and late promoters in the poxviridae has been reported previously. Vaccinia virus promoter sequences P7.5 (early) and PLl 1 (late) have been used to express foreign genes in fowlpox virus (Boyle and Coupar, 1988) and similarly, the fowlpox virus thymidine kinase promoter has been shown to operate in vaccinia virus (Boyle and Coupar, 1986; Boyle et a/., 1987). In a transient expression system, capripoxvirus-infected cells were able to express ’ To whom correspondence dressed. 0042-6822/92
and reprint requests
$3.00
Copyright 0 i 992 by Academic Press, Inc. All rights of reproduction in any form reserved.
should be ad-
464
IN VW0 RECOGNITION
OF ORF VIRUS EARLY TRANSCRIPTIONAL
cinia virus in which the OV BarnHI-E fragment was inserted into the thymidine kinase (TK) gene of vaccinia virus were analyzed by Northern blotting, Sl nuclease, and primer extension and compared with transcripts arising from wild-type OV. The results of those analyses are reported. MATERIALS
AND METHODS
The OV strain used in these experiments was NZ-2 (Robinson et al., 1982; Mercer et a/., 1987). Virus was isolated from sheep scab material and subsequently propagated in primary bovine testis (BT) cells. The method of preparing OV for use in transcription experiments has been described (Fleming et al., 1991). Vaccinia virus, Lister strain (the origin of this strain is described in Robinson and Mercer, 1988), and the recombinant vaccinia virus were propagated in 143B-TKcells. Recombinant vaccinia virus stocks used in the transcription experiments were prepared by the method used for OV (Fleming et al., 1991). Preparation
of viral RNA
Monolayers of BT cells or 143B-TK- cells were infected with 30 PFU of OV or recombinant vaccinia virus per cell in medium containing 100 pg/ml cycloheximide. Total cellular RNA was isolated 6 hr after infection by lysing the cells in 6 M guanidinium isothiocyanate followed by sedimentation through a 5.7 M CsCl cushion (Glisin et al., 1974; Ullrich et al,, 1977). The RNA pellet was washed once with 70% ethanol, resuspended in 200 ~1 of 10 mMTris, 5 mM EDTA, 1O/oSDS, and stored as an ethanol precipitate at -20”. Transcriptional
analyses
The method of Northern analysis has been described (Fleming et al., 1991). Briefly, RNAs were electrophoresed in denaturing agarose-formaldehyde gels, blotted onto nitrocellulose membranes, and hybridized with nick-translated probes or single-stranded (ss) probes by the method of Lee-Chen and Niles (1988). For Sl analyses the method of Berk and Sharp (1977) was used with modifications (Fleming eta/., 1991). Uniformly labeled ss-DNA probes were hybridized to total RNA and digested with Sl nuclease (Amersham) at 29 or 37”. The sizes of the protected fragments were determined by electrophoresis on 6% polyacrylamide, 8 M urea sequencing gels. For primer extension analyses the method of McKnight et al. (1981) was slightly modified as described in Fleming et al. (1991). Uniformly labeled ss-DNA primers were annealed to total cellular RNA and the extension reaction was carried out with either 20 U of AMV reverse transcriptase or
465
PROMOTERS
500 U of cloned MLV reverse transcriptase (BRL, Bethesda Research Laboratories Life Technologies, Inc., Gaithersburg, MD). The extended primers were analyzed in a 6% polyacrylamide, 8 M urea sequencing gel. The sizes of the primer extension products were estimated against a sequencing ladder made by sequencing from an appropriate ss-DNA template. DNA sequencing DNA sequencing was carried out by the dideoxynucleotide chain termination method (Sanger eta/., 1977) using ss recombinant M 13 phage. The sequence of BarnHI-E containing the three ORFs analyzed is described in Mercer et al, (1989) and Fraser et al. (1990). Construction
of recombinant
vaccinia
virus
