In vivo delivery of functional Flightless I siRNA using layer-by-layer polymer surface modification.

XML Template (2015) [27.3.2015–11:44am] //blrnas3.glyph.com/cenpro/ApplicationFiles/Journals/SAGE/3B2/JBAJ/Vol00000/150025/APPFile/SG-JBAJ150025.3d

(JBA)

[1–12] [PREPRINTER stage]

Biomaterials Processing

In vivo delivery of functional Flightless I siRNA using layer-by-layer polymer surface modification

Journal of Biomaterials Applications 0(0) 1–12 ! The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav DOI: 10.1177/0885328215579422 jba.sagepub.com

Penny J Martens1, Mai Ly1,2, Damian H Adams3, Kathryn R Penzkover1,2, Xanthe Strudwick3, Allison J Cowin3 and Laura A Poole-Warren1,2

Abstract Gene silencing using small interfering RNA has been proposed as a therapy for cancer, viral infections and other diseases. This study aimed to investigate whether layer-by-layer polymer surface modification could deliver small interfering RNA to decrease fibrotic processes associated with medical device implantation. Anti-green fluorescent protein labelled small interfering RNA was applied to tissue culture plates and polyurethane using a layer-by-layer technique with small interfering RNA and poly-L-lysine. In vitro studies showed that the level of down-regulation of green fluorescent protein was directly related to the number of coatings applied. This layer-by-layer coating technique was then used to generate Rhodamine-Flii small interfering RNA-coated implants for in vivo studies of small interfering RNA delivery via subcutaneous implantation in mice. After two days, Rh-positive cells were observed on the implants’ surface indicating cellular uptake of the Rhodamine-Flii small interfering RNA. Decreased Flii gene expression was observed in tissue surrounding the Rhodamine-Flii small interfering RNA coated implants for up to seven days post implantation, returning to baseline by day 21. Genes downstream from Flii, including TGF-b1 and TGF-b3, showed significantly altered expression confirming a functional effect of the Rhodamine-Flii small interfering RNA on gene expression. This research demonstrates proof-ofprinciple that small interfering RNA can be delivered via layer-by-layer coatings on biomaterials and thereby can alter the fibrotic process. Keywords Animal model, drug delivery, polyurethane, siRNA

Introduction Tissue healing following injury or disease is characterized by a cascade of events including coagulation, inflammation, granulation tissue formation, matrix deposition and remodeling. The implantation of synthetic materials into the body results in initiation of this cascade and in most cases ends with fibrosis. Excessive fibrosis or capsule formation around implants is a significant issue that can result in poor aesthesis, altered mechanical properties and even device failure in extreme cases. The down-regulation of genes associated with fibrosis would therefore be a desirable therapeutic approach to reduce fibrotic responses to biomaterials. Gene silencing using small interfering RNA (siRNA) has been proposed as a way to reduce gene expression

associated with many diseases including cancers, viral infections and fibrosis.1 The majority of the research effort on siRNA has focused on using it as a druglike molecule. One of the first and simplest methods studied was the delivery of naked siRNA. However, naked siRNA is susceptible to serum nucleases, has a short half-life in vivo, and may have unintended

1 Graduate School of Biomedical Engineering, UNSW Australia, Sydney, Australia 2 Cooperative Research Centre for Polymers, Notting Hill, Australia 3 Regenerative Medicine, Mawson Institute, University of South Australia, South Australia, Australia

Corresponding author: Penny J Martens, Graduate School of Biomedical Engineering, UNSW Australia, Sydney, NSW 2052, Australia. Email: [email protected]


(JBA)


2 consequences for non-targeted sites. Viral and non-viral vectors have therefore received much interest.2–6 For viral vectors, the mechanism of entry into the cell and uptake by the nucleus is relatively uncomplicated given that viruses are perfectly adapted to achieve this end. Viral vectors have also proven to yield high transfection efficiency in most cell lines.7 However, the major disadvantage of viruses as vectors relate primarily to safety concerns given previous reports of severe immune responses to viral proteins. Non-viral vectors such as liposomes, cholesterol, peptides, antibodies, polymeric nanoparticles and degradable polymeric chains have therefore received significant attention as alternatives to viral delivery despite tending to have lower transfection efficiencies.8,9 The mechanism of cellular uptake of siRNA complexes is not fully understood; however, cationic lipids or polymer chains are thought to enhance passage through the lipid bilayer component of the cell membrane. It is believed that the cationic complexes (lipid or polymer plus siRNA) interact electrostatically with the cell surface and are then endocytosed through a variety of pathways. Once internalized, the cationic complexes dissociate and the siRNA is released into the cytosol for subsequent passage into the nucleus for transcription. Cationic complexes can be achieved in several ways, with the nucleic acids being delivered either as polymer matrices/nanoparticles or loaded on a biomaterial surface. Polycationic nanoparticles, or polyplexes, are the most prolific areas of research and development for siRNA delivery. These include variants of polyethylenimine, chitosan, poly(L-lysine), cyclodextran, protamin and atelocollagen.10,11 The use of these polymeric entities is highly attractive due to the relative ease with which chemical modifications can be made to the polymer backbone. Studies have used a range of approaches to deliver siRNA via biomaterials, exploiting either surface association or encapsulation techniques. These include development of novel micelles,12 surface functionalized nanoparticles,13 siRNA-loaded nanoparticles and hydrogels14,15 and layer-by-layer techniques. These layer-by-layer approaches are simple and elegant and promising results have been reported, primarily using nanoparticulate delivery approaches.16 There have been limited reports examining layer-by-layer coatings on conventional biomaterials. A recent study demonstrated some efficacy in aortic smooth muscle cells using polyethylenimine-siRNA (PEI-siRNA) delivered following single dip coating of electrospun poly(ethylene terephthalate) grafts with PEI-siRNA polyplexes; however, in vivo studies were not conducted.17 In this study, Flightless I (Flii), a cytoskeletal protein and member of the gelsolin family of actin remodeling proteins, was used as a candidate protein

Journal of Biomaterials Applications 0(0) to demonstrate the effectiveness of siRNA bound to the surface of an implant for gene silencing. Previous studies have shown that Flii is an important inhibitor of fibrosis.18–20 Flii-deficient mice have improved wound healing with increased epithelial migration and enhanced wound contraction.18,21 Flii-overexpressing mice have impaired wound healing with larger, less contracted wounds, reduced cell proliferation and delayed epithelial migration.18 An added benefit is that reduced expression of Flii also affects collagen I synthesis in vitro and in vivo, with slower, more organized production of collagen leading to improved dermal architecture and reduced scarring.20 In this study, surface modification of a polymeric biomaterial surface with Flii siRNA and its subsequent delivery using in vitro and in vivo models was investigated. Specifically, delivery of siRNA via layer-by-layer coatings on biomaterial surfaces was examined.

