Bioscience, Biotechnology, and Biochemistry
ISSN: 0916-8451 (Print) 1347-6947 (Online) Journal homepage: http://www.tandfonline.com/loi/tbbb20
In Vivo Biotinylation of Fusion Proteins Expressed in Escherichia coli with a Sequence of Propionibacterium freudenreichii Transcarboxylase 1.3S Biotin Subunit Naoko Yamano, Yoshikazu Kawata, Hiroyuki Kojima, Koji Yoda & Makari Yamasaki To cite this article: Naoko Yamano, Yoshikazu Kawata, Hiroyuki Kojima, Koji Yoda & Makari Yamasaki (1992) In Vivo Biotinylation of Fusion Proteins Expressed in Escherichia coli with a Sequence of Propionibacterium freudenreichii Transcarboxylase 1.3S Biotin Subunit, Bioscience, Biotechnology, and Biochemistry, 56:7, 1017-1026, DOI: 10.1271/bbb.56.1017 To link to this article: http://dx.doi.org/10.1271/bbb.56.1017
Published online: 12 Jun 2014.
Submit your article to this journal
Article views: 24
View related articles
Citing articles: 8 View citing articles
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20 Download by: [91.213.8.236]
Date: 06 June 2016, At: 09:36
Biosci. Biotech. Biochem., 56 (7), 1017-1026, 1992
In Vivo Biotinylation of Fusion Proteins Expressed in Escherichia coli with a Sequence of Propionibacterium freudenreichii Transcarboxylase 1.3S Biotin Subunit Naoko YAMANO, Yoshikazu KAWATA, Hiroyuki KOJIMA,t Koji YODA,* and Makari YAMASAKI* Government Industrial Research Institute, Osaka, Midorigaoka 1-8-31, Ikeda, Osaka 563, Japan The University of Tokyo, Bunkyo-ku, Tokyo 113, Japan Received October 11, 1991
* Department of Agricultural Chemistry,
Downloaded by [91.213.8.236] at 09:36 06 June 2016
Biotinylation of fusion proteins in E. coli was studied using a sequence of Propionibacterium freudenreichii transcarboxylase 1.3S biotin subunit. As the biotinylation sequence, we examined two sequences: one was of amino acid residues [84-123] of 1.3S, a partial sequence containing a region from a conserved tetrapeptide (Ala-Met-Bct-Met) around the biotinyllysine (Bet) to the carboxyl terminal; the other was of an almost entire sequence [18-123]. We constructed recombinant plasmids for fusion proteins of p-galactosidase, of chloramphenicol acetyltransferase, and of alkaline phosphatase. We found the biotinylation in the [18-123] sequence fused to alkaline phosphatase.
Biotin is known to bind specifically to avidin with the association constant of over 10 15 M- 1. This avidin-biotin binding has been used in many analytical techniques: 1) affinity chromatography, protein blotting, immunoassays, and gene probes. In these techniques, biotinylated agents have so far been prepared only chemically. However, in living systems from bacteria to mammalian, there are a variety of biotinylated enzymes, called biotin enzymes. For the biosynthesis of biotin enzymes, the biotinylation occurs at the Lys residue of apoenzymes, being catalyzed by biotin holoenzyme synthetase (BHS). Interestingly, BHS acts across species barriers, i.e., BHS from one organism biotinylates the apoenzyme from another. 2) Recent developments of analyses of biotin enzymes have shown that almost all the enzymes conserve a tetrapeptide sequence Ala-Met-Bct-Met (Bct: biotinyllysine) around the biotinyl site and the location of Bct at the 35th residue from the carboxyl terminal. 2) These facts suggest that the biotinylation may be possible only if we provide a specific sequence for a peptide of interest. We were interested in production of a biotinylated hybrid protein in Escherichia coli using a sequence of biotin enzymes. We selected a biotin subunit of Propionibacterium shermanii transcarbonylase, since it had been the most studied. 2 -11) The biotin subunit, called 1.3S, consists of 123 amino acids. Its gene was cloned, sequenced, and expressed in E. coli by Murtif et al. S ) Wood et al. 7 ) and Murtif et al. 11 ) studied functional relations of some conserved sequences in 1.3S. The relations are not fully understood. At least it can be said for the biotinylation that the conserved tetrapeptide only is insufficient and that a hydrophobic nature of the carboxyl terminal region is indispensable. In this report we studied two types of biotinylation sequences (called a biotin-tail hereafter) for fusion to the carboxyl end of a target protein. One sequence was of the amino acid residues [84--l23J of 1.3S, a partial sequence containing the region from the conserved tetrapeptide to the carboxyl terminal. Its gene was synthesized and t
connected to the 3'-end of the rt-complementing part of the fJ-galactosidase gene (lacZ') and of the chloramphenicol acetyltransferase gene (cat). The other was of the [18-l23J of 1.3S, an almost entire sequence of the biotin subunit, which was cloned here from P. freudenreichii IFO 12426. It was connected to the 3'-end of the fJ-galactosidase gene (lacZ) and of the alkaline phosphatase gene (phoA) of E. coli. Both genes were truncated with a deletion of their carboxyl terminal region. Expressions of those fused proteins in E. coli were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and the biotinylations were analysed by fluorography using cells grown in a medium containing 14C-Iabeled biotin. We found that the sequence [18-l23J caused biotinylation in the fusion protein with alkaline phosphatase.
Materials and Methods Bacterial strains and plasmids. Bacterial strains used as recipients for recombinant plasmids were derivatives of E. coli K-12; HB101 (supE44, hsdS20(r B-, mB -), recA13, ara-14, proA2, lac YI, galK2, rpsL20, xyl-5, mtl-I, mcrA +, mcrB-), JM109 (recAI, supE44, endAI, hadR17, gyrA96, relAI, thi, J(lac-proAB)jF'[traD36, proAB+, lacI q , lacZi1MI5] , mcrA -, mcrB+) and MC1061 (hsdR, ara139i1(araABC-leu) 7679, i1lacX74, galU, galK, rpsL, thi, mcrA -, mcrB-). P.freudenreichii IFO 12426 was obtained from Culture Collection of the Institute for Fermentation, Osaka. Plasmids pBR322, pUC18, pUC19, pHSG397, pHSG399 (Takara Shuzo), pDR540, and pKK223-3 (Pharmacia) were used for cloning and construction of the hybrid plasmids. The genes of chloramphenicol acetyltransferase, ,B-galactosidase, and alkaline phosphatase were prepared from pHSG399, Agt11 (Promega), and pKI_2,12) respectively. Media and culture conditions. The E. coli strains were usually grown aerobically in L-broth at 37°C. Antibiotics were used at concentrations of 50,ugjml for ampicillin, l70,ugjml for chloramphenicol, and 50,ugjml for tetracycline. P. freudenreichii IFO 12426 was grown in PYG medium (5 g of peptone, 5 g of yeast extract, 109 of glucose, 0.5 g of Tween 80 per liter) at 30°C. For minimum media, we used DM medium (10.5 g of K 2HP0 4, 4.5g ofKH 2P0 4, l.Og of (NH4hS04' 0.5g of Na'citrate' 2H 20, 0.2g of MgS0 4 ' 7H 20, 2gofg1ucose, 25 ,ugofthiamine' HCl per liter) and Medium 12Jl3) (12 g of Tris, 4.68 g of NaCl, 1.5 g of KCl, 1.08 g of NH 4C1, 0.35 g of Na 2S0 4, 0.20 g of MgCl2> 29 mg of CaC1 2, 0.5 mg of FeC1 3, 0.27 mg ofZnC1 2, 2g of glucose, 25,ug of thiamine' HC1, and 8.3 x 1O- 4 M K 2HP0 4 (for normal conditions) or 8.3 x 10- 5 M K 2HP0 4 (for phosphate limited conditions) per liter, pH 7.5).
To whom correspondence should be addressed.