The BarnHI-E fragment of OV NZ-2 was inserted into the insertion vector, pUV1 (Falkner et al., 1987) and this construct used to produce a vaccinia virus (Lister strain) recombinant by homologous recombination at the TK locus (Mackett et al., 1984). Recombinants were selected by plaque assay in the presence of 5-bromodeoxy-uridine and stained with 5-bromo4-chloro-3-indolyl-p-galactopyranoside (X-gal). Four plaque purification steps were carried out before virus stocks were prepared in 143B-TK- cells. The identity of the recombinant was confirmed by restriction endonuclease and DNA/DNA hybridization analyses of purified viral DNA. No hybridization was seen between the BarnHI-E fragment of OV and a HindIll digest of vaccinia virus DNA. The OV DNA fragment was orientated within the insertion vector such that the ITR region of the BarnHI-E fragment was adjacent to the vaccinia virus late promoter (PLl 1) carried by pUV1 (Falkner et a/., 1987). In this orientation the transcriptionally active ORFs of BarnHI-E were in the opposite orientation to that of both the adjacent vaccinia virus late promoter (Pl 1) and the more distant early TK promoter. RESULTS Northern
blot analysis
Northern blot analysis of OV early RNA showed three bands representing transcripts from BarnHI-E (Fig. 1). Two of these bands corresponded to RNAs of 1.7(ORF G/E) and 0.48-kb (ORF-1) and a slightly broader band corresponded to RNAs of between 0.70- (ORFpp) and 0.76-kb (ORF-3) (see Fig. 2A for the location of these ORFs in BarnHI-E). RNAs represented by these bands were clearly more abundant when total RNA was prepared from 143B-TK- cells infected with OV (OV(TK-) RNA) than from BT cells infected with OV (OV(BT) RNA) at the same m.o.i. Furthermore, the
466
FLEMING
REC
ORF BT
TK
BT
TK
FIG. 1. RNA transcripts detected by Northern blot analysis in cells infected with the orf virus or a vaccinia virus recombinant containing orf virus BarnHI-E. Total RNA isolated from either BT cells (BT) or 143B-TK- cells (TK) infected with either orf virus (or-f) or recombinant vaccinia virus (ret) in the presence of cycloheximide was extracted at 6 hr p.i., separated by gel electrophoresis, and transferred to a nitrocellulose membrane. The blot was incubated under annealing conditions with a 32P-labeled, nick-translated probe of orf virus BarnHI-E. The position of RNA size markers (BRL) in kb are shown at the right-hand side of the figure and the calculated sizes of the bands in kb on the left-hand side.
0.48-kb transcript, while barely detectable in OV(BT) RNA (Fig. 1, lane l), was prominent in OV(TK-) RNA (Fig. 1, lane 2). To determine if OV genes are transcribed in cells infected with the recombinant vaccinia virus containing the BarnHI-E fragment of OV DNA total RNA prepared from both 143B-TK- cells (rVV(TK-) RNA) and from BT cells (rW(Bt) RNA) infected with the recombinant virus were electrophoresed in parallel with OV(BT) RNA and OV(TK-) RNA and probed with radiolabeled BarnHI-E DNA (Fig. 1, lanes 3 and 4). Three bands were detected in recombinant-derived RNA and these had similar mobilities to those detected in OV derived RNA. However, the relative band densities varied within and between lanes. In lane 1 and lane 2 (OV-derived RNA) the 0.70-0.76-kb transcripts are clearly more abundant than the 0.48-kb transcripts in contrast with the recombinant-derived RNA (lanes 3 and 4) where the 0.48-kb and 0.70-0.76-kb transcripts are of similar abundance. The 1.7-kb band is more prominant in the OV(BT) RNA and OV(TK-) RNA (lanes 1 and 2) than in the rVV(BT) RNA and rVV(TK-) RNA (lanes 3 and 4). The finding of a 1.7-kb transcript in the rVV RNA was unexpected as a complete open reading frame which could give rise to a transcript of this size is not present in the BarnHI-E insert in the recombinant. As discussed below the 1.7-kb band in recombinant-derived RNA is likely to be read-through transcription from the ORF-pp promoter.
ET AL.