Materials and methods Materials Polydopamine (PDA), dimethylacetamide (DMAc), EMEM (supplemented with 50 mg/ml streptomycin and 50 U/ml penicillin), Tris-HCl buffer, TrypsinEDTA and CY3-conjugated streptavidin were all purchased from Sigma-Aldrich, Sydney, Australia and used without further purification. Poly(ether)urethane 80 A pellets (PEU; Urethane Compounds, Melbourne, Australia), Decon 90 (Decon Laboratories, England) and sterile 3452 grease (Dow Corning, Sydney, Australia) were all used as received. HyClone DMEM and HyClone Fetal Bovine Serum (FBS) were purchased from Thermo Fisher Scientific, Victoria, Australia. Tissue culture polystyrene (TCPS) 24-well plates (Greiner bio-one (CellstarÕ ), Germany), 4-0 braided silk (Dysilk, Dynek Pty Ltd, South Australia, Australia), the various histology stains (DAKO Corporation, Botany, Australia), InSpeck Microscope Image Intensity Calibration Kits (Invitrogen, California, USA), TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and the DNA-free-kit (Ambion, Austin, Texas, USA) were used as supplied according to manufacturer’s instructions. Poly-L-lysine hydrobromide (30–70 kDa, MP Biomedicals, Sydney, Australia) (PLL) was dissolved in pyrogen-free water for irrigation (Baxter, Sydney, Australia) to a concentration of 1 mg/ml. The poly-L-lysine solution was placed in a cellulose membrane (Sigma-Aldrich, Australia) to dialyze over four days at 4 C with frequent water changes (three to four times per day). Dialyzed PLL was stored at 20 C as a stock solution and diluted to the appropriate concentration using water for irrigation as needed. Transfection agents (HiPerFect (HPF),


(JBA)


Martens et al.

3

rhodamine-labelled anti-green fluorescent protein (GFP) siRNA and rhodamine-labelled Flii siRNA (Flii Rh-siRNA)) were purchased from Qiagen, Melbourne, Australia. siRNA complexes were formed by adding 1.5 ml of 20 mM siRNA and 3 ml of HPF into 100 ml of serum-free media (EMEM supplemented with 50 mg/ml streptomycin and 50 mg /ml penicillin) followed by incubation at room temperature for 5 min to allow complex formation.

In vitro studies Layer-by-layer coating of cell culture plates. 24-well plates (TCPS) were coated with 190 ml of PLL (0.1 mg/ml) for 15 min with agitation at room temperature. Excess PLL was removed and well plates were air dried at room temperature before being rinsed twice with pyrogen-free water for irrigation and allowed to dry at room temperature (primer layer). Experimental wells coated with rhodamine labelled anti-GFP siRNA were exposed to 25 nM siRNA for 15 min with agitation. Excess siRNA was removed and well plates were air dried at room temperature. Rhodamine fluorescence in the solution was measured before and after exposure to the surface and the coating efficiency was estimated as Efficiency ¼ Fn =Fo 100 where Fo is the original solution fluorescence and Fn is the fluorescence after the nth exposure. Subsequent layers of either PLL or siRNA were coated in the same manner (Figure 1). Further confirmation of successful siRNA coating was conducted using fluorescence microscopy of uncoated, pre-coated and siRNA coated substrates. The layer-by-layer architecture used in this study was Primer-(siRNA–PLL)n where n is the number of siRNA–poly-L-lysine double layers. For example, a three double layer coating with PLL as the first two primer layers would consist of the following siRNA– PLL coating combination as shown in Figure 2. In this study, coatings of up to five double layers were examined.

Preparation of polyurethane biomaterial. PEU 80 A pellets were dissolved in DMAc at a concentration of 5 g PEU/ 100 g total solution at 60 C. The PEU solution was poured into a glass Petri dish and the solvent was removed under dry air atmosphere at 60 C in a laboratory vacuum oven for 48 h (partial vacuum of 400 to 500 mbar; Binder VD). The polyurethane sheets were cut into 10 mm discs using a punch and soaked in 2% Decon 90 for 24 h. The discs were then rinsed six times with Milli-Q water before further soaking in Milli-Q water for 48 h and dried in a laminar flow hood. These discs were sterilized by ethylene oxide prior to coating. For simplicity, the cast poly(ether)urethane will be referred to as polyurethane (PU). PU surfaces were treated prior to the layer-by-layer adsorption of PLL and rhodamine-labelled anti-GFP siRNA with an initial coating of PDA, which prepares the surface for coating.22 Forward and reverse target sequences of the anti-GFP siRNA hairpin transcript were GATCCCCGCAAGCTGACCCTGAAGTTCT TCAAGAGAG AACTTCAGGGTCAGCTTGCTTT TTGGAAA and AGCTTTTCCAAAAAG C A A GC T GACCCTGAA G T T CTCTCTTG AAGAACT TCA GGGTCAGCTTGCGGG.23 PU discs were soaked in a solution of PDA (2 mg/ml) in 10 mM Tris-HCl buffer at pH 8.5 for 24 h with constant shaking using an orbital shaker. The discs were then washed thoroughly with 10 mM Tris-HCl (pH 8.5) and dried inside a laminar hood. PDA-coated PU discs were placed inside the wells of 24-well plates and sterile 3452 grease was used to prevent movement of the discs. Prior to the cell culture studies, the discs were coated with PLL and siRNA using the same layer-by-layer technique as described previously. For the in vivo studies, Flii RhsiRNA was used to coat the PU discs for implantation. Similar to the in vitro studies, the PU discs were coated with PDA followed by two PLL primer layers and five siRNA–PLL double layers using the same method and concentrations as described previously.