NII-Electronic Library Service
NII-Electronic Library Service
BamBI
Biotin-tail (BI) lac
lacZ'
BamBI
Biotin-tail (BI)
BamBI digestion
BamHI
90
Construction of Plasmids pDR-BT and pUC-BT.
*
100
110
120
A gene for the biotinylation sequence BT was prepared from synthesized oligonucleotides. The nucleotide and amino acid sequences of BT are illustrated below in the figure. The conserved tetrapeptide and biotinylated Lys (Bet) are indicated with a box and *, respectively. Abbreviations: lac, lac promoter; tac, tac promoter.
Fig. 1.
XhoI
tac
Xhol
BamBI digestion
Biotin-tail fragment
BamBI lacZ'
GATCCAATG GTTCTCGAGIGCCATGAAGATG GAGACCGAGATCAACGCTCCCACCGACGGCAAGGTCGAGAAGGTCCTTGTCAAGGAGCGTGACGCCGTGCAGGGCGGTCAGGGTCTCATCAAGATCGGCTGA TAG GTTAC CAAGAGCTC CGGTACTTCTAC CTCTGGCTCTAGTTGCGAGGGTGGCTGCCGTTCCAGCTCTTCCAGGAACAGTTCCTCGCACTGCGGCACGTCCCGCCAGTCCCAGAGTAGTTCTAGCCGACT ATCCTAG DPM VLE AMKM ETEINAPTDGKVEKVLVKERDAVQGGQGLIKIG-
BamHI
BamBI
Downloaded by [91.213.8.236] at 09:36 06 June 2016
~
~
a
a:: >-
--
~
00
§
In Vivo Biotinylation of Fusion Proteins Expressed in E. coli Synthesis of oligonucleotides. Oligonucleotides were synthesized by the phosphoramidide method using a DNA synthesizer (Nippon Zeon, ZEON GENET A-III) based on the DNA sequence of the P. shermanii W52 transcarboxylase biotin subunit 1.3S. The oligonucleotides were purified by electrophoresis. Molecular cloning of the transcarboxylase biotin subunit l.3S gene. The biotin subunit 1.3S was cloned from P. freudenreichii IFO 12426 as described by Murtif et al. S ) Chromosomal DNA was digested with PstI completely and inserted into the PstI site of pBR322. E. coli HBlOl was transformed with these hybrid plasmids. Selection of positive colonies was done by dot blot hybridization. Probes were prepared from a hybrid
1019
plasmid containing the oligonucleotides synthesized above and labeled with a digoxigenin labeling system (Boehringer Mannheim). Protein detection and enzyme assay. Proteins produced with the recombinant plasmids were analyzed by SDS-PAGE. 14 ) For analysis of low molecular weight proteins, a modified SDS-PAGE using urea by Kyte et al. (SUDS-PAGE)15) was used. Gels were stained with Coomassie brilliant blue. p-Galactosidase activity was assayed with o-nitrophenyl-pD-galactoside (ONPG) by the method of Miller. 16l For induction of the lac promoter, cells were grown with isopropyl-l-thio-p-D-galactoside (IPTG, 1mM). Alkaline phosphatase activity was measured with p-nitrophenyl phosphate (NPP) as described by Kreuzer et al. 13 ) using
BamBI
Sau3AI
Downloaded by [91.213.8.236] at 09:36 06 June 2016
BamBI digestion
Sau3AI digestion
Sau3AI tae
Seal BamBI
Biotin-tail fragment
Seal partial digestion
BamBI digestion
BamB I linker BamBI digestion
Sau3AI tae
hoi Biotin-tai I (BT) Seal Fig. 2.
Construction of pDRCm-BT for Fusion to Chloramphenicol Acetyltransferase.
The BamHI linker was introduced between cat and BT to connect BT with the 3'-end of cat in frame.
NII-Electronic Library Service
NII-Electronic Library Service
~
U
~,
+
21.5 kDa-
30 kDa-
46 kDa-
!Xl I
E-4
+
-
!Xl I U
E-4
+
46 kDa-
~
E-4
---
P4
~
U
.-4
Q)
oJ
~
0.
Q
II
.' t
~
~
14.3 kDa-
21. 5 kDa-
30 kDa-
P.
~
~
10
~
0
0.
~
~
~
I
+
46
21. 5
-
PI
~
10 ~
"'l:l'
0
-
e:t
d
0 0
0 0
d
~
0 0
~ .j.J
M
.j.J
0 M
0
.-l
-
0
...-4
D
...-4
C
Analyses of the Total Proteins by Protein Staining (A, C) and of Biotinylation by Fluorography (B, D) for the Fusion Proteins with the Biotin-tail [84-123].
~
c.>
,-l
C1)
e:t o o
~ .j.J
o
...-4
-
13
-
~ ~
~
~
I
~
E-4
+
Strain JMI09 was used as the host for all the plasmids. The transformants were grown with (+) or without IPTG (-). SUDS-PAGE was used for the analyses of pUCI9, pDR-BT and pUC-BT (A, C), while SDS-PAGE was for pDR540 and pDRCm-BT (B, D). Electrophoresis for the fluorographic analysis was in a different run from that for the protein analysis, but the electrophoretic conditions were the same as that of corresponding SDS-PAGE.
Fig. 3.
3.4 kDa_
6.5 kDa-
14.3 kDa_
21. 5 kDa-
30 kDa-
.A.
Downloaded by [91.213.8.236] at 09:36 06 June 2016
f2-
~
o
z
:>
~
-< :>
z
0
N
;:;
1021
In Vivo Biotinylation of Fusion Proteins Expressed in E. coli cells grown in Medium 121 in both the normal and the phosphate-limited conditions.
and exposed to X-ray film (NewRX, Fuji) at - 70°C for 1 to 3 months.
Results Detection of biotinylated proteins. Biotinylated proteins were analyzed by fluorography. E. coli harboring the hybrid plasmids were grown in DM medium or Medium 121, containing 0.024,uCi/ml 14C-biotin (1.96 GBq/ mmol, Amersham). The total cell extract was fractioned by SDS-PAGE which was done under the same conditions as that for the protein detection. After treatment with a sensitizer (Amplify, Amersham), gels were dried
Biotinylation with the partial sequence [84-123J 0/ 1.38 biotin subunit We synthesized the oligonucleotides of which sequences are shown in Fig. 1. It contains a gene corresponding to the amino acid sequence [84-123J of 1.3S biotin subunit
PI EcoRI
Xbal
D---P'~ Agt 11
ReoRI, Xbal digestion ~eoRI
XbaI
Downloaded by [91.213.8.236] at 09:36 06 June 2016
5.2 Ib IaeZ fragment
SaIl digestion
SaIl
1.15 Ib PI fragment SaIl digestion
IaeZ EeoRI SaIl
ReoRI, Seal digestion
SaIl
Seal Hindlll lacZ
all hoI PI Seal
Fig. 4.
Construction of pUClac-PT for the Fusion to f3-Galactosidase.
The lacZ gene with deletion of the carboxyl terminal region was extracted from 19t11. A 1.15-kb Sall fragment, PT, containing the amino acid sequence [18-123J of the 1.3S biotin subunit was extracted from pBR-PT for the biotin-tail. Both were ligated with their EcoRI ends. Ap, ampicillin resistance gene.
NII-Electronic Library Service
N.
1022
YAMANO
of P. shermanii transcarboxylase and flanking sequences for introduction of BamHI end at both 5'- and 3'-ends. The sequence [84--123J just covers the region from the conserved tetrapeptide around Bct (marked with a box and * in Fig. 1) to the carboxyl terminal. 8) The translation initiation codon was also introduced in the 5'-flanking sequence. The synthesized DNA fragment was designated BT (l35bp). We constructed three plasmids using the BT fragment as a biotin-tail: the plasmid pDR-BT was directed to express
et ai.
the peptide only from BT, pUC-BT to express a fusion protein to part of the a-complementating region (amino acid residues [1-16J) of j3-galactosidase (LacZ'), and pDRCm-BT to express a fusion protein to chloramphenicol acetyltransferase (CAT). Details of the construction of these plasmids are illustrated in Figs. 1 and 2. In pDR-BT, the translation initiation codon in the 5' -flanking sequence of BT was arranged at a suitable position under the tac promoter. In pUC-BT, the BT fragment was inserted into lacZ' under the lac promoter in pUCI9. In pDRCm-BT Hindlll
Hindlll
Downloaded by [91.213.8.236] at 09:36 06 June 2016
Sphl
Hindlll, Sphl digestion
+
Hind I I I. Sph I digestion -1-.-6-I-b--h-o-A-f-r-a-g-m-e-n-t-1 P
Xhol
phoA
Pstl SaIl
PI all
Fig. 5.
