242
EGF
[23] In Vitro
RECEPTOR AND RELATED RECEPTORS
Transcription of Epidermal Receptor Gene
Growth
[23]
Factor
B y RYOICHIRO KAGEYAMA and GLENN T. MERLINO
Introduction The p r o m o t e r of the epidermal growth factor (EGF) j receptor gene has a high GC content and lacks a typical T A T A box and C A A T box. 2 Recently, transcriptional m e c h a n i s m s have been intensively analyzed3'4; h o w e v e r , our understanding of the factors involved in transcription from p r o m o t e r s without T A T A boxes is still rather limited because of the low efficiency of cell-free transcription from these promoters. We have developed an in v i t r o transcription system for the human E G F receptor gene using nuclear extracts from A431 h u m a n epidermoid c a r c i n o m a cells, which o v e r p r o d u c e E G F receptors. 5'6 We found that transcription factors S p l and E T F ( E G F r e c e p t o r transcription factor) are required for the expression of E G F receptor. 5-8 S p l is a well-characterized factor that binds to GC boxes ( G G G C G G ) and stimulates transcription from various p r o m o t e r s containing GC b o x e s such as the SV40 promoter. 9"~° E T F is a novel trans-acting factor which also binds to GC-rich regions, but it specifically stimulates E G F r e c e p t o r transcription and has little or no effect on transcription f r o m the SV40 early promoter. 6'jj In this chapter we describe m e t h o d s for the preparation and fractionation of A431 nuclear extracts, a technique for purification of E T F , and the in v i t r o transcription assay used in the analysis of the E G F receptor i AMV, Avian myeloblastosis virus; CAT, chloramphenicol acetyltransferase; DTT, dithiothreitol; EGF, epidermal growth factor; HEPES, N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid; PBS, phosphate-buffered saline; PCPV, packed cell pellet volumes; SDS, sodium dodecyl sulfate; ETF, EGF receptor transcription factor. 2 S. Ishii, Y.-h. Xu, R. H. Stratton, B. A. Roe, G. T. Merlino, and I. Pastan, Proe. Natl. Acad. Sci. U.S.A. 82, 4920 (1985). 3 p. F. Johnson and S. L. McKnight, Anna. Rev. Biochem. 58, 799 (1989). 4 p. j. Mitchell and R. Tjian, Science 245, 371 (1989). 5 R. Kageyama, G. T. Merlino, and 1. Pastan, J. Biol. Chem. 263, 6329 (1988). 6 R. Kageyama, G. T. Merlino, and 1. Pastan, Proe. Natl. Aead. Sei. U.S.A. 85, 5016 (1988). 7 A. C. Johnson, S. lshii, Y. Jinno, I. Pastan, and G. T. Merlino, J. Biol. Chem. 263, 5693 (1988). 8 A. C. Johnson, Y. Jinno, and G. T. Merlino, Mol. Cell. Biol. 8, 4174 (1988). 9 W. S. Dynan and R. Tjian, Nature (London) 316, 774 (1985). ~0j. T. Kadonaga, K. A. Jones, and R. Tjian, Trends Biochem. 11, 20 (1986). " R. Kageyama, G. T. Merlino, and 1. Pastan, J. Biol. Chem. 264, 15508 (1989).
METHODS IN ENZYMOLOGY. VOL. 198
Copyright c~9 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
[23]
EGF RECEPTORin Vitro TRANSCRIPTION
243
promoter. Nuclear extract preparation and fractionation are basically performed according to Wildeman et al. 12and Dynan and Tjian,13 respectively. Preparation of the sequence-specific affinity resin for ETF purification is according to Wu et al. 14
Preparation of A431 Nuclear Extract Materials
Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum Phosphate-buffered saline without calcium and magnesium (PBS) Buffer 1:10 mM HEPES, pH 7.9, 10 mM KCI, 1.5 mM MgCI2, and 0.5 mM dithiothreitol (DTT) Buffer 2:20 mM HEPES, pH 7.9,420 mM NaCI, 0.2 mM EDTA, 1.5 mM MgC1z, 25% (v/v) glycerol, and 0.5 mM DTT Buffer 3:20 mM HEPES, pH 7.9, 20 mM KCI, ! mM MgC12, 17% (v/v) glycerol, and 2 mM DTT Methods
A431 cells (3 x 107 plated per roller bottle, 900 cm 2) are grown in 100 ml of Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Typically, 20 roller bottles are prepared. On the third day the medium is changed, and on the fourth day the cells are harvested. After washing with PBS the cells are collected by a scraper with 15 mi of ice-cold PBS per roller bottle. From this point all procedures are done at 4°. The cell suspension is subjected to centrifugation at 4700 g for 5 min, and the cell pellets are suspended in the same volume of PBS. After centrifugation at 1800 g for 5 min, the volume of the cell pellet is measured. We usually obtain 30 ml of packed cells from 20 roller bottles. The cells are resuspended in 5 packed cell pellet volumes (PCPV) of buffer 1 and placed on ice for 10 min. After centrifugation at 7300 g for 10 min, the cells are resuspended in 2 PCPV of buffer 1 and lysed by homogenization in a Dounce homogenizer (-20 strokes). Cell lysis should be checked by light microscopy; lysis should be greater than 90%. After centrifugation at 1200 g for 20 min, the homogenate separates into two ~2A. G. Wildeman,P. Sassone-Corsi,T. Grundstroem,M. Zenke,and P. Chambon,EMBO J. 3, 3129 (1984). 13W. S. Dynanand R. Tjian, Cell (Cambridge, Mass.) 32, 669 (1983). 14C. Wu, S. Wilson, B. Walker, 1. Dawid, T. Paisley,V. Zimarino,and H. Ueda, Science 238, 1247(1987).