Cell culture studies. Murine fibroblasts (NIH3T3) permanently transfected with GFP were plated onto pre-treated wells at a density of 5 104 cells/ml

Polycation siRNA TCPS

PLL-PLL-siRNA-PLL-siRNA-PLL-siRNA-PLL Primer

Figure 1. Schematic of attachment of siRNA to a surface. TCPS was first coated with polycation (PLL). A layer of siRNA was then coated on the surface, followed by a second layer of polycation.

Double layer 1

Double layer 2

Double layer 3

Figure 2. An example of a three double layer coating with PLL as the first two primer layers.


(JBA)


4 (2.5 104 cells/well). Transfection and subsequent gene suppression were allowed to proceed for 48 h. Cells were then trypsinised using Trypsin-EDTA (0.1% w/v) and quantification was performed. Successful transfection and gene suppression would result in a decrease in GFP expression in the cells that are transfected with the anti-GFP siRNA. Cellular fluorescence was analyzed using fluorescence-activated cell sorting (FACS; Becton Dickinson, Sydney, Australia) with 10,000 events in each triplicate sample being measured and the average decrease in fluorescence quantified. Baseline measurements of the cells in contact with tested surfaces (i.e. no siRNA) were taken as controls, and all other measurements were normalized to this baseline fluorescence. The current gold standard for siRNA delivery is the use of transfection agent with the siRNA in solution with the cells. Therefore, controls were conducted using complexes of HPF and rhodamine-labelled anti-GFP siRNA in the cell culture media. The average viability of the cells attached to various surfaces was also determined using the same seeding and transfection procedure as above. The percent viability of the cells was determined using a Vi-Cell XR 2.03 (Beckman Coulter, Lane Cove, Australia). siRNA knockdown of Flii. Primary human foreskin fibroblasts (HFFs) and keratinocytes (HaCaTs) were seeded into 6-well plates and cultured until 30–50% confluent at time of transfection. Flii siRNA GCUGGAACACU UGUCUGUGdTdT and CACAGACAAGUGUU CCAGCdTdT was transfected into the cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). Flii siRNA (250 ml) (optimized to final concentrations of 100 nM for HFFs, 60 nM for HaCaTs) in OptiMEM I reduced serum medium (Invitrogen, Carlsbad, CA, USA) was incubated for 20 min at room temperature with 250 ml Lipofectamine 2000 to form an siRNA:Lipofectamine complex. siRNA:Lipofectamine 2000 complex (500 ml) was added to each well, mixed and cells incubated for 6 h prior to replacing transfection media with 10% FBS-supplemented DMEM. Cells were incubated for 24 to 48 h for gene knockdown assessment. Scratch wound assay. HFFs were grown to confluence in DMEM with 10% FBS in 6-well plates then scratched with a P200 pipette tip, producing a wound of approximately 2 mm 1 cm. The cells were photographed at 0, 3, 6, 12, 24, 27, 30 and 48 h (using an Olympus F-View II 1.3 MP 12-bit camera (Olympus, Notting Hill, Victoria, Australia), Nikon TE-2000U microscope (Nikon Australia, Rhodes, NSW, Australia), and analySIS acquisition software (Soft Imaging System GmbH, Munster Germany)). Wound margins were measured using the Image Pro-Plus program

Journal of Biomaterials Applications 0(0) (MediaCybernetics Inc., Silver Springs, Maryland, USA) and rate of closure quantified as percent of initial wound area. Cell proliferation assay. HFFs and HaCaTs transfected with Flii siRNA, as described above, were cultured until confluent in a 37 C, 5% CO2 incubator before seeding into 96-well plates at a density of 4 104 cells/well. After 24 h, the media was replaced with serum-free DMEM and incubated for 4 h to synchronize the cell cycle. Cell proliferation assays were performed using the metabolic substrate WST-1 according to manufacturer’s protocols (Roche Applied Science, Munich, Germany). Briefly, 10 ml of WST-1 reagent was added to the cells and left at 37 C for 30 min. The presence of the formazan product was quantified using a dual absorbance of 450 nm and 600 nm using a plate reader.

Animal studies All experiments were approved by the Women’s and Children’s Health Network Animal Ethics Committee, Adelaide, following the Australian Code of Practice for the Care and the Use of Animals for Scientific Purposes. Studies were performed using mice with the BALB/c background. Three groups (time points Day 2, 7 and 21) of eight mice each (16–20 weeks old) were anaesthetized with inhaled isofluorane, and the dorsum shaved and cleaned with 10% w/v povidine iodine solution. A 2 cm long incision was created on the skin down the midline of the spine, midway between the scapulae and hindquarters. Pockets were created on both sides of the animal underneath the skin via blunt ended dissection perpendicular to the incision and extending approximately 2 cm to each side. The pockets were held open with forceps to allow the implants to be placed into the cavity without folding. The side of the implant coated with the treatment was placed in contact with the underlying dermis. Treatment and control Flii Rh-siRNA layer-by-layer implants were placed within the same animal but were randomized for the side utilized. The incisions were closed with two sutures of 4-0 braided silk. Implants were harvested at 2, 7 and 21 days. Day 2 implants were viewed under fluorescent microscope. Skin surrounding implants was collected, with half fixed in formalin for histology and immunohistochemistry. The other half was frozen in liquid nitrogen for mRNA extraction. Histology, immunohistochemistry and image analysis. Histological sections (4 mm) were cut from paraffinembedded fixed tissue. Sections were stained with hematoxylin and eosin, Masson’s Trichrome or subjected to immunohistochemistry following antigen retrieval


(JBA)


Martens et al.