Construction of pHSGAP-PT for Fusion to Alkaline Phosphatase.
The phoA gene was extracted from pKI-2 with deletion of the carboxyl terminal region. The biotin-tail gene PT was connected with the 3'-end of phoA at the Sall ends of pHSGAP. em, chloramphenicol resistance gene.
NII-Electronic Library Service
Downloaded by [91.213.8.236] at 09:36 06 June 2016
In Vivo Biotinylation of Fusion Proteins Expressed in E. coli
(Fig. 2), the cat gene was truncated with a deletion of 9 amino acids in the carboxyl terminal region, and connected with BT via a BamHi linker. The fusion protein consists of [1-2IOJ amino acid residues of CAT and a linker peptide, Ser-Asp-Pro-Met, and [84-123J of 1.3S biotin subunit. Figures 3-A and 3-C show the analysis of the total proteins expressed in E. coli. For the analysis of pDR-BT and pUC-BT SUDS-PAGE was used, because a much smaller size of the products was expected. In Fig. 3-A pUC-BT gives no band to be intensified by the addition of TPTG, at the position expected from its molecular weight, 6.4 kDa. The product of pDR-BT (4.4 kDa) was not detected either (data not shown). In fJ-galactosidase assay, however, a distinct increase of the activity was recognized for pUC-BT upon the addition of IPTG (data not shown). This may suggest that the pUC-BT expressed the fusion product at a very low level. Presumably both products are mostly lysed in the cells because of their incompleteness as a protein. On the other hand, the expression of pDRCm-BT is clearly recognized on the addition of IPTG at the position of its molecular weight (27 kDa) in Fig. 3-C. The fusion protein maintained the activity of CAT, since the transformant JMI09 harboring pDRCm-BT grew in LB medium containing 25,ugjml chloramphenicol.
Fig. 6.
1023
Figures 3-B and 3-D show analysis of the biotinylation by fluorography. The cells were grown in DM medium with 14C-labeled biotin. A strong band at the bottom in common to all the lanes corresponds to free biotin. If the products were biotinylated with BHS in E. coli, they should give an extra band. However, only a single band in common to that of the controls pUC19 and pDR540 appears, as shown in Figs. 3-B (for pDR-BT and pUC-BT) and 3-D (for pDRCm-BT). The position of the common band agrees with that of an endogenous biotin enzyme, acetyl-CoA carboxylase biotin carboxyl carrier protein (22.5 kDa). It should be noted that the films were exposed for three months. The sensitivity of fluorography of the three month exposure is comparative to that of a fJ-galactosidase assay. These results show that the fusion proteins of pUC-BT and pDRCm-BT are not biotinylated in E. coli. Biotinylation with the sequence [18-123} of 1.38 biotin subunit The biotin subunit gene of P. freudenreichii was cloned from strain TFO 12426 by following the procedure ofMurtif et al. who used the P. shermanii strain W52. 8 ) We obtained a positive clone for 1.3S gene on pBR322 (designated pBR-PT). It contained the PstT fragment of 1.7 kb and
Analysis of the Total Proteins by SDS-PAGE for the Fusion Proteins with the Biotin-tail [18-123].
(A) is for fusion proteins to {i-galactosidase and (B) is to alkaline phosphatase. In (A), the cells with pUClac and pUClac-PT were grown with IPTG. In (B), the cells were grown under the normal conditions ( - ) and under the phosphate-limited conditions ( + ).
NII-Electronic Library Service
N.
1024
showed consistent digestion patterns with those expected from the sequence of 1.3S when it was treated with several restriction endonucleases. The PstI fragment was inserted into pUC19 and pKK223-3 at their PstI sites under the lac promoter and the tac promoter, respectively. Both plasmids expressed a protein of which the molecular weight was identical to that of 1.3S biotin subunit. The biotinylation of the product was confirmed by fluorography. Consequently, this cloned DNA fragment certainly contains the complete gene of the 1.3S biotin subunit. To produce biotinylated fusion proteins, we selected j1-galactosidase and alkaline phosphatase of E. coli as a fusion partner. The latter is a well characterized periplasmic enzyme and its gene was cloned by Yoda et al. 12 ) Procedures for the plasmid constructions are illustrated in Figs. 4 and 5. A 1.15-kb fragment made by digestion of pBR-PT with Sail is used for the gene of the biotin-tail and designated PT. It contains the gene for the amino acid residues [18-123J of 1.3S and of a O.8-kb sequence downstream
from the carboxyl terminal. For the fusion to f3galactosidase, the lacZ gene was extracted from A gtll, with deletion of 16 amino acids from the 3'-end of lacZ, and connected with PT (pUClac-PT). Between lacZ and PT, codons for 9 extra amino acids were inserted as a linker. For fusion to alkaline phosphatase, its gene phoA was extracted from plasmid pKI-2. It contains the promoter and the signal sequences of phoA. 17 ) In pHSGAP-PT, 23 amino acids were deleted from the 3'-end of phoA. Between the phoA and PT codons for His-Arg-Trp were inserted as a linker. Expression of the fusion proteins was analyzed by SDS-PAGE (Figs. 6-A and 6-B). In Fig. 6-A, JMI09 harboring pUClac-PT is seen expressing an extra portein of which the molecular weight agrees with that expected (l24kDa). In Fig. 6-B, three strains of E. coli, HBI0l, JMI09, and MCI061, harboring pHSGAP-PT express the fusion protein with alkaline phosphatase. The size of the fusion protein is approximately 56 kDa, provided that the
13
.A.
Downloaded by [91.213.8.236] at 09:36 06 June 2016
et al.
YAMANO
e-.
~
p., I
~
CJ ttl
I CJ I'd
...-1
...-1
Co) ~
Co) ~
........
........ -t 0
c.
-t
0 ~
l:Q
=:
c.
..-I
l:Q
:=
CJ I'd
CJ I'd
...-1
...-1
Co) ~
::>
c. ........ Cl)
0 ..-I
i!;
Co)
E-4
p., I
l:I:l
c. ........
Cl)
-t
0 ..-I
~
~
I
~00 ~00
c.
........
e-.
0 ..-I
~
l:I:l
E-4
e-.
E-4
~00
I
I
I
l:I:l 04
c.
........
Cl)
co
........
0
~
0
..-I
..-I Co)
~
:E
::I::
~
~
~
~00 l:I:l
C.
........ ~
~
~00
Ci
........
Cl)
co
0
~
~
+
~00
l:I:l
l:I:l Po!
........
0
~
p., I
~
0
~
Co)
~
X
+
+
- 46 kDa
- 30 kDa
Fig. 7.
Analysis of the Biotinylation by Fluorography for the Fusion Proteins with the Biotin-tail [18-123].
(A) is for fusion proteins to f3-galactosidase and (B) is to alkaline phosphatase.