244
E G F RECEPTOR AND RELATED RECEPTORS
[23]
phases. The top phase contains cytoplasmic proteins, and the bottom phase is a crude nuclear pellet. The pellet is suspended in 2 PCPV of buffer 2 by 10 strokes in a Dounce homogenizer. The homogenate is stirred gently on ice for 30 rain, then subjected to centrifugation at 12,000 g for 20 min. The supernatant is collected, and 0.33 g of (NH4)2SO4 per 1 ml of the supernatant is slowly added with gentle stirring. After this addition, the solution is stirred for an additional 20 min and then centrifuged at 12,000 g for 25 min. The pellet is suspended in buffer 3 at 1/12 the volume of the 12,000 g supernatant, and the resulting suspension is dialyzed against two changes of 100 volumes each of buffer 3 for a total of 5-8 hr. The dialyzate is centrifuged at I0,000 g for 10 min to remove insoluble material. The supernatant is divided into small aliquots, quickly frozen in dry ice, and stored at - 8 0 °. We usually obtain 100-150 mg of crude nuclear extract from 30 g of A431 cells.
Fractionation of A431 Nuclear Extract Materials
Heparin-agarose (Bethesda Research Laboratories, Gaithersburg, MD) DEAE-Sepharose CL-6B (Pharmacia, Piscataway, N J) HM buffer: 20 mM HEPES, pH 7.9, 1 mM MgCI 2, 2 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, and 17% (v/v) glycerol Note: 0.1 M KCI/HM indicates 0.1 M KCI solution in HM buffer. Methods
Fractionation is performed according to the scheme shown in Fig. 1A. First, 250 mg of nuclear extract is applied to a heparin-agarose column (30-ml bed volume, 2.5 x 6 cm) equilibrated in 0.1 M KCI/HM, and 1.5ml fractions are collected. The column is washed with 3 bed volumes of 0.1 M KCI/HM (fraction A). In general, fraction A is not required for EGF receptor gene transcription. However, it may be necessary for optimal transcription of other promoters and should be tested in each case. The column is then eluted with 0.4 M KCI/HM (fraction B). The peak fractions are collected and dialyzed against 100 volumes of 0.1 M KCI/HM for 3 hr. Long dialysis should be avoided because the transcriptional activity is very labile. The 0.4 M KCI B fraction (75 mg) is next applied to a DEAE-Sepharose CL-6B column (30-ml bed volume, 2.5 x 6 cm) equilibrated in 0.12 M KCI/HM. The column is step-eluted with 2.5 bed volumes of 0.12 M KCI/
[23]
EGF RECEPTORin Vitro TRANSCRIPTION
245
A A431 Nuclear Extract
Heparin-Agarose
I
0.4M
IO.1M A
B
I DEAE-Sepharose 0.25M I O.5M
I 0.12M
BB general factors
BA
03
)
( pol II )
Oligo Affinity x2 0.5M
ETF
B 5'
I
I
3,
CCCGCGCGAGCTAGACGTCCGGGCAGCCCCCGGCGCAGCGCGGCCG GATCTGCAGGCCCGTCGGGGGCCGCGTCGCGCCGGC 3,
I
I
5,
FIO. 1. (A) Fractionation of A43 i nuclear extract. DEAE-Sepharose fraction BA contains ETF, which is further purified by sequence-specific oligonucleotide affinity chromatography. DEAE-Sepharose fractions BB and BC contain general transcription factors and RNA polymerase lI, respectively. (B) Sequences of the two oligonucleotides used for the affinity resin. The ETF-binding region is indicated by brackets.
HM (fraction BA), 0.25 M KCI/HM (fraction BB), and then 0.5 M KCI/ HM (fraction BC). The peak protein-containing fractions from each step are individually pooled, adjusted to 0.33 mg/mi (NH4)2SO4 and stirred gently at 4° for 1 hr. After centrifugation at 10,000 g for 15 min, each pellet is dissolved in 500/~1 of 0.12 M KCI/HM. The three fractions are individually dialyzed against 100 volumes of 0.12 M KCI/HM for 3 hr. The final yields of the fractions BA, BB, and BC are usually approximately 6, 15, and 5 mg, respectively. Fraction BB contains most general transcription factors, and fraction BC has RNA polymerase I1. Transcription factor
246
E G F RECEPTOR AND RELATED RECEPTORS
[23]
ETF is present in fraction BA. For purification of ETF we subject pooled 0.12 M KCI fractions directly to sequence-specific oligonucleotide affinity chromatography without concentration by (NH4)2SO4 precipitation. Purification of Epidermal Growth Factor Receptor Transcription Factor Materials. Two complementary oligonucleotides, a 46-mer and a 36mer, and CNBr-activated Sepharose 4B (Pharmacia) are required to prepare the affinity column. The two oligonucleotides 5'-CCCGCGCGAGCTAGACGTCCGGGCAGCCCCCGGCGCAGCGCGGCCG-3'
and 5'-CGGCCGCGCTGCGCCGGGGGCTGCCCGGACGTCTAG-Y
are made using an Applied Biosystems (Foster City, CA) DNA synthesizer (Model 380A). Methods
The sequence-specific oligonucleotide affinity resin is prepared as follows. We make two complementary oligonucleotides (46-mer and 36-mer) in order that the annealed oligonucleotides consist of a 36-base pair (bp) double-stranded portion and a 10-nucleotide single-stranded portion (Fig. 1B). The single-stranded part is necessary for the coupling reaction to CNBr-activated Sepharose. We use the oligonucleotides without purification. For annealing, 700/zg of the 46-mer and 540/xg of the 36-mer are mixed in a final volume of 400/zl of solution containing 10 mM potassium phosphate, pH 8.2, and 100 mM NaCl. This mixture is heated at 85 ° for 2 min and then gradually cooled to room temperature over several hours. The hybridized oligonucleotides can be stored at 4 °. The annealing efficiency should be checked by an 8% polyacrylamide nondenaturing gel. Only a double-stranded band should be seen after staining with 1 /zg/ml ethidium bromide. This hybridized DNA fragment is used for the coupling reaction without further purification. The coupling reaction is carried out in a 4° cold room. CNBr-activated Sepharose 4B (1.2 g) is suspended in 40 ml of I mM HCI and poured into a 15-ml sintered glass funnel under slight vacuum. The Sepharose is washed sequentially with 150 ml of 1 mM HCI and 3 times with 15 ml of 10 mM potassium phosphate, pH 8.2, after which the vacuum is released. The Sepharose solution is resuspended in 2.5 ml of 10 mM potassium phosphate and transferred to a 15-ml polypropylene tube. The funnel is washed with an additional 2.5 ml of 10 mM potassium phosphate, and this solution is