5

according to the manufacturer’s protocols. Following blocking in 3% normal horse serum, primary antibody against Flii (1:400) (Flightless I (116.40) Santa-Cruz Biotechnology, Dallas, USA), biotinylated anti-rabbit IgG secondary antibody (1:200) (Sigma-Aldrich, Castle Hill, Australia) were used and detection was made by CY3-conjugated streptavidin (1:200) (SigmaAldrich, Castle Hill, Australia). Fluorescence intensity per unit area was determined using analySIS software package (Soft Imaging System GmbH, Munster Germany) and optical fluorescence analyzed in epidermis and dermis of the wounds, as previously described.18 InSpeck Microscope Image Intensity Calibration Kits were used to define fluorescence intensity levels for constructing calibration curves and evaluating sample brightness. Negative controls included replacing primary antibodies with normal rabbit IgG, or normal mouse IgG. For verification of staining, non-specific binding was determined by omitting primary or secondary antibodies. All control sections had negligible immunofluorescence. Real-time qRT-PCR. Total RNA was extracted from skin samples using TRIzol reagent according to manufacturers’ protocols. Contaminating genomic DNA was removed using a DNA-free-kit. cDNA was synthesized from 1 mg RNA using reverse transcriptase. cDNA together with specific primers were set up to a final concentration of 1 SYBR Green, 1 Amplitaq PCR buffer, 3 mM MgCl2, dNTPs (200 mM each), 0.9 mM of primers (forward and reverse) and 1.25 units AmpliTaq Gold DNA polymerase in 25 ml H2O. RT-qPCR reactions were run with an initial 95 C step for 15 min to activate the Taq buffer, then 35 cycles of: denaturation (95 C for 30 s), annealing (60 C for 30 s) and elongation (72 C for 30 s). Cycle threshold values for TGF-b1 and TGF-b3 were normalized first to Cyclophilin A (CypA) to obtain values for fold change. Primers used for RTqPCR analysis are shown in Table 1.

Statistical analysis Statistical differences were determined using the Student’s t-test or an ANOVA. For data not following

a normal distribution, the Mann-Whitney U test was performed. A p value of less than 0.05 was considered significant.

Results Layer-by-layer delivery of siRNA in vitro. The first step in developing an in vitro cell culture model was to test whether the double layer structures of siRNA and PLL could be formed on a TCPS surface, and to determine whether or not cells were viable in the presence of the materials. The coating efficiency of siRNA deposited from solution was estimated between 40 and 60% using FACS (see Table 2). No significant differences were observed between the number of double layers that were formed. Fluorescence microscopy did not detect any fluorescence on control TCPS, or TCPS followed by exposure to siRNA. However, following PLL coating, fluorescence was able to be observed after exposure of the PLL layer to a single coating of siRNA (data not shown). In addition, the number and percentage viability of cells were equivalent across all control and test TCPS base surfaces. For the cell transfection study, fibroblasts were permanently transfected with GFP and siRNA was chosen such that it would interfere with the GFP expression.23 For controls, cells were coated on TCPS with no siRNA present (TCPS baseline). Cells were also coated with siRNA–HPF transfection complex present in the media solution (TCPS Control). Additionally, the TCPS was coated with PLL (PLL baseline), and with PLL and siRNA–HPF transfection complex present in the media solution (PLL Control). In both cases, when siRNA–HPF was present, a significant decrease in GFP expression was observed compared to the baseline values (56.1% suppression for TCPS control and 45.7% suppression for PLL control; p < 0.02; Figure 3). No difference was observed between the TCPS and PLL baselines (Figure 3). siRNA–PLL double layers (3, 4, or 5) were fabricated, and tested as compared to the PLL baseline. Figure 3 shows that all of the siRNA double layers caused a decrease in the amount of GFP expression. Analysis of variance showed a statistically significant decrease in GFP gene expression of

Table 1. Primer sequences used in real-time qPCR. Gene Flii Gelsolin TGF-b1 TGF-b3 CypA

Forward primer 5

0

CCTCCTACAGCTAGCAGGTTATCAAC3 50 CAGACAGCCCCTGCCAGCACCC3 0 50 CCACACTTCTCTTTTTGGCG3 0 0 5 AAGCGCACAGAGCAGAGAAT3 0 0 5 GGTTGGATGGCAAGCATGTG3

Reverse primer 0

50

GCATGTGCTGGATATATACCTGGCAG3 50 GAGTTCAGTGCACCAGCCTTAGGC3 0 50 TCACCGAGCTCTGTTGACAA3 0 0 5 AGTGTCAGTGACATCGAAAG3 0 50 TGCTGGTCTTGCCATTCCTG3

0


(JBA)


6

Journal of Biomaterials Applications 0(0)

Table 2. Coating efficiency, cell count and percentage viability for a variety of test surfaces. Coating

Coating efficiency (%)

No. of viable cells/ml ( 105)

Percentage viability

TCPS TCPS-PLL One double layer (TCPS) Two double layer (TCPS) Three double layer (TCPS) Four double layer (TCPS) Five double layer (TCPS) PU PU-PDA-PLL Five double layer (PU)

– – 57.3 61.9 47.4 49.9 38.8 – – –

5.4 0.3 6.3 0.1 – – 4.4 0.2 4.6 0.3 5.1 0.8 1.0 0.2 0.9 0.2 1.5 0.9

89.9 1.6 93.3 2.9 – – 89.0 2.7 89.7 0.7 85.4 1.6 70.0 1.9 67.5 9.0 74.2 6.6

GFP Expression (% of baseline)

120 100 80 60 40 20 0 S CP

T

l l ine ers ers ers line ntro ntro lay lay lay ase Co Co ble ble ble LL LB u u u PS L P o o o C P T 3d 5d 4d

sel

Ba

Figure 3. GFP expression in murine fibroblasts (NIH3T3) permanently transfected with GFP exposed to anti-GFP siRNA. Results are expressed as a percentage of baseline values. TCPS bars are cells on tissue culture polystyrene, while PLL bars represent plates that have been coated with PLL prior to exposure to cells. Baseline bars represent plates that have had no exposure to siRNA or HiPerFect. Control refers to cells exposed to the siRNA/HiPerFect transfection complex in solution and represent maximal transfection. The last three bars represent surfaces coated with two layers of PLL (primer coat) and three to five double layers, respectively. All PLL surfaces were normalized to the PLL baseline, while the TCPS surfaces were normalized to TCPS baseline. Data represent the mean and standard error of the mean from four independent experiments. For three and four double layers, data represent mean and standard error of the mean from two independent experiments. (*) represents values that are significantly different from their baseline values with p < 0.05 and (**) represent values that are significantly different from their baseline values with p < 0.02.