NII-Electronic Library Service
In Vivo Biotinylation of Fusion Proteins Expressed in E. coli
Table I. Activity of fJ-Galactosidase and Alkaline Phosphatase with Biotin-tail Strain fJ-Galactosidase HBlOl
JM109
Alkaline phosphatase HBlOl
JMl09
Downloaded by [91.213.8.236] at 09:36 06 June 2016
MC106l
Plasmid
None pUClac pUClac-PT None pUClac pUClac-PT None pHSGAP pHSGAP-PT None pHSGAP pHSGAP-PT None pHSGAP pHSGAP-PT pKI-2
Enzymatic activity (units)
7.9 85.1 77.4
4.7 105.3 55.8 0.016 0.015 ND 0.050 0.044 ND 0.057 0.012 0.006 1.85
ND, not detected. Activity of fJ-galactosidase was measured by colorimetry with ONPG. The cells were grown with IPTG. Activity of alkaline phosphatase was measured with p-nitrophenyl phosphate. The cells were grown in Medium 121 (phosphate-limited conditions).
signal sequence of alkaline phosphatase is processed. 12) The band is distinguished for the cells grown in the phsophate-limited Medium 121 (marked by + in Fig. 6-B). This indicates that the phoA promoter works in pHSGAP-PT. There is no distinct difference of the expression level among the three strains. The biotinylation is analyzed by fluorography in Fig. 7. The fusion protein to fj-galactosidase gives no extra band for either HBI0l or JMI09 harboring pUClac-PT. The thick band at the bottom is attributed to free biotin and the endogenous biotin enzyme. On the other hand, pH8GAP-PT gives an extra band in the phosphate-limited medium. This band is assigned to the fusion protein with alkaline phosphotase, because it is nearly at the position expected. Although the band appears only for HBI0l and MCI061 in the figure, a prolonged exposure of the film gave a weak band for JMI09, too. Thus, the level ofbiotinylation is very different among strains. Considering similar expressions of the protein among the strains as shown in Fig. 6-B, we note that all of the product is not biotinylated. Presumably the action of BH8 in the cell is insufficient, depending on the strain and becomes a limiting factor. Measurements of the enzyme activity of these fusion proteins are summarized in Table I. For pUClac-PT, the activity is 50-90% of that for pUClac. For pHSGAP and pHSGAP-PT, however, no distinct activity was detected for all the three strains. Since we used the truncated gene of phoA for the fusion to the biotin-tail, the loss of activity may be attributed to the deletion of the carboxyl terminal region. 18 )
Discussion P. shermanii transcarboxylase is a huge complex composed of 30 protein subunits of three types (1.38, 58, and 128).10) It catalyzes transfer of a carboxyl group from
1025
methylmalonyl-CoA to pyruvate, forming propionyl-CoA and oxalacetate. The sequence of biotin subunit 1.3S provides three functions: an acceptor of biotin as the substrate of BH8, a subunit as a component of the enzyme complex, and a holoenzyme as the active center. BHS of E. coli is a 321-amino-acid protein which is encoded on birA. It also acts as the biotin operon repressor, i.e., it is bifunctional. 19 - 21) The biotinylation with BHS involves formation of an amide bond between the c-amino group of Lys-89 and the carboxyl group of biotinyl 5'-adenylate. What interests us the most is why the biotinylation is specified at Lys-89 among many Lys residues. Our primary interest lies in this specificity. We suppose that the biotinylation proceeds as follows. Enzyme BH8 first activates biotin with ATP and forms a complex with biotinyl 5'-adenylate. A complex of BH8 with biotinyl 5'-adenylate provides binding domains for 1.38 in such a way that only the c-amino group of Lys-89 can react with biotinyl 5'-adenylate. Since the carboxyl terminal region is indispensable, one binding domain of 1.3S to BHS must be a hydrophobic sequence. The high conservation of the distance between the biotinyl site and the carboxyl germinal is related to the location of biotinyl 5'-adenylate on the BH8 molecule. We therefore, kept the carboxyl terminal region in the intact form. We studied here biotinylation of fusion proteins with the sequences [84-123J and [18-123J of 1.3S. We failed to biotinylate the former sequence. The failure may be attributed either to: a) lack of some necessary sequence upstream from the conserved tetrapeptide, or b) steric hindrance by the fusion partner. Since the products of pDR-BT and pUC-BT were not accumulated in the cell, these results cannot distinguish between them. However, we suppose that the former reason is more likely. There are still fairly good conservation sequences with hydrophobicity upstream from the biotinyl site. 2) In fact, we could not detect any trace of biotinylation in the fluorographic films even of three-month exposures, although we detected a little expression of pUC-BT by the fj-galactosidase assay. On the other hand, biotinylation occurred with the sequence [18-123J in the fusion protein to alkaline phosphatase. The sequence [18-123J was sufficient for biotinylation. This is consistent with the result of Murtif and Samols, who observed biotinylation in the sequence [19-123J alone. l l ) For fusion proteins, however, the biotinylation could easily be interfered with by the fusion partner as in the fusion to fj-galactosidase. This contrasts with the cross-specificity of the BHS. The biotin-tail has to maintain the activity of enzyme as well as the ability to be biotinylated. For this end, it may be useful to insert a hydrophilic linker peptide between the enzyme and the biotin-tail so that both can keep independence from each other. Biotinylation by genetic engineering is important not only for analytical applications but also for basic studies of biosynthesis of holoenzymes. Acknowledgment. We are very grateful to Keiko Kanemasa for her full support in our experiments.
References 1)
M. Wilchek and E. A. Bayer, in "Methods in Enzymology," Vol.
NII-Electronic Library Service
1026
2) 3) 4) 5) 6) 7) 8) 9)
184, ed. by M. Wilchek and E. A. Bayer, Academic Press, New York, 1990, pp. 5-13. D. Samols, C. G. Thornton, V. L. Murtif, G. K. Kumar, F. C. Haase, and H. G. Wood, J. BioI. Chern., 263, 646l~6464 (1988). D. P. Kosow, S. C. Huang, and M. D. Lane, J. BioI. Chern., 237, 3633-3639 (1962). M. D. Lane, D. L. Young, and F. Lynen, J. BioI. Chern., 239, 2858-2864 (1964). H. C. McAllister and M. J. Coon, J. BioI. Chern., 241, 2855-2861 (1966). M. E. Saunders, W. G. Sherwood, M. Duthie, L. Surh, and R. A. Gravel, Arn. J. Hurn. Genet., 34, 590-601 (1982). H. G. Wood and G. K. Kumar, Ann. N. Y. A cad. Sci., 447, 1-22 (1985). V. L. Murtif, C. R. Bahler, and D. Samols, Proc. Natl. A cad. Sci. U.S.A., 82, 5617-5621 (1985). H. G. Wood, B. C. Shenoy, G. K. Kumar, S. Parajape, V. Murtif, and D. Samols, Fed. Proc., 46, 2124 (abstr.) (1987). G. K. Kumar, H. Beegan, and H. G. Wood, Biochern., 27,5972-5978 (1988).
11)
V. L. Murtif and D. Samols, J. BioI. Chern., 262, 11813-11816 (1987). 12) K. Yoda, Y. Kikuchi, M. Yamasaki, and G. Tamura, Agric. BioI. Chern., 44, 1213-1214 (1980). 13) K. Kreuzer, C. Pratt, and A. Torriani, Genetics, 81, 459-465 (1975). 14) T. J. Silhavy, M. L. Berman, and L. W. Enquist, in "Experiments with Gene Fusions," Cold Spring Harbor Laboratory Press, New York, 1984, pp. 208-212. 15) J. Kyte and H. Rodriguez, Anal. Biochern., 133, 515-522 (1983). 16) J. H. Miller, in "Experiments in Molecular Genetics," Cold Spring Harbor Laboratory Press, New York, 1972. pp. 352-355. 17) C. N. Chang, W-J. Kuang, and E. Y. Chen, Gene, 44, 121-128 (1986). 18) Yoda et al., unpublished result. 19) D. F. Barker and A. M. Campbell, J. Mol. Bioi., 146, 469-492 (1981). 20) M. R. Buoncristiani, P. K. Howard, and A. J. Otsuka, Gene, 44, 255-261 (1986). 21) R. G. Brennan, S. Vasu, B. W. Matthews, and A. J. Otsuka, J. Bioi. Chern., 264, 5 (1989).