[23]
EGF RECEPTORin Vitro TRANSCRIPTION
247
also transferred to the same tube. The hybridized olgionucleotide mixture (400 p,l) is then added to the Sepharose solution, and the tube is rotated at room temperature for 18 hr. The coupling reaction is stopped by addition of Tris-HCl, pH 8.0, to a final concentration of 100 mM. This mixture is incubated at 4° for 24 hr and then transferred to a 15-ml sintered glass funnel at room temperature. The Sepharose is washed with 10 mi of 100 mM Tris-HCl, pH 8.0; 30 ml of 100 mM potassium phosphate, pH 8.2; 30 ml of a solution of 1.5 M NaCI and 10 mM Tris-HCl, pH 8.0; and 30 ml of a solution of 100 mM NaCl, 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA in this order under slight vacuum. The vacuum is released, and the Sepharose is suspended in 5 ml of the latter buffer and stored at 4°. The efficiency of the coupling reaction can be checked by using 32p-labeled oligonucleotides. More than 20% of the oligonucleotides should be coupled. To purify the transcription factor ETF, fraction B A (10 ml, - 1 . 5 mg/ ml) is applied to the sequence-specific oligonucleotide affinity column (1-ml bed volume in Econo-column, Bio-Rad, Richmond, CA) equilibrated in 0.12 M KC1/HM. The column is washed with 5 ml of 0.25 M KCI/HM and then eluted with 2 ml of 0.5 KCI/HM. The eluate ( - 2 ml) is diluted to 0.1 M KC1 with HM buffer, and reapplied to a second affinity column (lml bed volume in Econo-column) equilibrated in 0.12 M KC1/HM. The column is washed with 5 ml of 0.25 M KCI/HM and eluted with 2 ml of 0.5 M KCI/HM. For the elution, 0.5-ml fractions are collected and analyzed by sodium dodecyl sulfate (SDS)/10% polyacrylamide gel electrophoresis. The peak fraction which contains the majority of the 120-kDa protein is used for the DNase 1 footprinting, gel mobility shift, and in vitro transcription assays. In Vitro Transcription Assay Materials. Supercoiled DNA templates containing the chloramphenicol acetyltransferase (CAT) gene, and a CAT-specific primer, 5'-TGCCATTGGGATATATCAACGGTG-Y
that is complementary to the region between nucleotides 4920 and 4943 of pSV2 cat were prepared.15 Sephadex G-50, DNA grade (Pharmacia), T4 polynucleotide kinase (Bethesda Research Laboratories), avian myeloblastosis virus (AMV) reverse transcriptase (Life Sciences, Pharmacia, or Boehringer Mannheim, Indianapolis, IN), RNase-free DNase I (Bethesda Research Laboratories), and [y-32p]ATP, 5000 Ci/mmol (Amersham, Art5 C. Gorman,
in " D N A Cloning, Volume 11, A Practical Approach" (D. M. GIover, ed.), p. 143. IRL, Oxford and Washington, D.C., 1985.
248
E G F RECEPTOR AND RELATED RECEPTORS
I
pGEM4
1
I
I
Receptor Promoter
EGF
~
[23]
v
.,~M_~_
"--~,~
3'
CAT
GTGGCAACTATATAGGGTFACCGT 5'
FIG. 2. Structure of the supercoiled DNA template. The EGF receptor promoter region and the truncated CAT gene (between nucleotides 4751 and 5001 of pSV2 cat 15) are cloned into pGEM-4 (Promega, Madison, WI). The start site ( - 48) and direction of transcription are indicated by the upper arrow. The asterisk shows the 5'-end-labeled site of the CATspecific primer (thick line), and the lower arrow indicates the primer-extended product. The sequence of the primer is also shown.
lington Heights, IL), were obtained from the indicated sources. Glycine buffer contains 170 mM glycine, 170 mM NaCI, and 32 mM NaOH. Methods
There are several methods available to study in vitro transcription: runoff, 16,17 S 1 nuclease mapping, J6 and primer extension assays. The clearest
results are usually obtained using a primer extension assay. The templates we use are supercoiled plasmids containing the EGF receptor promoter and the CAT reporter gene (Fig. 2). In general, the use of a truncated CAT gene can substantially reduce the background. However, when using the highest quality extracts and fractions we get virtually the same signal from plasmids containing the whole CAT gene. A 5'-end-labeled CAT-specific primer is used to detect transcripts initiating within the EGF receptor promoter. The distance between the labeled site of the primer and the 5' end of the CAT gene is 80 nucleotides. Therefore, the primer-extended product corresponding to the initiation site in the promoter should be greater than 80 nucleotides. The primer is 5'-end-labeled as follows. First, the primer (5/xl, 70 ng) is heated at 90 ° for 30 sec and transferred to ice. Then, 1.75/xl of 100 mM MgCI z, 1.75 /xl of 100 mM DTT, 4.4 /xl of glycine buffer, 10 /zl of [y-3Zp]ATP, and 1 ~1 of T4 polynucleotide kinase (10 units/~l) are added, and the mixture is incubated at 37° for 30 min. This solution is applied 16j. L. Manley, A. Fire, M. Samuels, and P. A. Sharp, this series, Vol. 101, p. 568. 17j. D. Dignam, P. L. Martin, B. S. Shastry, and R. G. Roeder, this series, Vol. 101, p. 582.