7.7% (three double layers, p ¼ 0.049), 12.3% (four double layers; p < 0.02) and 18.5% (five double layers; p < 0.02) when compared to PLL baseline value. This result clearly demonstrates that the siRNA that was originally adhered to the surface was able to enter the cells and produce the desired inhibition of green

florescence. This result also indicates a dose response, with more double layers causing a greater decrease in GFP expression. These experiments were further developed by coating the siRNA–PLL on PU-PDA discs. The number and percentage viability of the cells in contact with surfaces are shown in Table 2. It is evident that the base PU surface was not ideal for cell growth with numbers significantly lower than those observed for the TCPS surfaces. However, no differences were observed between the base PU surfaces and those coated with the PLL or siRNA for either the number of cells or the percent viability. The transfection ability of the siRNA when bound to a model biomaterial surface was tested in a similar method to that described above. Analogous controls were performed in this experiment, where the PUPDA discs were used as a baseline with no siRNA present (PU-PDA baseline), and with siRNA–HPF in solution (PU-PDA Control). In addition, a further control where the PU-PDA discs were also coated with PLL was tested without siRNA (PU-PDA-PLL baseline) and with siRNA–HPF in solution (PU-PDA-PLL Control). In both cases, the siRNA–HPF complex resulted in a significant drop in GFP expression (35.4% suppression for PU-PDA and 43.5% suppression for PU-PDA-PLL), and there was no significant difference observed between the PU-PDA and PUPDA-PLL baseline values (Figure 4). When the discs were coated with five double layers of siRNA/PLL, a decrease of 23.3 21.1% was observed as compared to the PLL baseline, although this was not statistically significant (p ¼ 0.093). Flii siRNA reduces Flii gene expression and affects cellular proliferation and migration. RNA was extracted from human fibroblasts treated with increasing concentrations of Flii siRNA for 24 h. Real-time qPCR revealed decreased expression of Flii mRNA with 100 nM


(JBA)


Martens et al.

GFP Expression (% if baseline)

140 120 100 80 60 40 20 0 l rs rol ine ntro aye ont sel Co le l Ba L AC b L L u D L o -P A-P 5d A-P PU -PD -PD PU PU line

ase

AB -PD

PU

Figure 4. GFP expression in murine fibroblasts (NIH3T3) permanently transfected with GFP exposed to anti-GFP siRNA. Results are expressed as a percentage of baseline values. PU-PDA bars are cells on polyurethane discs precoated with PDA for 24 h while PU-PDA-PLL bars represent polyurethane discs that have been pre-coated with PDA for 24 h and also PLL prior to exposure to cells. Baseline bars represents plates that have had no exposure to siRNA or HiPerFect. Control refers to cells that have been exposed to the siRNA/HiPerFect transfection complex in solution. The last bar represents surfaces coated with two layers of PLL (primer coat) and five double layers of siRNA–PLL. All PU-PDA-PLL surfaces are normalized to the PU-PDA-PLL baseline, while the PU-PDA surfaces are normalized to PU-PDA baseline. Results represent the mean and standard error of the mean from three independent experiments.

siRNA with an observed 82% decrease in Flii gene expression (Figure 5(a)). No effect was observed on family member gelsolin confirming specificity of the siRNA for Flii. Fibroblast monolayers treated with either Flii specific siRNA or scrambled siRNA were scratch wounded and the effect on wound migration determined by measurement of the residual wound area at different time points post wounding (Figure 5(b) to (d). Representative images of control wounds (Figure 5(b)) or Flii siRNA treated wounds (Figure 5(c)) at 9 h post-wounding are shown. A significant increase in the rate of cellular migration into the wound deficit was observed with scratch wounds treated with Flii siRNA with fibroblasts migrating into the wound faster than control fibroblasts. Increased proliferation was also observed in both human fibroblasts (Figure 5(e)) and human keratinocytes (Figure 5(f)) treated with Flii siRNA. Flii siRNA reduces Flii gene expression in vivo. Once it was established that the siRNA–PLL double layers could be coated on the surface of a biomaterial and that the siRNA was active and could affect cells in vitro, studies were performed to determine if Flii siRNA could be

7 delivered to skin cells in vivo. Flii siRNA layer-by layer coated and uncoated implants were inserted into subcutaneous pockets on the dorsal surface of mice. To determine the intracellular uptake of Flii Rh-siRNA, the implants and surrounding tissue were excised after two days and viewed using bright field and fluorescence microscopy (Figure 6). Fluorescently labelled cells were observed adhered to the Rh-siRNA-treated implants (Figure 6(a)) confirming that the Flii siRNA had been taken up by the surrounding cells. Bright field microscopy showed cells adhering to the surface of the implants with increased number of cells attached to the siRNA-treated implants (Figure 6(b)). Control implants were lacking in fluorescence (Figure 6(c)) and appeared to have fewer cells attached to the surface (Figure 6(d)). To determine the functionality of the siRNA on the implant, RNA was extracted from the skin samples at 2, 7 and 21 days post-insertion (Figure 7) and Flii gene expression determined using quantitative RTqPCR. Flii mRNA was reduced in the skin surrounding the implant at day 2 (p ¼ 0.063) but this only became statistically significant at day 7 post-insertion (p ¼ 0.035) as compared to control implants indicating prolonged release of the siRNA over time (Figure 7(a)). By day 21, mRNA levels had returned to control levels confirming no permanent effect on Flii gene expression was occurring. Previous studies have shown that changes in Flii gene expression directly affect TGF-b1 and TGF-b3.19 Therefore, to determine whether Flii siRNA on the implants was affecting downstream genes TGF-b1 and TGF-b3 gene expression was also assessed. A significant reduction in TGF-b1 was observed at two days post-insertion (p ¼ 0.034) but by seven days TGF-b1 levels had increased (p ¼ 0.035) and remained elevated at 21 days post-injury (Figure 7(b)). In contrast, TGFb3 which was reported to work conversely to TGF-b1 in the skin,24 was observed to be significantly increased at day 2 in response to Flii siRNA treatment (p ¼ 0.044) (Figure 7(c)), and then return to control levels by day 7. Skin samples collected from around the implants at 2, 7 and 21 days were also assessed histologically. The number of cells within a fixed area of the dermis immediately above the implants (Figure 8(a)) or in the subpanniculus carnosus space surrounding the implants (Figure 8(b)) was counted. A significant increase in cellularity was observed in the Flii siRNA-coated implants (p ¼ 0.016; Figure 8(a)) in the dermis when compared to controls at day 2 post-insertion. This cellular infiltrate consisted predominantly of fibroblasts and inflammatory cells. However, by days 7 and 21, no difference in cell numbers was observed between control and treated implants with cell numbers returning to basal levels by day 21. Increased numbers of cells were also observed in the sub-panniculus carnosus area surrounding the