Downloaded by [91.213.8.236] at 09:36 06 June 2016
10)
N. Y AMANO et al.
NII-Electronic Library Service
ISSN: 0916-8451 (Print) 1347-6947 (Online) Journal homepage: http://www.tandfonline.com/loi/tbbb20
In Vivo Biotinylation of Fusion Proteins Expressed in Escherichia coli with a Sequence of Propionibacterium freudenreichii Transcarboxylase 1.3S Biotin Subunit Naoko Yamano, Yoshikazu Kawata, Hiroyuki Kojima, Koji Yoda & Makari Yamasaki To cite this article: Naoko Yamano, Yoshikazu Kawata, Hiroyuki Kojima, Koji Yoda & Makari Yamasaki (1992) In Vivo Biotinylation of Fusion Proteins Expressed in Escherichia coli with a Sequence of Propionibacterium freudenreichii Transcarboxylase 1.3S Biotin Subunit, Bioscience, Biotechnology, and Biochemistry, 56:7, 1017-1026, DOI: 10.1271/bbb.56.1017 To link to this article: http://dx.doi.org/10.1271/bbb.56.1017
Published online: 12 Jun 2014.
Submit your article to this journal
Article views: 24
View related articles
Citing articles: 8 View citing articles
Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20 Download by: [91.213.8.236]
Date: 06 June 2016, At: 09:36
Biosci. Biotech. Biochem., 56 (7), 1017-1026, 1992
In Vivo Biotinylation of Fusion Proteins Expressed in Escherichia coli with a Sequence of Propionibacterium freudenreichii Transcarboxylase 1.3S Biotin Subunit Naoko YAMANO, Yoshikazu KAWATA, Hiroyuki KOJIMA,t Koji YODA,* and Makari YAMASAKI* Government Industrial Research Institute, Osaka, Midorigaoka 1-8-31, Ikeda, Osaka 563, Japan The University of Tokyo, Bunkyo-ku, Tokyo 113, Japan Received October 11, 1991
* Department of Agricultural Chemistry,
Downloaded by [91.213.8.236] at 09:36 06 June 2016
Biotinylation of fusion proteins in E. coli was studied using a sequence of Propionibacterium freudenreichii transcarboxylase 1.3S biotin subunit. As the biotinylation sequence, we examined two sequences: one was of amino acid residues [84-123] of 1.3S, a partial sequence containing a region from a conserved tetrapeptide (Ala-Met-Bct-Met) around the biotinyllysine (Bet) to the carboxyl terminal; the other was of an almost entire sequence [18-123]. We constructed recombinant plasmids for fusion proteins of p-galactosidase, of chloramphenicol acetyltransferase, and of alkaline phosphatase. We found the biotinylation in the [18-123] sequence fused to alkaline phosphatase.
Biotin is known to bind specifically to avidin with the association constant of over 10 15 M- 1. This avidin-biotin binding has been used in many analytical techniques: 1) affinity chromatography, protein blotting, immunoassays, and gene probes. In these techniques, biotinylated agents have so far been prepared only chemically. However, in living systems from bacteria to mammalian, there are a variety of biotinylated enzymes, called biotin enzymes. For the biosynthesis of biotin enzymes, the biotinylation occurs at the Lys residue of apoenzymes, being catalyzed by biotin holoenzyme synthetase (BHS). Interestingly, BHS acts across species barriers, i.e., BHS from one organism biotinylates the apoenzyme from another. 2) Recent developments of analyses of biotin enzymes have shown that almost all the enzymes conserve a tetrapeptide sequence Ala-Met-Bct-Met (Bct: biotinyllysine) around the biotinyl site and the location of Bct at the 35th residue from the carboxyl terminal. 2) These facts suggest that the biotinylation may be possible only if we provide a specific sequence for a peptide of interest. We were interested in production of a biotinylated hybrid protein in Escherichia coli using a sequence of biotin enzymes. We selected a biotin subunit of Propionibacterium shermanii transcarbonylase, since it had been the most studied. 2 -11) The biotin subunit, called 1.3S, consists of 123 amino acids. Its gene was cloned, sequenced, and expressed in E. coli by Murtif et al. S ) Wood et al. 7 ) and Murtif et al. 11 ) studied functional relations of some conserved sequences in 1.3S. The relations are not fully understood. At least it can be said for the biotinylation that the conserved tetrapeptide only is insufficient and that a hydrophobic nature of the carboxyl terminal region is indispensable. In this report we studied two types of biotinylation sequences (called a biotin-tail hereafter) for fusion to the carboxyl end of a target protein. One sequence was of the amino acid residues [84--l23J of 1.3S, a partial sequence containing the region from the conserved tetrapeptide to the carboxyl terminal. Its gene was synthesized and t
connected to the 3'-end of the rt-complementing part of the fJ-galactosidase gene (lacZ') and of the chloramphenicol acetyltransferase gene (cat). The other was of the [18-l23J of 1.3S, an almost entire sequence of the biotin subunit, which was cloned here from P. freudenreichii IFO 12426. It was connected to the 3'-end of the fJ-galactosidase gene (lacZ) and of the alkaline phosphatase gene (phoA) of E. coli. Both genes were truncated with a deletion of their carboxyl terminal region. Expressions of those fused proteins in E. coli were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and the biotinylations were analysed by fluorography using cells grown in a medium containing 14C-Iabeled biotin. We found that the sequence [18-l23J caused biotinylation in the fusion protein with alkaline phosphatase.
Materials and Methods Bacterial strains and plasmids. Bacterial strains used as recipients for recombinant plasmids were derivatives of E. coli K-12; HB101 (supE44, hsdS20(r B-, mB -), recA13, ara-14, proA2, lac YI, galK2, rpsL20, xyl-5, mtl-I, mcrA +, mcrB-), JM109 (recAI, supE44, endAI, hadR17, gyrA96, relAI, thi, J(lac-proAB)jF'[traD36, proAB+, lacI q , lacZi1MI5] , mcrA -, mcrB+) and MC1061 (hsdR, ara139i1(araABC-leu) 7679, i1lacX74, galU, galK, rpsL, thi, mcrA -, mcrB-). P.freudenreichii IFO 12426 was obtained from Culture Collection of the Institute for Fermentation, Osaka. Plasmids pBR322, pUC18, pUC19, pHSG397, pHSG399 (Takara Shuzo), pDR540, and pKK223-3 (Pharmacia) were used for cloning and construction of the hybrid plasmids. The genes of chloramphenicol acetyltransferase, ,B-galactosidase, and alkaline phosphatase were prepared from pHSG399, Agt11 (Promega), and pKI_2,12) respectively. Media and culture conditions. The E. coli strains were usually grown aerobically in L-broth at 37°C. Antibiotics were used at concentrations of 50,ugjml for ampicillin, l70,ugjml for chloramphenicol, and 50,ugjml for tetracycline. P. freudenreichii IFO 12426 was grown in PYG medium (5 g of peptone, 5 g of yeast extract, 109 of glucose, 0.5 g of Tween 80 per liter) at 30°C. For minimum media, we used DM medium (10.5 g of K 2HP0 4, 4.5g ofKH 2P0 4, l.Og of (NH4hS04' 0.5g of Na'citrate' 2H 20, 0.2g of MgS0 4 ' 7H 20, 2gofg1ucose, 25 ,ugofthiamine' HCl per liter) and Medium 12Jl3) (12 g of Tris, 4.68 g of NaCl, 1.5 g of KCl, 1.08 g of NH 4C1, 0.35 g of Na 2S0 4, 0.20 g of MgCl2> 29 mg of CaC1 2, 0.5 mg of FeC1 3, 0.27 mg ofZnC1 2, 2g of glucose, 25,ug of thiamine' HC1, and 8.3 x 1O- 4 M K 2HP0 4 (for normal conditions) or 8.3 x 10- 5 M K 2HP0 4 (for phosphate limited conditions) per liter, pH 7.5).
To whom correspondence should be addressed.
NII-Electronic Library Service
NII-Electronic Library Service
BamBI
Biotin-tail (BI) lac
lacZ'
BamBI
Biotin-tail (BI)
BamBI digestion
BamHI
90
Construction of Plasmids pDR-BT and pUC-BT.