A Northern blotting procedure using ss-probes and OV-derived RNA was used to map the positions of early transcripts arising from the non-ITR portion of the BarnHI-E fragment (Fig. 2). It has been shown previously that there is only one early, transcriptionally active ORF in the ITR, ORF-3, to which the 0.76-kb transcript has been mapped (Fleming et al,, 1991). A ssprobe spanning the region between nucleotides 454-2233 (probe 1 in Fig. 2A) revealed three bands corresponding to mRNAs of 1.7-, 0.70-, and 0.48-kb and indicated that they are all transcribed head-to-tail in a rightward direction toward the end of the OV genome (Fig. 2B). The 0.76-kb mRNA transcribed from ORF-3 (Fleming et al., 1991) has been shown to be transcribed in the same direction. The three non-ITR transcripts correspond in size to ORF-pp, ORF-1, and ORF-G/E, allowing for the addition of a 200-300 poly(A) tract to each. It was a prediction that these transcripts would be early genes given the similarity of their A+T-rich flanking sequences to those found flanking other poxvirus early genes (Fraser eta/., 1990; J. S. Sullivan, A. A. Mercer, K. M. Fraser, and A. J. Robinson, unpublished data). Probes specific for each ORF were used in Northern blotting experiments to map the 1.7-, 0.70-, and 0.48-kb early transcripts (Fig. 2). This confirmed the results suggested above, namely, that the 1.7-kb transcript maps to ORF-G/E, which originates in BarnHI-G and terminates 1035 nucleotides into BarnHI-E, that the 0.70-kb transcript maps to ORF-pp (Mercer et al., 1989) which is located between nucleotides 1058-l 576, and that the 0.48-kb transcript maps to ORF-1 which is located between nucleotides 1504-l 879 (Fraser et a/., 1990). Northern blot analysis of recombinant-derived RNA, revealed that the 0.76-, 0.70-, and 0.48-kb transcripts map to the same ORFs as in OV-derived RNA (Fig. 2C). The 1.7-kb transcript was detected by probes 1, 6, and 7, but was not detected by probes 3 and 8, indicating that this mRNA is also transcribed in a rightward direction but, unlike the 1.7-kb transcript detected in OVderived RNA which maps to ORF-G/E, this transcript maps to a region spanned by ORF-pp and ORF-1. Unfortunately, probe 5 which had been used for Northern analysis of OV-derived RNA was lost and probe 8 which lies immediately adjacent to probe 5 was therefore used for Northern analysis of recombinantderived RNA. The 5’ ends of ORF-pp transcripts
ORF-pp, which spans a region in BarnHI-E from nucleotide 1058 to 1576 and has an initiation codon at 1 100 (Mercer et a/,, 1989; Fig. 4), codes for a polypep-
IN WI/O RECOGNITION
OF ORF VIRUS EARLY TRANSCRIPTIONAL
I kb
I
0
2
1 2
j
3
44
B 1
234567
1
2
C 3
4
8
6
7
FIG. 2. Mapping of early transcripts within the orf virus BarnHI-E fragment in orf virus-infected cells and in cells infected with a vaccinia virus recombinant containing the orf virus BarnHI-E fragment. (A) Map showing the location of the single-stranded (ss) MlB/orf virus recombinant DNA probes used in the analysis. The top line represents the orfvirus NZ-2 genome showing the location of BarnHI restriction endonuclease cleavage sites (Mercer et al., 1987). The relative positions of probes derived from the BarnHI-E fragment are shown numbered 1 to 8 on the expanded map below the genome map. Probes complementary to rightward transcripts are shown above the line and those complementary to leftward transcripts below the line. Probe 6 corresponds to double-stranded (ds) DNA and was labeled with 32P by nick-translation. The location of the 5’end of probe 7 was not known and is therefore shown as a broken line. ORFs which were transcriptionally active are labeled and shown as arrowed lines. The location of the inverted terminal repeat is indicated with a vertical dotted line and a heavy arrow. (B) Northern analysis. Total RNA isolated from TK- cells infected with orf virus in the presence of cycloheximide was extracted at 6 hr p.i, separated by electrophoresis in an agarose/formaldehyde gel, and transferred to a nitrocellulose membrane. Strips cut from this membrane were incubated under annealing conditions, first with a recombinant Ml 3
PROMOTERS
467