(JBA)

8

Journal of Biomaterials Applications 0(0) (c)

(b)

1.0

20 0

0

Gene expression

40

24

Gelsolin

12

Flii

60

9

0.0

80

6

0.5

Control Flii siRNA

100

3

(d) % Original Wound Area

Fold Change

(a) 1.5

Time post-wounding (hours)

(f) 300

Fibroblasts

Proliferation (% control)

Proliferation (% control)

(e) 150

100

50

Keratinocytes

200

100

0

0 Control

siRNA

Control

siRNA

Figure 5. Flii siRNA increases cell migration and proliferation in skin cells. Relative gene expression levels of Flii and gelsolin in human fibroblasts treated with 100 nM Flii siRNA for 24 h as determined by RTqPCR (a). Flii siRNA and control treated Human fibroblast cell migration as determined via scratch wound assay (b–d). Scratch wound at 6 h in control (b) and Flii siRNA treated fibroblasts (c). Graph of % original wound area up to 24 h post scratch (d) Scratch wound assay results represent mean standard error of the mean n ¼ 9 for each group, *p < 0.05 vs. equivalent control time-point for t 3 days. WST-1 cell proliferation assay results of human fibroblasts (e) and keratinocytes (f). Proliferation results represent mean standard error of the mean. n ¼ 12 for each group, fibroblasts, *p < 0.05 (¼0.029) vs. control. Keratinocytes were treated with FliI siRNA (60 nM) for 24 h. Proliferation results represent mean standard error of the mean n ¼ 12 for each group, fibroblasts, *p < 0.05 (¼ 0.021) vs. control.

(a)

(b)

Flii siRNA (c)

(d)

Control

Figure 6. Uptake of Flii siRNA by cells surrounding implants. Rhodamine-labelled Flii siRNA coated (a, b) and control implants (c, d) were excised from the dorsal surface of the mice after two days and viewed using fluorescence (a, c) and bright field microscopy (b, d). Increased cellularity was observed on the siRNA-treated implants (A, B vs. control C, D) and positive immunofluorescence was observed within cells attached to the implants (A, inset at higher magnification). Magnification bar in D ¼ 50 mm and applies to A–D.



(JBA)

Martens et al.

9

(a) 1.0

Fold change

0.8

Discussion Flii

0.6

*

0.4 0.2 0.0 2

7

21

Time post insertion (days)

Fold change

(b) 2.0 1.5

TGF-β1

*

*

7

21

1.0 0.5

*

0.0 2


(c) 2.5

Fold Change

2.0

*

TGF-β3

1.5 1.0 0.5 0.0 2

7

21


Figure 7. Decreased Flii gene expression post insertion of Flii siRNA. RNA was extracted from siRNA and control treated skin at 2, 7 and 21 days post-insertion. The effect of Flii siRNA on gene expression was determined using quantitative RTqPCR. Decreased Flii (a) and TGF-b1 (b) gene expression was observed at two and seven days post insertion returning to baseline levels by 21 days. (c) Increased TGF-b3 gene expression was observed at two days post insertion returning to baseline levels at days 7 and 21. Figure represents means and standard error of means. n ¼ 6 per group per time-point. *p < 0.05.

implant at day 2 although this was not statistically significant (p ¼ 0.059; Figure 8(b)). To determine if changing Flii gene expression by siRNA had an effect on Flii protein production in the skin, Flii was assessed using immunohistochemistry (Figure 9). Interestingly, no significant effect was observed on Flii protein in the skin surrounding the implants at days 2 and 7 although at day 21, there was a slight but statistically significant decrease in Flii protein expression (p ¼ 0.044) suggesting that treatment with siRNA may have a long-term effect on Flii protein expression in the skin.

While it is generally recognized that siRNA is a powerful technique, several factors have limited the widespread clinical application of siRNA duplexes as a therapeutic modality or even as an investigational tool in vivo, including their large molecular weight, negative charge, susceptibility to enzymatic degradation and difficulties in controlling cellular uptake and intracellular activity.25–27 The overall approach of this study encompassed in vitro and in vivo demonstration of proof-of-principle that siRNA could be delivered via the surface of a biomaterial, and specifically that Flii siRNA was still active in promoting wound repair. Using a layer-by-layer technique, we were able to deliver siRNA–PLL double layer coatings on both TCPS and PU discs up to five double layers thick. In vitro studies showed that TCPS coated with antiGFP siRNA could reduce levels of GFP expression in stably transfected GFP-producing 3T3 cells. While both surfaces demonstrated that the siRNA on the surface was able to enter the cells and inhibit the GFP expression, the level of inhibition was different between the two surfaces. A significant and dose dependent inhibition was observed on the base TCPS surfaces, with more double layers causing a greater decrease in expression. The PU surfaces also demonstrated a very clear inhibition but this result was not significant. Further optimization of the protocol through the modification of PLL molecular weight or the concentration of siRNA, could result in more gene suppression. However, this optimization was outside the scope of this work, and the clear demonstration of a decrease in GFP expression was sufficient. siRNA–PLL double layer coatings were also developed on PU discs, with an initial surface preparation using PDA suitable for subcutaneous implantation. This layer-by-layer technique was then used to prepare implants suitable for the evaluation of the uptake of a candidate siRNA presented on a polymeric biomaterial in vivo. We chose to focus on the cytoskeletal protein Flii, as we have previously shown that siRNA against Flii reduces gene expression and affects cellular proliferation and migration when delivered by traditional transfection methods in vitro.18 Using layer-by-layer coating technology, Flii Rh-siRNA was attached to PU discs and successfully delivered to the surrounding tissues in vivo with a prolonged release over time but in a non-permanent fashion. This Flii Rh-siRNA was functional, with a reduction in Flii gene and protein expression observed in the tissues surrounding the implants. Flii has previously been shown to differentially modulate the expression of TGF-b1 and TGF-b3.28


(JBA)


10

Journal of Biomaterials Applications 0(0) 25 20

Control

*

Flii siRNA

15 10 5 0

(b) 60 Cellularity (cells/μm2 ×10–4)

Cellularity (cells/μm2 ×10–4)

(a)

Control Flii siRNA

40

20

0 2

21 7 Time post insertion (days)

2

7 21 Time post insertion (days)

Figure 8. Increased cellularity in Flii siRNA skin samples. Tissue surrounding the implants was collected at days 2, 7 and 21 and sections subsequently stained with hematoxylin and eosin. The number of cells within a fixed area of the dermis immediately above the implants (a), or in the sub-panniculus carnosus surrounding the implants (b), was counted using light microscopy. Figure represents means and standard error of means. n ¼ 6 per group per timepoint. *p < 0.05.