*
100
110
120
A gene for the biotinylation sequence BT was prepared from synthesized oligonucleotides. The nucleotide and amino acid sequences of BT are illustrated below in the figure. The conserved tetrapeptide and biotinylated Lys (Bet) are indicated with a box and *, respectively. Abbreviations: lac, lac promoter; tac, tac promoter.
Fig. 1.
XhoI
tac
Xhol
BamBI digestion
Biotin-tail fragment
BamBI lacZ'
GATCCAATG GTTCTCGAGIGCCATGAAGATG GAGACCGAGATCAACGCTCCCACCGACGGCAAGGTCGAGAAGGTCCTTGTCAAGGAGCGTGACGCCGTGCAGGGCGGTCAGGGTCTCATCAAGATCGGCTGA TAG GTTAC CAAGAGCTC CGGTACTTCTAC CTCTGGCTCTAGTTGCGAGGGTGGCTGCCGTTCCAGCTCTTCCAGGAACAGTTCCTCGCACTGCGGCACGTCCCGCCAGTCCCAGAGTAGTTCTAGCCGACT ATCCTAG DPM VLE AMKM ETEINAPTDGKVEKVLVKERDAVQGGQGLIKIG-
BamHI
BamBI
Downloaded by [91.213.8.236] at 09:36 06 June 2016
~
~
a
a:: >-
--
~
00
§
In Vivo Biotinylation of Fusion Proteins Expressed in E. coli Synthesis of oligonucleotides. Oligonucleotides were synthesized by the phosphoramidide method using a DNA synthesizer (Nippon Zeon, ZEON GENET A-III) based on the DNA sequence of the P. shermanii W52 transcarboxylase biotin subunit 1.3S. The oligonucleotides were purified by electrophoresis. Molecular cloning of the transcarboxylase biotin subunit l.3S gene. The biotin subunit 1.3S was cloned from P. freudenreichii IFO 12426 as described by Murtif et al. S ) Chromosomal DNA was digested with PstI completely and inserted into the PstI site of pBR322. E. coli HBlOl was transformed with these hybrid plasmids. Selection of positive colonies was done by dot blot hybridization. Probes were prepared from a hybrid
1019
plasmid containing the oligonucleotides synthesized above and labeled with a digoxigenin labeling system (Boehringer Mannheim). Protein detection and enzyme assay. Proteins produced with the recombinant plasmids were analyzed by SDS-PAGE. 14 ) For analysis of low molecular weight proteins, a modified SDS-PAGE using urea by Kyte et al. (SUDS-PAGE)15) was used. Gels were stained with Coomassie brilliant blue. p-Galactosidase activity was assayed with o-nitrophenyl-pD-galactoside (ONPG) by the method of Miller. 16l For induction of the lac promoter, cells were grown with isopropyl-l-thio-p-D-galactoside (IPTG, 1mM). Alkaline phosphatase activity was measured with p-nitrophenyl phosphate (NPP) as described by Kreuzer et al. 13 ) using
BamBI
Sau3AI
Downloaded by [91.213.8.236] at 09:36 06 June 2016
BamBI digestion
Sau3AI digestion
Sau3AI tae
Seal BamBI
Biotin-tail fragment
Seal partial digestion
BamBI digestion
BamB I linker BamBI digestion
Sau3AI tae
hoi Biotin-tai I (BT) Seal Fig. 2.
Construction of pDRCm-BT for Fusion to Chloramphenicol Acetyltransferase.
The BamHI linker was introduced between cat and BT to connect BT with the 3'-end of cat in frame.
NII-Electronic Library Service
NII-Electronic Library Service
~
U
~,
+
21.5 kDa-
30 kDa-
46 kDa-
!Xl I
E-4
+
-
!Xl I U
E-4
+
46 kDa-
~
E-4
---
P4
~
U
.-4
Q)
oJ
~
0.
Q
II
.' t
~
~
14.3 kDa-
21. 5 kDa-
30 kDa-
P.
~
~
10
~
0
0.
~
~
~
I
+
46
21. 5
-
PI
~
10 ~
"'l:l'
0
-
e:t
d
0 0
0 0
d
~
0 0
~ .j.J
M
.j.J
0 M
0
.-l
-
0
...-4
D
...-4
C
Analyses of the Total Proteins by Protein Staining (A, C) and of Biotinylation by Fluorography (B, D) for the Fusion Proteins with the Biotin-tail [84-123].
~
c.>
,-l
C1)
e:t o o
~ .j.J
o
...-4
-
13
-
~ ~
~
~
I
~
E-4
+
Strain JMI09 was used as the host for all the plasmids. The transformants were grown with (+) or without IPTG (-). SUDS-PAGE was used for the analyses of pUCI9, pDR-BT and pUC-BT (A, C), while SDS-PAGE was for pDR540 and pDRCm-BT (B, D). Electrophoresis for the fluorographic analysis was in a different run from that for the protein analysis, but the electrophoretic conditions were the same as that of corresponding SDS-PAGE.
Fig. 3.
3.4 kDa_
6.5 kDa-
14.3 kDa_
21. 5 kDa-
30 kDa-
.A.
Downloaded by [91.213.8.236] at 09:36 06 June 2016
f2-
~
o
z
:>
~
-< :>
z
0
N
;:;
1021
In Vivo Biotinylation of Fusion Proteins Expressed in E. coli cells grown in Medium 121 in both the normal and the phosphate-limited conditions.
and exposed to X-ray film (NewRX, Fuji) at - 70°C for 1 to 3 months.
Results Detection of biotinylated proteins. Biotinylated proteins were analyzed by fluorography. E. coli harboring the hybrid plasmids were grown in DM medium or Medium 121, containing 0.024,uCi/ml 14C-biotin (1.96 GBq/ mmol, Amersham). The total cell extract was fractioned by SDS-PAGE which was done under the same conditions as that for the protein detection. After treatment with a sensitizer (Amplify, Amersham), gels were dried
Biotinylation with the partial sequence [84-123J 0/ 1.38 biotin subunit We synthesized the oligonucleotides of which sequences are shown in Fig. 1. It contains a gene corresponding to the amino acid sequence [84-123J of 1.3S biotin subunit
PI EcoRI
Xbal
D---P'~ Agt 11
ReoRI, Xbal digestion ~eoRI
XbaI
Downloaded by [91.213.8.236] at 09:36 06 June 2016
5.2 Ib IaeZ fragment
SaIl digestion
SaIl
1.15 Ib PI fragment SaIl digestion
IaeZ EeoRI SaIl
ReoRI, Seal digestion
SaIl
Seal Hindlll lacZ
all hoI PI Seal
Fig. 4.
Construction of pUClac-PT for the Fusion to f3-Galactosidase.
The lacZ gene with deletion of the carboxyl terminal region was extracted from 19t11. A 1.15-kb Sall fragment, PT, containing the amino acid sequence [18-123J of the 1.3S biotin subunit was extracted from pBR-PT for the biotin-tail. Both were ligated with their EcoRI ends. Ap, ampicillin resistance gene.
NII-Electronic Library Service
N.
1022
YAMANO
of P. shermanii transcarboxylase and flanking sequences for introduction of BamHI end at both 5'- and 3'-ends. The sequence [84--123J just covers the region from the conserved tetrapeptide around Bct (marked with a box and * in Fig. 1) to the carboxyl terminal. 8) The translation initiation codon was also introduced in the 5'-flanking sequence. The synthesized DNA fragment was designated BT (l35bp). We constructed three plasmids using the BT fragment as a biotin-tail: the plasmid pDR-BT was directed to express
et ai.
the peptide only from BT, pUC-BT to express a fusion protein to part of the a-complementating region (amino acid residues [1-16J) of j3-galactosidase (LacZ'), and pDRCm-BT to express a fusion protein to chloramphenicol acetyltransferase (CAT). Details of the construction of these plasmids are illustrated in Figs. 1 and 2. In pDR-BT, the translation initiation codon in the 5' -flanking sequence of BT was arranged at a suitable position under the tac promoter. In pUC-BT, the BT fragment was inserted into lacZ' under the lac promoter in pUCI9. In pDRCm-BT Hindlll
Hindlll
Downloaded by [91.213.8.236] at 09:36 06 June 2016
Sphl
Hindlll, Sphl digestion
+
Hind I I I. Sph I digestion -1-.-6-I-b--h-o-A-f-r-a-g-m-e-n-t-1 P
Xhol
phoA
Pstl SaIl
PI all
Fig. 5.