tide with sequence homology to an ORF in certain retroviruses (McClure et al., 1988), vaccinia virus F2L (Slabaugh and Roseman, 1989), and to Escherichia co/i dUTPase (McGeoch, 1990). Immediately upstream of the initiation codon is the sequence 5’-GAAAGTGTAAATTGTA, assumed to be an early promoter. S 1 nuclease analysis. OV(TK-) RNA or rVV(TK-) RNA was hybridized to a uniformly labeled probe (spanning nucleotides 880-1220, Fig. 3) and digested with nuclease Sl . Analysis of the protected fragments against the sequence from which the Sl probe was derived revealed four major protected fragments for OV(TK-) RNA, but only one with rVV(TK-) RNA. The protected fragment for the rVV(TK-) RNA was the same size as the shortest found with OV(TK-) RNA and identified a transcriptional start point (tsp) at nucleotide 1076, 24 nucleotides upstream from the ORF-pp ATG and 15 nucleotides downstream from the right end of the promoter-like sequence (Fig. 4). The other three major protected fragments found with OV(TK-) RNA most likely resulted from the protection of the Sl probe by 3’ ends of the adjacent 1.7-kb transcript (ORF-G/E). The shorter two of these mapped to positions 25 and 51 nucleotides downstream from the sequence 5’TTITTCT located at nucleotides 1038-1044 (Fig. 4) and probably represented major termination points of the 1.7-kb transcript. The absence of these larger protected fragments in rVV(TK-) RNA is consistent with the truncation of the ORF-G/E in the recombinant, such that it lacks a promoter at its 5’ end. The longest fragment seen in OV(TK-) RNA is the same size as the Sl probe and most likely arose as a result of complete protection of the probe by unterminated mRNA. Primer-extension analysis. A labeled primer 99 nucleotides in length and complementary to an internal region of the 0.70-kb transcript was synthesised from an M 13 recombinant template. The primer extension products were analyzed on a sequencing gel against a sequence of the template from which the primer was derived. OV(TK-) RNA and rVV(TK-) RNA each gave only one major band and these were of identical size (Fig. 3). The tsp measured by this method mapped to nucleotide 1076, in agreement with the result found by Sl analysis.
probe and then with 32P-labeled M 13 DNA. The numbers shown above the lanes correspond to the probe numbers in (A). The size markers shown in kb were obtained from BRL and the positions and sizes in kb of the relative bands are indicated with arrows. (C) Northern analysis of total RNA isolated from TK- cells infected with recombinant vaccinia virus and analyzed as in (B). The lane numbers correspond to the probe numbers in (A). The size markers and band sizes are shown as for(B) except the extra band at 0.76 is indicated.
468
FLEMING
ET AL.
PE ORF-pp
880 BBB cl::-
’ Bgl II
ACGTI
1121 I Xmn I
1220 I
ACGTl23
2
n BB
I
*PRIMER r
ISI
PROBE
PE
ORF 1
123
ACGT1234
ACGT
LPRIMER ISI PROBE
PE
Sl
ORF3
AGCT12
Sph
3
AGCTl
23
I
*PRIMER -‘SI
PROBE
FIG. 3. Sl nuclease and primer extension mapping of the 5’ ends of transcripts. Single-stranded 3*P-labeled probes were used for both Sl nuclease and primer extension analysis and were synthesised from recombinant M 13 DNA templates. Line diagrams show the strategies used for making probes to map mRNAs transcribed from ORF-pp, ORF-1, and ORF-3, respectively. The solid line represents a single-stranded fragment of orf virus DNA derived from BarnHI-E (Fraser et a/., 1990) and in the case of ORF-3 this line is flanked by M 13 DNA sequences represented by diagonally slashed lines. The arrowed open line represents a radiolabeled strand synthesized from orf virus-specific primers (stippled box) in ORF-pp and ORF-1 and from an Ml 3 forward sequencing primer (stippled box) in ORF-3. The ds-DNA product was digested in ORF-pp with eitherBg/ll for Sl mapping (Sl probe) orXmnl for primer extension; in ORF-1 with Kspl for Sl mapping orAvaIl for primer extension; in ORF-3 with either BarnHI, utilizing the BamHl site in the cassette for Sl mapping or the sphl site within the sequence for primer extension. Following digestion, the ds-DNA products were denatured, separated in a polyacrylamide gel, and recovered by electrophoresis. The approxi-
IN VW0 RECOGNITION
OF ORF VIRUS EARLY TRANSCRIPTIONAL
The 5’ ends of ORF-I transcripts ORF-1 spans a region from nucleotide 1645 to 1889 with an initiation codon at 1663 (Fraser et al., 1990). Immediately upstream of the initiation codon is the sequence 5’-AAAATTGTAAAATGTA, assumed to be the promoter of the ORF-1 gene. Sl n&ease analysis. OV(TK-) RNA and rVV(TK-) RNA were hybridized separately to a uniformly labeled ss-DNA probe which spanned nucleotides 1504-l 879 and each gave rise to a single major protected fragment of equal size after Sl digestion (Fig. 3). This result gave a tsp at nucleotide 1612, 51 nucleotides upstream from the ATG of ORF-1 and 18 nucleotides downstream from the putative promoter (Fig. 4). Primer-extension analysis. A labeled primer 98 nucleotides in length and complementary to an internal region of the 0.48-kb mRNA was synthesized from an Ml 3 DNA