[23]
EGF RECEPTORin Vitro TRANSCRIPTION
249
to a Sephadex G-50 column (l.8-ml bed volume in an Econo-column) equilibrated in TE buffer (10 mM Tris-HCl, pH 7.5, and 1 mM EDTA) to separate the labeled primer from the free [y-SzP]ATP. Fractions (3 drops, 100 tzl) are collected and counted. The two or three peak fractions are pooled and directly used for the primer extension assay. In vitro transcription reactions are carried out as follows. When using a crude nuclear extract, 1.25/xl of a mixture of 10 mM each of ATP, GTP, CTP, and UTP (10 mM 4NTP), 1.2/xl of 40 mM spermidine, 1.5/zl of 16 mM MgCI2, 2.3 tzl of 500 mM KCI, and 1/zg of a DNA template are mixed with an appropriate amount of water to make the volume 17.5 txl. The crude nuclear extract (7.5 /xl, - 1 2 mg/ml) is then added to start the reaction. When using the heparin-agarose fraction B, 2.5 /xl of 10 mM 4NTP, 2.4/zl of 40 mM spermidine, 3/zl of 16 mM MgCI2, and 1 /xg of a DNA template are mixed with an appropriate amount of water to make the volumn 38/zl. Fraction B (12/xl, - 6 mg/ml) is then added to start the reaction. When reconstituting DEAE-Sepharose fractions, the same amounts of reagents and DNA are used as for the heparin-agarose fraction, but they are mixed with an appropriate amount of water to make the volume 31 /A. Then 7/xl of fraction BA, 7/zl of fraction BB, and 5/xl of fraction BC are added. When using purified ETF, 2 /zl of the affinity column eluate and 5 txl of HM buffer are added instead of fraction BA. After incubation at 30° for I hr, the reaction is stopped by the addition of 400/xl of a solution of 0.3 M sodium acetate, 0.4% SDS, and 1 mM EDTA and extracted with phenol/chloroform and then with chloroform. After the addition of 1 ml of ethanol, the mixture is incubated in a dry ice/ ethanol bath for 5 min and centrifuged for 10 min. After washing with ethanol and drying, the pellet is dissolved in 200/zl of 2 M LiCI. Ethanol (400/xl) is added, and the solution is incubated on ice for 30 min. After centrifugation for 10 min and washing with ethanol, the pellet is suspended in 100/xl of a solution of 10 mM Tris-HCl, pH 7.5, 100 mM NaCI, and 10 mM MgC12 and treated with 13/xg of RNase-free DNase I at 37° for l0 rain. The reaction is stopped by the addition of a solution of 100 pA of 10 mM EDTA, 0.2% SDS (w/v), and 150 mM NaCl, and the resulting mixture is extracted with phenol/chloroform. The 32p-end-labeled primer (5-10 pA, 0.1-0.2 pmol) and 500/xl of ethanol are added to the cell-free RNA. After incubation in a dry ice/ethanol bath for 5 min, the mixture is subjected to centrifugation for 10 min. At least 50% of the radioactivity should be in the pellet. After washing with ethanol, the pellet is dissolved in 10/xl of a solution of 40% (v/v) formamide, 0.4 M NaCI, 40 mM piperazine-N,N'-bis(2-ethanesulfonic acid), pH 6.4, and ! mM EDTA and then heated at 75° for 5 min. After incubation at 42° for 2 hr, 80/xl of water, 10/zl of 3 M sodium acetate, and 250/zl of
250
E G F RECEPTOR AND RELATED RECEPTORS
[23]
ethanol are added, and the mixture is placed in a dry ice/ethanol bath for 5 min. Nucleic acids are recovered by centrifugation in a microcentrifuge for 10 min. After ethanol washing, the pellet is dissolved in 49/zl of a solution of 50 mM Tris-HCl, pH 8.3, 8 mM MgCI2, 30 mM KCI, 3 mM DTT, 1 mM each of dATP, dGTP, dCTP, and dTTP, and 1.6 tzg/ml of actinomycin D. AMV reverse transcriptase (1 ~1, 10-20 units) is added to start the reaction. After incubation at 37° for 1 hr, the reaction is stopped by sequentially adding 6/~1 of 0.25 M EDTA and 6 tzl of 2 N NaOH, then heating at 37° for 20 min. The reaction is neutralized by the addition of 12 tzl of 1 N HCI. tRNA (1 p,l, 5 mg/mi) is then introduced as a carrier. The solution is extracted with phenol/chloroform and precipitated with 200 tzl of ethanol. The pellet is dissolved in 5 tzl of a solution of 80% (v/v) formamide, 0.01 N NaOH, 1 mM EDTA, 1 mg/ml xylene cyanol, and 1 mg/ml bromphenol blue. The sample (2-3 tzl) is heated at 90° for 2 min, transferred to ice, and applied to a 5% polyacrylamide/7 M urea denaturing gel. After electrophoresis, the gel is subjected to standard autoradiographic techniques. Concluding Remarks We have successfully used this sensitive assay system to identify novel trans-acting factors involved in EGF receptor gene transcription regulation. 5"6'~j It is likely that this system can be used to analyze transcription by related TATA box-minus promoters and that together these studies may help elucidate general mechanisms by which expression of this important class of genes is regulated. Acknowledgments The authors wish to thank Drs. AlfredJohnson,PamelaMarino,and Ira Pastanfor useful discussions, and Althea Gaddis and Jennie Evans for editorial assistance.