Construction of pHSGAP-PT for Fusion to Alkaline Phosphatase.
The phoA gene was extracted from pKI-2 with deletion of the carboxyl terminal region. The biotin-tail gene PT was connected with the 3'-end of phoA at the Sall ends of pHSGAP. em, chloramphenicol resistance gene.
NII-Electronic Library Service
Downloaded by [91.213.8.236] at 09:36 06 June 2016
In Vivo Biotinylation of Fusion Proteins Expressed in E. coli
(Fig. 2), the cat gene was truncated with a deletion of 9 amino acids in the carboxyl terminal region, and connected with BT via a BamHi linker. The fusion protein consists of [1-2IOJ amino acid residues of CAT and a linker peptide, Ser-Asp-Pro-Met, and [84-123J of 1.3S biotin subunit. Figures 3-A and 3-C show the analysis of the total proteins expressed in E. coli. For the analysis of pDR-BT and pUC-BT SUDS-PAGE was used, because a much smaller size of the products was expected. In Fig. 3-A pUC-BT gives no band to be intensified by the addition of TPTG, at the position expected from its molecular weight, 6.4 kDa. The product of pDR-BT (4.4 kDa) was not detected either (data not shown). In fJ-galactosidase assay, however, a distinct increase of the activity was recognized for pUC-BT upon the addition of IPTG (data not shown). This may suggest that the pUC-BT expressed the fusion product at a very low level. Presumably both products are mostly lysed in the cells because of their incompleteness as a protein. On the other hand, the expression of pDRCm-BT is clearly recognized on the addition of IPTG at the position of its molecular weight (27 kDa) in Fig. 3-C. The fusion protein maintained the activity of CAT, since the transformant JMI09 harboring pDRCm-BT grew in LB medium containing 25,ugjml chloramphenicol.
Fig. 6.
1023
Figures 3-B and 3-D show analysis of the biotinylation by fluorography. The cells were grown in DM medium with 14C-labeled biotin. A strong band at the bottom in common to all the lanes corresponds to free biotin. If the products were biotinylated with BHS in E. coli, they should give an extra band. However, only a single band in common to that of the controls pUC19 and pDR540 appears, as shown in Figs. 3-B (for pDR-BT and pUC-BT) and 3-D (for pDRCm-BT). The position of the common band agrees with that of an endogenous biotin enzyme, acetyl-CoA carboxylase biotin carboxyl carrier protein (22.5 kDa). It should be noted that the films were exposed for three months. The sensitivity of fluorography of the three month exposure is comparative to that of a fJ-galactosidase assay. These results show that the fusion proteins of pUC-BT and pDRCm-BT are not biotinylated in E. coli. Biotinylation with the sequence [18-123} of 1.38 biotin subunit The biotin subunit gene of P. freudenreichii was cloned from strain TFO 12426 by following the procedure ofMurtif et al. who used the P. shermanii strain W52. 8 ) We obtained a positive clone for 1.3S gene on pBR322 (designated pBR-PT). It contained the PstT fragment of 1.7 kb and
Analysis of the Total Proteins by SDS-PAGE for the Fusion Proteins with the Biotin-tail [18-123].
(A) is for fusion proteins to {i-galactosidase and (B) is to alkaline phosphatase. In (A), the cells with pUClac and pUClac-PT were grown with IPTG. In (B), the cells were grown under the normal conditions ( - ) and under the phosphate-limited conditions ( + ).
NII-Electronic Library Service
N.
1024
showed consistent digestion patterns with those expected from the sequence of 1.3S when it was treated with several restriction endonucleases. The PstI fragment was inserted into pUC19 and pKK223-3 at their PstI sites under the lac promoter and the tac promoter, respectively. Both plasmids expressed a protein of which the molecular weight was identical to that of 1.3S biotin subunit. The biotinylation of the product was confirmed by fluorography. Consequently, this cloned DNA fragment certainly contains the complete gene of the 1.3S biotin subunit. To produce biotinylated fusion proteins, we selected j1-galactosidase and alkaline phosphatase of E. coli as a fusion partner. The latter is a well characterized periplasmic enzyme and its gene was cloned by Yoda et al. 12 ) Procedures for the plasmid constructions are illustrated in Figs. 4 and 5. A 1.15-kb fragment made by digestion of pBR-PT with Sail is used for the gene of the biotin-tail and designated PT. It contains the gene for the amino acid residues [18-123J of 1.3S and of a O.8-kb sequence downstream
from the carboxyl terminal. For the fusion to f3galactosidase, the lacZ gene was extracted from A gtll, with deletion of 16 amino acids from the 3'-end of lacZ, and connected with PT (pUClac-PT). Between lacZ and PT, codons for 9 extra amino acids were inserted as a linker. For fusion to alkaline phosphatase, its gene phoA was extracted from plasmid pKI-2. It contains the promoter and the signal sequences of phoA. 17 ) In pHSGAP-PT, 23 amino acids were deleted from the 3'-end of phoA. Between the phoA and PT codons for His-Arg-Trp were inserted as a linker. Expression of the fusion proteins was analyzed by SDS-PAGE (Figs. 6-A and 6-B). In Fig. 6-A, JMI09 harboring pUClac-PT is seen expressing an extra portein of which the molecular weight agrees with that expected (l24kDa). In Fig. 6-B, three strains of E. coli, HBI0l, JMI09, and MCI061, harboring pHSGAP-PT express the fusion protein with alkaline phosphatase. The size of the fusion protein is approximately 56 kDa, provided that the
13
.A.
Downloaded by [91.213.8.236] at 09:36 06 June 2016
et al.
YAMANO
e-.
~
p., I
~
CJ ttl
I CJ I'd
...-1
...-1
Co) ~
Co) ~
........
........ -t 0
c.
-t
0 ~
l:Q
=:
c.
..-I
l:Q
:=
CJ I'd
CJ I'd
...-1
...-1
Co) ~
::>
c. ........ Cl)
0 ..-I
i!;
Co)
E-4
p., I
l:I:l
c. ........
Cl)
-t
0 ..-I
~
~
I
~00 ~00
c.
........
e-.
0 ..-I
~
l:I:l
E-4
e-.
E-4
~00
I
I
I
l:I:l 04
c.
........
Cl)
co
........
0
~
0
..-I
..-I Co)
~
:E
::I::
~
~
~
~00 l:I:l
C.
........ ~
~
~00
Ci
........
Cl)
co
0
~
~
+
~00
l:I:l
l:I:l Po!
........
0
~
p., I
~
0
~
Co)
~
X
+
+
- 46 kDa
- 30 kDa
Fig. 7.
Analysis of the Biotinylation by Fluorography for the Fusion Proteins with the Biotin-tail [18-123].
(A) is for fusion proteins to f3-galactosidase and (B) is to alkaline phosphatase.