recombinant template. Primer extension products of OV and recombinant virus RNA gave only one major band in each assay and the extension products were of the same size. The tsp by the primer extension method mapped to nucleotide 1612, the same result as that obtained by Sl nuclease analysis. The 5’ ends of ORF-3 transcripts ORF-3 spans a region in BarnHI-E from nucleotides 2573 to 32 17 with an initiation codon at 2735. ORF-3 crosses the ITR junction at nucleotide 2617 (Fraser et al., 1990). The 5’ end of OV(BT) RNA transcribed from ORF-3 has been mapped by Sl nuclease and primerextension to nucleotide 2654 and nucleotide 2655, respectively (Fleming et a/., 1991). In the experiments now reported, the 5’end analysis was performed using rVV(TK-) RNA and compared with OV(BT) RNA. Sl nuclease analysis. The size of the major protected fragment for rVV(TK-) RNA was 192 nucleotides (Fig. 3) which mapped the tsp to nucleotide 2658, 77 nucleotides upstream from the ORF-3 ATG and 14 nucleotides downstream from the sequence 5’GCAAAGTGAAAAAGGA (Fig. 4). This tsp is four nucleotides downstream from that mapped in OV(BT) RNA (2654). Primer-extension analysis. rVV(TK-) RNA mapped the tsp to nucleotide 2655. The difference in the tsp
PROMOTERS
469
between OV(BT) RNA and rVV(TK-) RNA seen in Sl nuclease analysis was not apparent using the primer extension method where the tsps were identical.
DISCUSSION This study has shown that OV early promoters are recognized by vaccinia virus transcriptional factors. ORF-pp, ORF-1, and ORF-3 were faithfully transcribed in the recombinant virus. Little difference in transcript sizes was found between OV and the recombinant virus and tsps were shown to be identical or, in one case, within four nucleotides. The result also infers that OV transcription termination sequences are recognized by vaccinia virus transcription termination factors, assuming the poly(A) tails of equivalent transcripts are of similar length. A comparison of the relative densities of bands obtained by Northern blotting showed that OV genes are transcribed efficiently in cells infected with the recombinant virus and that at least one OV gene (ORF-1) may be transcribed more efficiently from the recombinant than from the OV genome. Another finding that emerged was the high yields of OV early RNA isolated from nonpermissive 143B-TK- cells compared with BT cells infected at the same m.o.i. in the presence of cycloheximide. It could be that because BT cells are primary cells and are likely to be a heterogenous population, a proportion of these cells do not become infected. Alternatively, the level of transcription may be enhanced in nonpermissive cells. Only primary cells of bovine, ovine, and human cells have been recorded as being permissive for OV and, generally, cells of other species and cell lines are nonpermissive (Robinson and Balassu, 1982) although some strains of virus have been adapted to vero cells (Hussain and Burger, 1989) and will grow in MRC-5 cells (R. Drillien, personal communication). The reason for this is not known and, as far as we are aware, the stage of the cell cycle at which the block occurs has not been investigated. It is not clear why nonpermissive 143B-TK- cells gave a higher yield of viral RNA, although a block at the level of DNA replication might be expected to give this result. These or other nonpermissive cell lines could be more
mate size, position of 5’ ends, and direction of transcription of transcripts are indicated by the arrow above each map. Sl mapping (Sl): Total RNA was annealed with the single-stranded Sl probes shown, digested with Sl nuclease, and the products were electrophoresed in a polyactylamide gel in parallel with standard sequencing reactions. Lanes A, C, G, and T, standard sequencing reactions; lane 1, undigested Si probe. In ORF-pp and ORF-1; lane 2, Sl products from RNA isolated from mock-infected cells; lane 3, RNA from orf virus-infected cells; lane 4, RNA from recombinant vaccinia virus-infected cells. In ORF-3; lane 2, Sl products from RNA isolated from orf virus-infected cells and lane 3, RNA from recombinant vaccinia virus-infected cells. Primer extension mapping (PE): Total RNA was annealed with the primers shown, extended with AMV reverse transcriptase, and the products were electrophoresed in a polyactylamide gel in parallel with standard sequencing reactions, Lanes A, G, C, and T, standard sequencing reactions; lane 1, primer extension products of RNA isolated from mock-infected cells; lane 2, RNA isolated from orf virus-infected cells; lane 3, RNA isolated from recombinant vaccinia virus-infected cells.