EGF
[23] In Vitro
RECEPTOR AND RELATED RECEPTORS
Transcription of Epidermal Receptor Gene
Growth
[23]
Factor
B y RYOICHIRO KAGEYAMA and GLENN T. MERLINO
Introduction The p r o m o t e r of the epidermal growth factor (EGF) j receptor gene has a high GC content and lacks a typical T A T A box and C A A T box. 2 Recently, transcriptional m e c h a n i s m s have been intensively analyzed3'4; h o w e v e r , our understanding of the factors involved in transcription from p r o m o t e r s without T A T A boxes is still rather limited because of the low efficiency of cell-free transcription from these promoters. We have developed an in v i t r o transcription system for the human E G F receptor gene using nuclear extracts from A431 h u m a n epidermoid c a r c i n o m a cells, which o v e r p r o d u c e E G F receptors. 5'6 We found that transcription factors S p l and E T F ( E G F r e c e p t o r transcription factor) are required for the expression of E G F receptor. 5-8 S p l is a well-characterized factor that binds to GC boxes ( G G G C G G ) and stimulates transcription from various p r o m o t e r s containing GC b o x e s such as the SV40 promoter. 9"~° E T F is a novel trans-acting factor which also binds to GC-rich regions, but it specifically stimulates E G F r e c e p t o r transcription and has little or no effect on transcription f r o m the SV40 early promoter. 6'jj In this chapter we describe m e t h o d s for the preparation and fractionation of A431 nuclear extracts, a technique for purification of E T F , and the in v i t r o transcription assay used in the analysis of the E G F receptor i AMV, Avian myeloblastosis virus; CAT, chloramphenicol acetyltransferase; DTT, dithiothreitol; EGF, epidermal growth factor; HEPES, N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid; PBS, phosphate-buffered saline; PCPV, packed cell pellet volumes; SDS, sodium dodecyl sulfate; ETF, EGF receptor transcription factor. 2 S. Ishii, Y.-h. Xu, R. H. Stratton, B. A. Roe, G. T. Merlino, and I. Pastan, Proe. Natl. Acad. Sci. U.S.A. 82, 4920 (1985). 3 p. F. Johnson and S. L. McKnight, Anna. Rev. Biochem. 58, 799 (1989). 4 p. j. Mitchell and R. Tjian, Science 245, 371 (1989). 5 R. Kageyama, G. T. Merlino, and 1. Pastan, J. Biol. Chem. 263, 6329 (1988). 6 R. Kageyama, G. T. Merlino, and 1. Pastan, Proe. Natl. Aead. Sei. U.S.A. 85, 5016 (1988). 7 A. C. Johnson, S. lshii, Y. Jinno, I. Pastan, and G. T. Merlino, J. Biol. Chem. 263, 5693 (1988). 8 A. C. Johnson, Y. Jinno, and G. T. Merlino, Mol. Cell. Biol. 8, 4174 (1988). 9 W. S. Dynan and R. Tjian, Nature (London) 316, 774 (1985). ~0j. T. Kadonaga, K. A. Jones, and R. Tjian, Trends Biochem. 11, 20 (1986). " R. Kageyama, G. T. Merlino, and 1. Pastan, J. Biol. Chem. 264, 15508 (1989).
METHODS IN ENZYMOLOGY. VOL. 198
Copyright c~9 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
[23]
EGF RECEPTORin Vitro TRANSCRIPTION
243
promoter. Nuclear extract preparation and fractionation are basically performed according to Wildeman et al. 12and Dynan and Tjian,13 respectively. Preparation of the sequence-specific affinity resin for ETF purification is according to Wu et al. 14
Preparation of A431 Nuclear Extract Materials
Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum Phosphate-buffered saline without calcium and magnesium (PBS) Buffer 1:10 mM HEPES, pH 7.9, 10 mM KCI, 1.5 mM MgCI2, and 0.5 mM dithiothreitol (DTT) Buffer 2:20 mM HEPES, pH 7.9,420 mM NaCI, 0.2 mM EDTA, 1.5 mM MgC1z, 25% (v/v) glycerol, and 0.5 mM DTT Buffer 3:20 mM HEPES, pH 7.9, 20 mM KCI, ! mM MgC12, 17% (v/v) glycerol, and 2 mM DTT Methods
A431 cells (3 x 107 plated per roller bottle, 900 cm 2) are grown in 100 ml of Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Typically, 20 roller bottles are prepared. On the third day the medium is changed, and on the fourth day the cells are harvested. After washing with PBS the cells are collected by a scraper with 15 mi of ice-cold PBS per roller bottle. From this point all procedures are done at 4°. The cell suspension is subjected to centrifugation at 4700 g for 5 min, and the cell pellets are suspended in the same volume of PBS. After centrifugation at 1800 g for 5 min, the volume of the cell pellet is measured. We usually obtain 30 ml of packed cells from 20 roller bottles. The cells are resuspended in 5 packed cell pellet volumes (PCPV) of buffer 1 and placed on ice for 10 min. After centrifugation at 7300 g for 10 min, the cells are resuspended in 2 PCPV of buffer 1 and lysed by homogenization in a Dounce homogenizer (-20 strokes). Cell lysis should be checked by light microscopy; lysis should be greater than 90%. After centrifugation at 1200 g for 20 min, the homogenate separates into two ~2A. G. Wildeman,P. Sassone-Corsi,T. Grundstroem,M. Zenke,and P. Chambon,EMBO J. 3, 3129 (1984). 13W. S. Dynanand R. Tjian, Cell (Cambridge, Mass.) 32, 669 (1983). 14C. Wu, S. Wilson, B. Walker, 1. Dawid, T. Paisley,V. Zimarino,and H. Ueda, Science 238, 1247(1987).