NII-Electronic Library Service
In Vivo Biotinylation of Fusion Proteins Expressed in E. coli
Table I. Activity of fJ-Galactosidase and Alkaline Phosphatase with Biotin-tail Strain fJ-Galactosidase HBlOl
JM109
Alkaline phosphatase HBlOl
JMl09
Downloaded by [91.213.8.236] at 09:36 06 June 2016
MC106l
Plasmid
None pUClac pUClac-PT None pUClac pUClac-PT None pHSGAP pHSGAP-PT None pHSGAP pHSGAP-PT None pHSGAP pHSGAP-PT pKI-2
Enzymatic activity (units)
7.9 85.1 77.4
4.7 105.3 55.8 0.016 0.015 ND 0.050 0.044 ND 0.057 0.012 0.006 1.85
ND, not detected. Activity of fJ-galactosidase was measured by colorimetry with ONPG. The cells were grown with IPTG. Activity of alkaline phosphatase was measured with p-nitrophenyl phosphate. The cells were grown in Medium 121 (phosphate-limited conditions).
signal sequence of alkaline phosphatase is processed. 12) The band is distinguished for the cells grown in the phsophate-limited Medium 121 (marked by + in Fig. 6-B). This indicates that the phoA promoter works in pHSGAP-PT. There is no distinct difference of the expression level among the three strains. The biotinylation is analyzed by fluorography in Fig. 7. The fusion protein to fj-galactosidase gives no extra band for either HBI0l or JMI09 harboring pUClac-PT. The thick band at the bottom is attributed to free biotin and the endogenous biotin enzyme. On the other hand, pH8GAP-PT gives an extra band in the phosphate-limited medium. This band is assigned to the fusion protein with alkaline phosphotase, because it is nearly at the position expected. Although the band appears only for HBI0l and MCI061 in the figure, a prolonged exposure of the film gave a weak band for JMI09, too. Thus, the level ofbiotinylation is very different among strains. Considering similar expressions of the protein among the strains as shown in Fig. 6-B, we note that all of the product is not biotinylated. Presumably the action of BH8 in the cell is insufficient, depending on the strain and becomes a limiting factor. Measurements of the enzyme activity of these fusion proteins are summarized in Table I. For pUClac-PT, the activity is 50-90% of that for pUClac. For pHSGAP and pHSGAP-PT, however, no distinct activity was detected for all the three strains. Since we used the truncated gene of phoA for the fusion to the biotin-tail, the loss of activity may be attributed to the deletion of the carboxyl terminal region. 18 )
Discussion P. shermanii transcarboxylase is a huge complex composed of 30 protein subunits of three types (1.38, 58, and 128).10) It catalyzes transfer of a carboxyl group from
1025
methylmalonyl-CoA to pyruvate, forming propionyl-CoA and oxalacetate. The sequence of biotin subunit 1.3S provides three functions: an acceptor of biotin as the substrate of BH8, a subunit as a component of the enzyme complex, and a holoenzyme as the active center. BHS of E. coli is a 321-amino-acid protein which is encoded on birA. It also acts as the biotin operon repressor, i.e., it is bifunctional. 19 - 21) The biotinylation with BHS involves formation of an amide bond between the c-amino group of Lys-89 and the carboxyl group of biotinyl 5'-adenylate. What interests us the most is why the biotinylation is specified at Lys-89 among many Lys residues. Our primary interest lies in this specificity. We suppose that the biotinylation proceeds as follows. Enzyme BH8 first activates biotin with ATP and forms a complex with biotinyl 5'-adenylate. A complex of BH8 with biotinyl 5'-adenylate provides binding domains for 1.38 in such a way that only the c-amino group of Lys-89 can react with biotinyl 5'-adenylate. Since the carboxyl terminal region is indispensable, one binding domain of 1.3S to BHS must be a hydrophobic sequence. The high conservation of the distance between the biotinyl site and the carboxyl germinal is related to the location of biotinyl 5'-adenylate on the BH8 molecule. We therefore, kept the carboxyl terminal region in the intact form. We studied here biotinylation of fusion proteins with the sequences [84-123J and [18-123J of 1.3S. We failed to biotinylate the former sequence. The failure may be attributed either to: a) lack of some necessary sequence upstream from the conserved tetrapeptide, or b) steric hindrance by the fusion partner. Since the products of pDR-BT and pUC-BT were not accumulated in the cell, these results cannot distinguish between them. However, we suppose that the former reason is more likely. There are still fairly good conservation sequences with hydrophobicity upstream from the biotinyl site. 2) In fact, we could not detect any trace of biotinylation in the fluorographic films even of three-month exposures, although we detected a little expression of pUC-BT by the fj-galactosidase assay. On the other hand, biotinylation occurred with the sequence [18-123J in the fusion protein to alkaline phosphatase. The sequence [18-123J was sufficient for biotinylation. This is consistent with the result of Murtif and Samols, who observed biotinylation in the sequence [19-123J alone. l l ) For fusion proteins, however, the biotinylation could easily be interfered with by the fusion partner as in the fusion to fj-galactosidase. This contrasts with the cross-specificity of the BHS. The biotin-tail has to maintain the activity of enzyme as well as the ability to be biotinylated. For this end, it may be useful to insert a hydrophilic linker peptide between the enzyme and the biotin-tail so that both can keep independence from each other. Biotinylation by genetic engineering is important not only for analytical applications but also for basic studies of biosynthesis of holoenzymes. Acknowledgment. We are very grateful to Keiko Kanemasa for her full support in our experiments.
References 1)
M. Wilchek and E. A. Bayer, in "Methods in Enzymology," Vol.
NII-Electronic Library Service
1026
2) 3) 4) 5) 6) 7) 8) 9)
184, ed. by M. Wilchek and E. A. Bayer, Academic Press, New York, 1990, pp. 5-13. D. Samols, C. G. Thornton, V. L. Murtif, G. K. Kumar, F. C. Haase, and H. G. Wood, J. BioI. Chern., 263, 646l~6464 (1988). D. P. Kosow, S. C. Huang, and M. D. Lane, J. BioI. Chern., 237, 3633-3639 (1962). M. D. Lane, D. L. Young, and F. Lynen, J. BioI. Chern., 239, 2858-2864 (1964). H. C. McAllister and M. J. Coon, J. BioI. Chern., 241, 2855-2861 (1966). M. E. Saunders, W. G. Sherwood, M. Duthie, L. Surh, and R. A. Gravel, Arn. J. Hurn. Genet., 34, 590-601 (1982). H. G. Wood and G. K. Kumar, Ann. N. Y. A cad. Sci., 447, 1-22 (1985). V. L. Murtif, C. R. Bahler, and D. Samols, Proc. Natl. A cad. Sci. U.S.A., 82, 5617-5621 (1985). H. G. Wood, B. C. Shenoy, G. K. Kumar, S. Parajape, V. Murtif, and D. Samols, Fed. Proc., 46, 2124 (abstr.) (1987). G. K. Kumar, H. Beegan, and H. G. Wood, Biochern., 27,5972-5978 (1988).
11)
V. L. Murtif and D. Samols, J. BioI. Chern., 262, 11813-11816 (1987). 12) K. Yoda, Y. Kikuchi, M. Yamasaki, and G. Tamura, Agric. BioI. Chern., 44, 1213-1214 (1980). 13) K. Kreuzer, C. Pratt, and A. Torriani, Genetics, 81, 459-465 (1975). 14) T. J. Silhavy, M. L. Berman, and L. W. Enquist, in "Experiments with Gene Fusions," Cold Spring Harbor Laboratory Press, New York, 1984, pp. 208-212. 15) J. Kyte and H. Rodriguez, Anal. Biochern., 133, 515-522 (1983). 16) J. H. Miller, in "Experiments in Molecular Genetics," Cold Spring Harbor Laboratory Press, New York, 1972. pp. 352-355. 17) C. N. Chang, W-J. Kuang, and E. Y. Chen, Gene, 44, 121-128 (1986). 18) Yoda et al., unpublished result. 19) D. F. Barker and A. M. Campbell, J. Mol. Bioi., 146, 469-492 (1981). 20) M. R. Buoncristiani, P. K. Howard, and A. J. Otsuka, Gene, 44, 255-261 (1986). 21) R. G. Brennan, S. Vasu, B. W. Matthews, and A. J. Otsuka, J. Bioi. Chern., 264, 5 (1989).
Downloaded by [91.213.8.236] at 09:36 06 June 2016
10)
N. Y AMANO et al.
NII-Electronic Library Service