470
FLEMING
convenient than primary cells for studying OV early transcriptional events. In general, the sequences of the three OV early promoters examined fit well with the consensus sequence of vaccinia virus early promoters (Fig. 5) and the degree to which they diverge from that consensus is within the range of divergence found between individual vaccinia virus early promoters (Davison and Moss, 1989a). Davison and Moss (1989a) showed that an A residue 13 nucleotides upstream from the initiation site (-13) is of considerable importance for the function of vaccinia virus early promoters. When the sequences of the putative promoters of ORF-pp, ORF-1, and ORF-3 are aligned with the 7.5-kDa promoter so that each has an A residue at the 3’end of a sequence that has maximal homology with essential nucleotides in the critical region, the ORF-1 promoter shows almost complete identity (10 out of 11 nucleotides) with those nucleotides essential for strong promoter activity. A similar analysis of the ORF-pp promoter revealed 9 out of 11 nucleotides corresponding to essential nucleotides within the critical region while ORF-3 showed the least homology. The demonstration that these OV early promoters are recognized by vaccinia virus transcriptional factors is in keeping with this conservation of sequence. Furthermore, with the qualification that there are quantitative differences in RNA transcription, it suggests that early genes encoding immunologically functional OV
ORF-pp
s,' 1031 1041 1051 1061 1071 y 1081 CCCCTGATTTTTCTGGAGAGTGTAAATTGTACACCCCGTAGTC~ATCGGCCGCTCGCC 1091 2001 ACCCTAGCCATG
Critical region -28
region -13
7.5-kD promoter
AAAAgTaGAAAataTA
strong
AAAAATTGAAAAACTA
promoter
Initiation region
SpaCeK
12
-2
TTCTAATTTA;
-1 t6 : : TGCACGG
SI
ORF-pp
GAAAGTGTAAATTGTA
CACCCCGTAGT
0 CGATCGG 2
ORF-1
AAAATTGTAAAATGTA
GCTTCTTTTTA
ORF-3
GCAAAGTGAAAAAGGA
SI 0 CCGCCTAGCAG A
"; TTCGAGA a TCGAGAC
FIG. 5. Alignment of orf virus early promoter sequences with structural elements of the vaccinia virus 7.5.kDa early promoter and the critical region of a synthetic vaccinia virus strong early promoter (Davison and Moss, 1989a). Within the critical region of the 7.5.kDa promoter, nucleotides are designated as either essential (upper case) or not essential (lower case) for strong promoter activity. Transcription start points in orf virus early promoters determined by Sl mapping are shown as circles and by primer extension mapping as triangles.
proteins will be expressed from vaccinia virus recombinants carrying large fragments of OV DNA, without the need to locate individual orf virus genes and place them under the control of vaccinia virus promoters. In addition, evidence from sequence and transcriptional data (S. B. Fleming, J. Blok, A. A. Mercer, K. M. Fraser, and A. J. Robinson, manuscript in preparation) and transient assays (D. J. Lyttle and A. J. Robinson, unpublished data) indicate that late genes will also be expressed. REFERENCES
ORFl
51
1571 1581 1591 1601 1619 1621 ATCAGCTAATCAAAATTGTATGTAGCTTCTTTTTATTC~AGAGTCTCGCACAGTTGC 1641 1651 1661 1631 GTAGATAACACTAATTACAACACATTTAATCATG ORF3
ET AL.