244
E G F RECEPTOR AND RELATED RECEPTORS
[23]
phases. The top phase contains cytoplasmic proteins, and the bottom phase is a crude nuclear pellet. The pellet is suspended in 2 PCPV of buffer 2 by 10 strokes in a Dounce homogenizer. The homogenate is stirred gently on ice for 30 rain, then subjected to centrifugation at 12,000 g for 20 min. The supernatant is collected, and 0.33 g of (NH4)2SO4 per 1 ml of the supernatant is slowly added with gentle stirring. After this addition, the solution is stirred for an additional 20 min and then centrifuged at 12,000 g for 25 min. The pellet is suspended in buffer 3 at 1/12 the volume of the 12,000 g supernatant, and the resulting suspension is dialyzed against two changes of 100 volumes each of buffer 3 for a total of 5-8 hr. The dialyzate is centrifuged at I0,000 g for 10 min to remove insoluble material. The supernatant is divided into small aliquots, quickly frozen in dry ice, and stored at - 8 0 °. We usually obtain 100-150 mg of crude nuclear extract from 30 g of A431 cells.
Fractionation of A431 Nuclear Extract Materials
Heparin-agarose (Bethesda Research Laboratories, Gaithersburg, MD) DEAE-Sepharose CL-6B (Pharmacia, Piscataway, N J) HM buffer: 20 mM HEPES, pH 7.9, 1 mM MgCI 2, 2 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride, and 17% (v/v) glycerol Note: 0.1 M KCI/HM indicates 0.1 M KCI solution in HM buffer. Methods
Fractionation is performed according to the scheme shown in Fig. 1A. First, 250 mg of nuclear extract is applied to a heparin-agarose column (30-ml bed volume, 2.5 x 6 cm) equilibrated in 0.1 M KCI/HM, and 1.5ml fractions are collected. The column is washed with 3 bed volumes of 0.1 M KCI/HM (fraction A). In general, fraction A is not required for EGF receptor gene transcription. However, it may be necessary for optimal transcription of other promoters and should be tested in each case. The column is then eluted with 0.4 M KCI/HM (fraction B). The peak fractions are collected and dialyzed against 100 volumes of 0.1 M KCI/HM for 3 hr. Long dialysis should be avoided because the transcriptional activity is very labile. The 0.4 M KCI B fraction (75 mg) is next applied to a DEAE-Sepharose CL-6B column (30-ml bed volume, 2.5 x 6 cm) equilibrated in 0.12 M KCI/HM. The column is step-eluted with 2.5 bed volumes of 0.12 M KCI/
[23]
EGF RECEPTORin Vitro TRANSCRIPTION
245
A A431 Nuclear Extract
Heparin-Agarose
I
0.4M
IO.1M A
B
I DEAE-Sepharose 0.25M I O.5M
I 0.12M
BB general factors
BA
03
)
( pol II )
Oligo Affinity x2 0.5M
ETF
B 5'
I
I
3,
CCCGCGCGAGCTAGACGTCCGGGCAGCCCCCGGCGCAGCGCGGCCG GATCTGCAGGCCCGTCGGGGGCCGCGTCGCGCCGGC 3,
I
I
5,
FIO. 1. (A) Fractionation of A43 i nuclear extract. DEAE-Sepharose fraction BA contains ETF, which is further purified by sequence-specific oligonucleotide affinity chromatography. DEAE-Sepharose fractions BB and BC contain general transcription factors and RNA polymerase lI, respectively. (B) Sequences of the two oligonucleotides used for the affinity resin. The ETF-binding region is indicated by brackets.
HM (fraction BA), 0.25 M KCI/HM (fraction BB), and then 0.5 M KCI/ HM (fraction BC). The peak protein-containing fractions from each step are individually pooled, adjusted to 0.33 mg/mi (NH4)2SO4 and stirred gently at 4° for 1 hr. After centrifugation at 10,000 g for 15 min, each pellet is dissolved in 500/~1 of 0.12 M KCI/HM. The three fractions are individually dialyzed against 100 volumes of 0.12 M KCI/HM for 3 hr. The final yields of the fractions BA, BB, and BC are usually approximately 6, 15, and 5 mg, respectively. Fraction BB contains most general transcription factors, and fraction BC has RNA polymerase I1. Transcription factor
246
E G F RECEPTOR AND RELATED RECEPTORS
[23]
ETF is present in fraction BA. For purification of ETF we subject pooled 0.12 M KCI fractions directly to sequence-specific oligonucleotide affinity chromatography without concentration by (NH4)2SO4 precipitation. Purification of Epidermal Growth Factor Receptor Transcription Factor Materials. Two complementary oligonucleotides, a 46-mer and a 36mer, and CNBr-activated Sepharose 4B (Pharmacia) are required to prepare the affinity column. The two oligonucleotides 5'-CCCGCGCGAGCTAGACGTCCGGGCAGCCCCCGGCGCAGCGCGGCCG-3'
and 5'-CGGCCGCGCTGCGCCGGGGGCTGCCCGGACGTCTAG-Y
are made using an Applied Biosystems (Foster City, CA) DNA synthesizer (Model 380A). Methods
The sequence-specific oligonucleotide affinity resin is prepared as follows. We make two complementary oligonucleotides (46-mer and 36-mer) in order that the annealed oligonucleotides consist of a 36-base pair (bp) double-stranded portion and a 10-nucleotide single-stranded portion (Fig. 1B). The single-stranded part is necessary for the coupling reaction to CNBr-activated Sepharose. We use the oligonucleotides without purification. For annealing, 700/zg of the 46-mer and 540/xg of the 36-mer are mixed in a final volume of 400/zl of solution containing 10 mM potassium phosphate, pH 8.2, and 100 mM NaCl. This mixture is heated at 85 ° for 2 min and then gradually cooled to room temperature over several hours. The hybridized oligonucleotides can be stored at 4 °. The annealing efficiency should be checked by an 8% polyacrylamide nondenaturing gel. Only a double-stranded band should be seen after staining with 1 /zg/ml ethidium bromide. This hybridized DNA fragment is used for the coupling reaction without further purification. The coupling reaction is carried out in a 4° cold room. CNBr-activated Sepharose 4B (1.2 g) is suspended in 40 ml of I mM HCI and poured into a 15-ml sintered glass funnel under slight vacuum. The Sepharose is washed sequentially with 150 ml of 1 mM HCI and 3 times with 15 ml of 10 mM potassium phosphate, pH 8.2, after which the vacuum is released. The Sepharose solution is resuspended in 2.5 ml of 10 mM potassium phosphate and transferred to a 15-ml polypropylene tube. The funnel is washed with an additional 2.5 ml of 10 mM potassium phosphate, and this solution is