Control Flii siRNA

40

Flii Fluorescence Intensity

*P=0.044 35

30

25

20 2

7 Time post insertion (days)

21

Figure 9. Effect of Flii siRNA on Flii protein production. Skin immediately adjacent to the implants was assessed for Flii protein using immunohistochemistry and quantified using image analysis. No significant effect of Flii siRNA was observed at days 2 and 7; however, at day 21, a slight but statistically significantly decrease in Flii protein expression was observed in Flii siRNAtreated samples. Figure represents means and standard error of means. n ¼ 6 per group per time-point. *p < 0.05.

These cytokines are important regulators of scar formation and fibrosis with TGF-b1 stimulating collagen synthesis, fibrosis and scar formation, while TGF-b3 has an opposing effect leading to reduced scar formation.24 A decrease in TGF-b1 and an increase in TGFb3 were observed in the tissues surrounding the implants that delivered the Flii Rh-siRNA confirming that the Flii siRNA was functional and that by reducing Flii gene expression in vivo it was possible to modulate the expression of genes involved in the fibrotic response. An increase in cellularity was also observed both on the Flii Rh-siRNA implants and in the surrounding tissue. Increased cellular proliferation has

previously been observed following reduction of Flii gene expression in vitro18 again confirming the functionality of the delivered siRNA. The layer-by-layer coating technique developed here effectively delivers functional siRNA in vitro and in vivo on multiple substrates with the ability to fine tune the level of gene silencing by manipulating the numbers of double layers. Recent developments in the field of nanotechnology have further advanced in vivo delivery of siRNA,29,30 but there are still some safety concerns due to their retention in the body and localization to the liver or conversely, the elimination of the nanoparticles from the body into the surrounding environment with unknown consequences.31 By utilizing surface chemistry modification in conjunction with layer-bylayer technology, it is possible to generate novel biomaterials which can release siRNA in situ that affect target gene expression, and subsequent modulation of downstream genes. This method of siRNA delivery offers potential promise for the generation of surface modified materials to be used to not only improve the success of implantation of devices but potentially in the development of functional wound dressings which may improve the wound healing process by silencing specific genes, such as Flii.

Conclusions In summary, siRNA can be coated onto the surface of biomaterial implants using a layer-by-layer technique. We have shown that siRNA that is adhered and delivered to the surrounding cells is functionally active, and the amount and timing of cellular uptake can be controlled through the number of layers on the implant. The ability to be able to deliver siRNA from a biomaterial has other applications such as reducing fibrosis associated with implanted medical


(JBA)


Martens et al. devices and the development of novel wound healing dressings. Funding This study was supported by the Cooperative Research Centre for Polymers. AJC is supported by a senior research fellowship (GNT1002009) from the National Health and Medical Research Council of Australia.

Declaration of conflict of interest None declared.

References 1. Scholz C and Wagner E. Therapeutic plasmid DNA versus siRNA delivery: common and different tasks for synthetic carriers. J Control Release 2012; 161: 554–565. 2. Freeley M and Long A. Advances in siRNA delivery to T-cells: potential clinical applications for inflammatory disease, cancer and infection. Biochem J 2013; 455: 133–147. 3. Cambon K and De´glon N. Lentiviral-mediated gene transfer of siRNAs for the treatment of Huntington’s disease. Methods Mol Biol 2013; 1010: 95–109. 4. Sadio A, Gustafsson JK, Pereira B, et al. Modified-chitosan/siRNA nanoparticles downregulate cellular CDX2 expression and cross the gastric mucus barrier. PLoS One 2014; 9: e99449. 5. Buerkli C, Lee SH, Moroz E, et al. Amphipathic homopolymers for siRNA delivery: probing impact of bifunctional polymer composition on transfection. Biomacromolecules 2014; 15: 1707–1715. 6. Li H, Hao Y, Wang N, et al. DOTAP functionalizing single-walled carbon nanotubes as non-viral vectors for efficient intracellular siRNA delivery. Drug Deliv. Epub ahead of print 3 June 2014. DOI: 10.3109/ 10717544.2014.919542 7. Nasri M, Karimi A and Allahbakhshian Farsani M. Production, purification and titration of a lentivirusbased vector for gene delivery purposes. Cytotechnology. Epub ahead of print6 March 2014. DOI: 10.1007/s10616-013-9652-5 8. Leong KW, Mao HQ, Truong-Le VL, et al. DNA-polycation nanospheres as non-viral gene delivery vehicles. J Control Release 1998; 53: 183–193. 9. Pirollo KF and Chang EH. Targeted delivery of small interfering RNA: approaching effective cancer therapies. Cancer Res 2008; 68: 1247–1250. 10. Howard KA. Delivery of RNA interference therapeutics using polycation-based nanoparticles. Adv Drug Deliv Rev 2009; 61: 710–720. 11. Yang YY, Wang Y, Powell R, et al. Polymeric core-shell nanoparticles for therapeutics. Clin Exp Pharmacol Physiol 2006; 33: 557–562. 12. Sun TM, Du JZ, Yan LF, et al. Self-assembled biodegradable micellar nanoparticles of amphiphilic and cationic block copolymer for siRNA delivery. Biomaterials 2008; 29: 4348–4355.