Sl
0 2621 2631 2641 2651 . 2661 2671 GCCACGGAGCAAAGTGAGACCGCCTAGCA~TCGAGACCCTCCCGCCGCAGCCGCG 2681 2691 2701 2711 fj 2721 2731 GACACCCCACACCCGCCTTCCACCCGCCAGACG' AACACCGCAGCCAACAAGCATG
FIG. 4. Nucleotide sequences of the promoter regions of ORF-pp, ORF-1, and ORF-3. Transcriptional start points determined by Sl mapping in orf virus are shown as solid circles and in recombinant vaccinia virus as open circles. Primer extension tsps in orf virus are shown as solid triangles and in recombinant vaccinia virus as open triangles. The last digit of numerals are aligned with the corresponding nucleotide. The sequences likely to be the “critical regions” (Davison and Moss, 1989a) of the early promoters are underlined. The ATG shown at the end of each sequence is the first translation start codon.
BERK, A. J., and SHARP, P. A. (1977). Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of Sl endonuclease-digested hybrid. Cell 12, 721-732. BERTHOLET,C., STOCCO, P., MEIR, E. V., and WITTEK, R. (1986). Functional analysis of the 5’ flanking sequence of a vaccinia virus late gene. EMBO/. 5,1951-1957. BINNS, M., STENZLER, L., TOMLEY, F., CAMPBELL, J., and BOURSNELL, M. (1987). Identification by a random sequencing strategy of the fowlpoxvirus DNA polymerase gene, its nucleotide sequence and comparison with other viral DNA polymerases. Nucleic Acids Res. 15, 6563-6573. BOYLE, D. B., and COUPAR, B. E. H. (1986). Identification and cloning of the fowlpox virus thymidine kinase gene using vaccinia virus. J. Gen. viral. 67, 1591-l 600. BOYLE, D. B., COUPAR, B. E. H., GIBBS, L. J., SEIGMAN, L. J., and BOTH, G. W. (1987). Fowlpox virus thymidine kinase and nucleotide sequence and relationships to other thymidine kinases. Virology 156, 355-365. BOYLE, D. B., and COUPAR, B. E. H. (1988). Construction of fowlpox viruses as vectors for poultry vaccines. Virus Res. 10, 343-356. COCHRAN, M. A., PUCKET~,C., and Moss, B. (1985). In vitro mutagen-
IN V/l'0
RECOGNITION
OF ORF VIRUS EARLY TRANSCRIPTIONAL
esis of the promoter region for a vaccinia virus gene: Evidence for early and late regulatory signals. J. Viral. 54, 30-37. DAVISON,A. I., and Moss, B. (1989a). Structure of vaccinia virus early promoters. 1. Mol. Biol. 210, 749-769. DAVISON, A. J., and Moss, B. (1989b). Structure of vaccinia virus late promoters. J. Mol. Biol. 210, 77 l-764. DRILLIEN, R., SPEHNER,D., VILLEVAL, D., and LECOCQ,J. (1987). Similar genetic organization between a region of fowlpox virus DNA and the vaccinia virus HindIll J fragment despite divergent location of the thymidine kinase gene. Virology 160, 203-209. FALKNER, F. G., CHAKRAEIARTI,S., and Moss, B. (1987). pUV1: a new vaccinia virus insertion and expression vector. Nucleic Acids Res. 15,7192. FLEMING, S. B., FRASER, K. M., MERCER, A. A., and ROBINSON, A. J. (1991). Vaccinia virus-like early transcriptional control sequences flank an early gene in orf virus. Gene 97, 207-212. FRASER,K. M., HILL, D. F., MERCER, A. A., and ROBINSON,A. J. (1990). Sequence analysis of the inverted terminal repetition in the genome of the parapoxvirus, orf virus. Virology 176, 379-389. GERSHON, P. D., and BLACK, D. N. (1989). A capripoxvirus pseudogene whose only intact homologs are in other poxvirus genomes. Virology 172, 350-354. GLISIN, V., CRKVENJAKOV,R., and BYUS, C. (1974). Ribonucleic acid isolated by cesium chloride centrifugation. Biochemistry 13, 2633-2637. HUSSAIN, K. A., and BURGER,D. (1989). Invivo and in vitro characteristics of contagious ecthyma virus isolates: host response mechanism. Vet. Microbial. 19, 23-36. LEE-CHEN, C. Y., and NILES, E. G. (1988). Transcription and translation of the 13 genes in the vaccinia virus HindIll D fragment. Virology163,52-63. MACKETT, M., SMITH, G. L., and Moss, B. (1984). A general method for the production and selection of infectious vaccinia virus recombinants expressing foreign genes. J. Viral. 