[23]
EGF RECEPTORin Vitro TRANSCRIPTION
247
also transferred to the same tube. The hybridized olgionucleotide mixture (400 p,l) is then added to the Sepharose solution, and the tube is rotated at room temperature for 18 hr. The coupling reaction is stopped by addition of Tris-HCl, pH 8.0, to a final concentration of 100 mM. This mixture is incubated at 4° for 24 hr and then transferred to a 15-ml sintered glass funnel at room temperature. The Sepharose is washed with 10 mi of 100 mM Tris-HCl, pH 8.0; 30 ml of 100 mM potassium phosphate, pH 8.2; 30 ml of a solution of 1.5 M NaCI and 10 mM Tris-HCl, pH 8.0; and 30 ml of a solution of 100 mM NaCl, 10 mM Tris-HCl, pH 8.0, and 1 mM EDTA in this order under slight vacuum. The vacuum is released, and the Sepharose is suspended in 5 ml of the latter buffer and stored at 4°. The efficiency of the coupling reaction can be checked by using 32p-labeled oligonucleotides. More than 20% of the oligonucleotides should be coupled. To purify the transcription factor ETF, fraction B A (10 ml, - 1 . 5 mg/ ml) is applied to the sequence-specific oligonucleotide affinity column (1-ml bed volume in Econo-column, Bio-Rad, Richmond, CA) equilibrated in 0.12 M KC1/HM. The column is washed with 5 ml of 0.25 M KCI/HM and then eluted with 2 ml of 0.5 KCI/HM. The eluate ( - 2 ml) is diluted to 0.1 M KC1 with HM buffer, and reapplied to a second affinity column (lml bed volume in Econo-column) equilibrated in 0.12 M KC1/HM. The column is washed with 5 ml of 0.25 M KCI/HM and eluted with 2 ml of 0.5 M KCI/HM. For the elution, 0.5-ml fractions are collected and analyzed by sodium dodecyl sulfate (SDS)/10% polyacrylamide gel electrophoresis. The peak fraction which contains the majority of the 120-kDa protein is used for the DNase 1 footprinting, gel mobility shift, and in vitro transcription assays. In Vitro Transcription Assay Materials. Supercoiled DNA templates containing the chloramphenicol acetyltransferase (CAT) gene, and a CAT-specific primer, 5'-TGCCATTGGGATATATCAACGGTG-Y
that is complementary to the region between nucleotides 4920 and 4943 of pSV2 cat were prepared.15 Sephadex G-50, DNA grade (Pharmacia), T4 polynucleotide kinase (Bethesda Research Laboratories), avian myeloblastosis virus (AMV) reverse transcriptase (Life Sciences, Pharmacia, or Boehringer Mannheim, Indianapolis, IN), RNase-free DNase I (Bethesda Research Laboratories), and [y-32p]ATP, 5000 Ci/mmol (Amersham, Art5 C. Gorman,
in " D N A Cloning, Volume 11, A Practical Approach" (D. M. GIover, ed.), p. 143. IRL, Oxford and Washington, D.C., 1985.
248
E G F RECEPTOR AND RELATED RECEPTORS
I
pGEM4
1
I
I
Receptor Promoter
EGF
~
[23]
v
.,~M_~_
"--~,~
3'
CAT
GTGGCAACTATATAGGGTFACCGT 5'
FIG. 2. Structure of the supercoiled DNA template. The EGF receptor promoter region and the truncated CAT gene (between nucleotides 4751 and 5001 of pSV2 cat 15) are cloned into pGEM-4 (Promega, Madison, WI). The start site ( - 48) and direction of transcription are indicated by the upper arrow. The asterisk shows the 5'-end-labeled site of the CATspecific primer (thick line), and the lower arrow indicates the primer-extended product. The sequence of the primer is also shown.
lington Heights, IL), were obtained from the indicated sources. Glycine buffer contains 170 mM glycine, 170 mM NaCI, and 32 mM NaOH. Methods
There are several methods available to study in vitro transcription: runoff, 16,17 S 1 nuclease mapping, J6 and primer extension assays. The clearest
results are usually obtained using a primer extension assay. The templates we use are supercoiled plasmids containing the EGF receptor promoter and the CAT reporter gene (Fig. 2). In general, the use of a truncated CAT gene can substantially reduce the background. However, when using the highest quality extracts and fractions we get virtually the same signal from plasmids containing the whole CAT gene. A 5'-end-labeled CAT-specific primer is used to detect transcripts initiating within the EGF receptor promoter. The distance between the labeled site of the primer and the 5' end of the CAT gene is 80 nucleotides. Therefore, the primer-extended product corresponding to the initiation site in the promoter should be greater than 80 nucleotides. The primer is 5'-end-labeled as follows. First, the primer (5/xl, 70 ng) is heated at 90 ° for 30 sec and transferred to ice. Then, 1.75/xl of 100 mM MgCI z, 1.75 /xl of 100 mM DTT, 4.4 /xl of glycine buffer, 10 /zl of [y-3Zp]ATP, and 1 ~1 of T4 polynucleotide kinase (10 units/~l) are added, and the mixture is incubated at 37° for 30 min. This solution is applied 16j. L. Manley, A. Fire, M. Samuels, and P. A. Sharp, this series, Vol. 101, p. 568. 17j. D. Dignam, P. L. Martin, B. S. Shastry, and R. G. Roeder, this series, Vol. 101, p. 582.