11 13. Bae KH, Lee K, Kim C, et al. Surface functionalized hollow manganese oxide nanoparticles for cancer targeted siRNA delivery and magnetic resonance imaging. Biomaterials 2011; 32: 176–184. 14. Zhou J, Patel TR, Fu M, et al. Octa-functional PLGA nanoparticles for targeted and efficient siRNA delivery to tumors. Biomaterials 2012; 33: 583–591. 15. Nguyen K, Dang PN and Alsberg E. Functionalized, biodegradable hydrogels for control over sustained and localized siRNA delivery to incorporated and surrounding cells. Acta Biomater 2013; 9: 4487–4495. 16. Deng ZJ, Morton SW, Ben-Akiva E, et al. Layer-by-layer nanoparticles for systemic codelivery of an anticancer drug and siRNA for potential triple-negative breast cancer treatment. ACS Nano 2013; 7: 9571–9584. 17. Nabzdyk CS, Chun MC, Oliver-Allen HS, et al. Gene silencing in human aortic smooth muscle cells induced by PEI-siRNA complexes released from dip-coated electrospun poly(ethylene terephthalate) grafts. Biomaterials 2014; 35: 3071–3079. 18. Cowin AJ, Adams DH, Strudwick XL, et al. Flightless I deficiency enhances wound repair by increasing cell migration and proliferation. J Pathol 2007; 211: 572–581. 19. Adams DH, Ruzehaji N, Strudwick XL, et al. Attenuation of Flightless I, an actin-remodelling protein, improves burn injury repair via modulation of transforming growth factor (TGF)-beta1 and TGF-beta3. Br J Dermatol 2009; 161: 326–336. 20. Jackson JE, Kopecki Z, Adams DH, et al. Flii neutralizing antibodies improve wound healing in porcine preclinical studies. Wound Repair Regen 2012; 20: 523–536. 21. Ruzehaji N, Kopecki Z, Melville E, et al. Attenuation of flightless I improves wound healing and enhances angiogenesis in a murine model of type 1 diabetes. Diabetologia 2014; 57: 402–412. 22. Lee H, Dellatore SM, Miller WM, et al. Mussel-inspired surface chemistry for multifunctional coatings. Science 2007; 318: 426–430. 23. Kim HS, Jeong HJ, Cho CK, et al. Target-specific gene silencing by siRNA plasmid DNA complexed with folatemodified poly(ethylenimine). J Control Release 2005; 104: 223–232. 24. Shah M, Foreman DM and Ferguson MW. Neutralisation of TGF-beta 1 and TGF-beta 2 or exogenous addition of TGF-beta 3 to cutaneous rat wounds reduces scarring. J Cell Sci 1995; 108: 985–1002. 25. Aigner A. Applications of RNA interference: current state and prospects for siRNA-based strategies in vivo. Appl Microbiol Biotechnol 2007; 76: 9–21. 26. Aagaard L and Rossi JJ. RNAi therapeutics: principles, prospects and challenges. Adv Drug Deliv Rev 2007; 59: 75–86. 27. Haupenthal J, Baehr C, Zeuzem S, et al. RNAse A-like enzymes in serum inhibit the anti-neoplastic activity of siRNA targeting polo-like kinase 1. Int J Cancer 2007; 121: 206–210. 28. Adams DH, Strudwick XL, Kopecki Z, et al. Gender specific effects on the actin-remodelling protein Flightless I and TGF-beta1 contribute to impaired


(JBA)


12 wound healing in aged skin. Int J Biochem Cell Biol 2008; 40: 1555–1569. 29. Dahlman JE, Banes C, Khan OF, et al. In vivo endothelial siRNA delivery using polymeric nanoparticles with low molecular weight. Nat Nanotechnol 2014; 9: 648–655.

Journal of Biomaterials Applications 0(0) 30. Lee H, Lytton-Jean AKR, Chen Y, et al. Molecularly self-assembled nucleic acid nanoparticles for targeted in vivo siRNA delivery. Nat Nanotechnol 2012; 7: 389–393. 31. Stern ST and McNeil SE. Nanotechnology safety concerns revisited. Toxicol Sci 2007; 101: 4–21.

Unique Surface Modification of Silica Nanoparticles with Polyethylenimine (PEI) for siRNA Delivery Using Cerium Cation Coordination Chemistry.

TLR9-Targeted SiRNA Delivery In Vivo.

Assessment of In Vivo siRNA Delivery in Cancer Mouse Models.

Effect of surface properties on liposomal siRNA delivery.

Functional Delivery of siRNA by Disulfide-Constrained Cyclic Amphipathic Peptides.

Green aqueous surface modification of polypropylene for novel polymer nanocomposites.

Applications of Functional Amyloids from Fungi: Surface Modification by Class I Hydrophobins.

Rational modification of oligoarginine for highly efficient siRNA delivery: structure-activity relationship and mechanism of intracellular trafficking of siRNA.

Arginine-terminated generation 4 PAMAM dendrimer as an effective nanovector for functional siRNA delivery in vitro and in vivo.

Systematic evaluation of antibody-mediated siRNA delivery using an industrial platform of THIOMAB-siRNA conjugates.

Topical delivery of siRNA into skin using SPACE-peptide carriers.

Direct cytosolic delivery of siRNA using nanoparticle-stabilized nanocapsules.

Improving the in vivo therapeutic index of siRNA polymer conjugates through increasing pH responsiveness.

Evaluation of dendrimer type bio-reducible polymer as a siRNA delivery carrier for cancer therapy.

Amphipathic homopolymers for siRNA delivery: probing impact of bifunctional polymer composition on transfection.

Degradable polymer-coated gold nanoparticles for co-delivery of DNA and siRNA.

siRNA delivery to the glomerular mesangium using polycationic cyclodextrin nanoparticles containing siRNA.

Hypoxia-targeted siRNA delivery.

In vivo comparison of local versus systemic delivery of immunostimulating siRNA in HPV-driven tumours.

In vivo gene silencing following non-invasive siRNA delivery into the skin using a novel topical formulation.

Tumor targeting RGD conjugated bio-reducible polymer for VEGF siRNA expressing plasmid delivery.

Taking charge of siRNA delivery.

Hybrid lipid-polymer nanoparticles for sustained siRNA delivery and gene silencing.

Cationic Polymer Modified Mesoporous Silica Nanoparticles for Targeted SiRNA Delivery to HER2+ Breast Cancer.