49, 857-864. MARS, M., and BEAUD, G. (1987). Characterization of vaccinia virus early promoters and evaluation of their informational content. J. MO/. Biol. 198, 6 19-63 1. MATTHEWS, R. E. F. (1982). Classification and nomenclature of viruses. lntervirology 17, l-l 99. MCCLURE, M. A., JOHNSON, M. S., FENG D.-F., and DOOLITTLE, R. F. (1988). Sequence comparisons of retroviral proteins: relative rates of change and general phylogeny. Proc. Nat/, Acad. Sci. USA 85, 2469-2473. MCGEOCH, D. J. (1990). Protein sequence comparisons show that the “pseudoprotease” encoded by poxviruses and certain retroviruses belong to the deoxyuridine triphosphatase family. Nucleic AcidsRes. 18,4105-4110. MCKNIGHT, S. L., GAVIS, E. R., KINGSBURY,R., and AXEL, R. (1981). Analysis of transcriptional regulatory signals of the HSV thymidine
PROMOTERS
471
kinase gene: Identification of an upstream control region. Cell 25, 385-398. MERCER,A. A., FRASER,K., BARNS, G., and ROBINSON,A. J. (1987). The structure and cloning of orf virus DNA. Virology 157, 1-l 2. MERCER, A. A., FRASER,K. M., STOCKWELL,P. A., and ROBINSON,A. 1. (1989). A homologue of retroviral pseudoproteases in the parapoxvirus, orf virus. Virology 172, 665-668. PLUCIENNICZAK,A., SCHROEDER, E., ZETTLEMEISSI,G., and STREECK, R. E. (1985). Nucleotide sequence of a cluster of early and late genes in a conserved segment of the vaccinia virus genome. Nucleic Acids Res. 13, 985-998. ROBINSON,A. J., and BALASSU,T. C. (1981). Contagious pustular dermatitis (orf). Vet. Bull. 51, 771-782. ROBINSON,A. J., ELLIS, G., and BALASSU,T. (1982). The genome of ori virus: restriction endonuclease analysis of viral DNA isolated from lesions of orf virus in sheep. Arch. Viral. 71, 43-55. ROBINSON, A. J., and MERCER, A. A. (1988). Or-f virus and vaccinia virus do not cross protect sheep. Arch. Viral. 101, 255-259. ROBINSON,A. J., and LYT~-LE,D. J. (1991). Parapoxviruses: their biology and potential as recombinant vaccines. In “Poxviruses as Vaccine Vectors” (M. M. Binns and G. L. Smith, Eds.). CRC Press, Boca Raton, FL. ROHRMANN, G., YUEN, L., and Moss, B. (1986). Transcription of vaccinia virus early genes by enzymes isolated from vaccinia virus virions terminates downstream of a regulatory sequence. Cell46, 1029-l 035. ROSEL, L. J., EARL, P. L., WEIR, J. P., and Moss, B. (1986). Conserved TAAATG sequence at the transcriptional and translational initiation sites of vaccinia virus late genes deduced by structural and functional analysis of the HindIll H genome fragment. 1. Viral. 60, 436-449. SANGER, F., NICKLEN, S., and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Nat/. Acad. Sci. USA 74,5463-5467. SLABAUGH,M. B., and ROSEMAN, N. A. (1989). Retroviral protease-like gene in the vaccinia virus genome. Proc. Nat/. Acad. Sci. USA 86, 4152-4155. ULLRICH, A., SHINE, J., CHIRGWIN, J., PICTET, R., TISCHER, E., RUTTER, W. J., and GOODMAN, H. M. (1977). Rat insulin genes: construction of plasmids containing the coding sequences. Science 196, 1313-1319. VASSEF,A. (1987). Conserved sequences near the early transcription start sites of vaccinia virus. Nucleic Acids Res. 15, 1427-l 443. WEIR, J. P., and MOSS, B. (1987). Determination of the transcriptional regulatory region of a vaccinia virus late gene. 1. Viral. 61, 75-80. WITTEK, R., KUENZLE,C. C., and WYLER, R. (1979). High C+G content in parapoxvirus DNA. J. Gen. W-o/. 43, 231-234. YUEN, L., and Moss, B. (1987). Oligonucleotide sequence signaling transcription termination of vaccinia virus early genes. Proc. Nat/. Acad. Sci. USA 84, 6417-6421.