[23]
EGF RECEPTORin Vitro TRANSCRIPTION
249
to a Sephadex G-50 column (l.8-ml bed volume in an Econo-column) equilibrated in TE buffer (10 mM Tris-HCl, pH 7.5, and 1 mM EDTA) to separate the labeled primer from the free [y-SzP]ATP. Fractions (3 drops, 100 tzl) are collected and counted. The two or three peak fractions are pooled and directly used for the primer extension assay. In vitro transcription reactions are carried out as follows. When using a crude nuclear extract, 1.25/xl of a mixture of 10 mM each of ATP, GTP, CTP, and UTP (10 mM 4NTP), 1.2/xl of 40 mM spermidine, 1.5/zl of 16 mM MgCI2, 2.3 tzl of 500 mM KCI, and 1/zg of a DNA template are mixed with an appropriate amount of water to make the volume 17.5 txl. The crude nuclear extract (7.5 /xl, - 1 2 mg/ml) is then added to start the reaction. When using the heparin-agarose fraction B, 2.5 /xl of 10 mM 4NTP, 2.4/zl of 40 mM spermidine, 3/zl of 16 mM MgCI2, and 1 /xg of a DNA template are mixed with an appropriate amount of water to make the volumn 38/zl. Fraction B (12/xl, - 6 mg/ml) is then added to start the reaction. When reconstituting DEAE-Sepharose fractions, the same amounts of reagents and DNA are used as for the heparin-agarose fraction, but they are mixed with an appropriate amount of water to make the volume 31 /A. Then 7/xl of fraction BA, 7/zl of fraction BB, and 5/xl of fraction BC are added. When using purified ETF, 2 /zl of the affinity column eluate and 5 txl of HM buffer are added instead of fraction BA. After incubation at 30° for I hr, the reaction is stopped by the addition of 400/xl of a solution of 0.3 M sodium acetate, 0.4% SDS, and 1 mM EDTA and extracted with phenol/chloroform and then with chloroform. After the addition of 1 ml of ethanol, the mixture is incubated in a dry ice/ ethanol bath for 5 min and centrifuged for 10 min. After washing with ethanol and drying, the pellet is dissolved in 200/zl of 2 M LiCI. Ethanol (400/xl) is added, and the solution is incubated on ice for 30 min. After centrifugation for 10 min and washing with ethanol, the pellet is suspended in 100/xl of a solution of 10 mM Tris-HCl, pH 7.5, 100 mM NaCI, and 10 mM MgC12 and treated with 13/xg of RNase-free DNase I at 37° for l0 rain. The reaction is stopped by the addition of a solution of 100 pA of 10 mM EDTA, 0.2% SDS (w/v), and 150 mM NaCl, and the resulting mixture is extracted with phenol/chloroform. The 32p-end-labeled primer (5-10 pA, 0.1-0.2 pmol) and 500/xl of ethanol are added to the cell-free RNA. After incubation in a dry ice/ethanol bath for 5 min, the mixture is subjected to centrifugation for 10 min. At least 50% of the radioactivity should be in the pellet. After washing with ethanol, the pellet is dissolved in 10/xl of a solution of 40% (v/v) formamide, 0.4 M NaCI, 40 mM piperazine-N,N'-bis(2-ethanesulfonic acid), pH 6.4, and ! mM EDTA and then heated at 75° for 5 min. After incubation at 42° for 2 hr, 80/xl of water, 10/zl of 3 M sodium acetate, and 250/zl of
250
E G F RECEPTOR AND RELATED RECEPTORS
[23]
ethanol are added, and the mixture is placed in a dry ice/ethanol bath for 5 min. Nucleic acids are recovered by centrifugation in a microcentrifuge for 10 min. After ethanol washing, the pellet is dissolved in 49/zl of a solution of 50 mM Tris-HCl, pH 8.3, 8 mM MgCI2, 30 mM KCI, 3 mM DTT, 1 mM each of dATP, dGTP, dCTP, and dTTP, and 1.6 tzg/ml of actinomycin D. AMV reverse transcriptase (1 ~1, 10-20 units) is added to start the reaction. After incubation at 37° for 1 hr, the reaction is stopped by sequentially adding 6/~1 of 0.25 M EDTA and 6 tzl of 2 N NaOH, then heating at 37° for 20 min. The reaction is neutralized by the addition of 12 tzl of 1 N HCI. tRNA (1 p,l, 5 mg/mi) is then introduced as a carrier. The solution is extracted with phenol/chloroform and precipitated with 200 tzl of ethanol. The pellet is dissolved in 5 tzl of a solution of 80% (v/v) formamide, 0.01 N NaOH, 1 mM EDTA, 1 mg/ml xylene cyanol, and 1 mg/ml bromphenol blue. The sample (2-3 tzl) is heated at 90° for 2 min, transferred to ice, and applied to a 5% polyacrylamide/7 M urea denaturing gel. After electrophoresis, the gel is subjected to standard autoradiographic techniques. Concluding Remarks We have successfully used this sensitive assay system to identify novel trans-acting factors involved in EGF receptor gene transcription regulation. 5"6'~j It is likely that this system can be used to analyze transcription by related TATA box-minus promoters and that together these studies may help elucidate general mechanisms by which expression of this important class of genes is regulated. Acknowledgments The authors wish to thank Drs. AlfredJohnson,PamelaMarino,and Ira Pastanfor useful discussions, and Althea Gaddis and Jennie Evans for editorial assistance.
