Mol Biotechnol DOI 10.1007/s12033-014-9749-x

RESEARCH

In Vitro Selection of RNA Aptamers Directed Against Protein E: A Haemophilus influenzae Adhesin Anders Barfod • Birendra Singh • Urban Johanson Kristian Riesbeck • Per Kjellbom

•

Ó Springer Science+Business Media New York 2014

Abstract Protein E (PE) of Haemophilus influenzae is a highly conserved ubiquitous surface protein involved in adhesion to and activation of epithelial cells. The host proteins—vitronectin, laminin, and plasminogen are major targets for PE-dependent interactions with the host. To identify novel inhibitory molecules of PE, we used an in vitro selection method based on systematic evolution of ligands by exponential enrichment known as SELEX in order to select 20 F-modified RNA aptamers that specifically bind to PE. Fourteen selection cycles were performed with decreasing concentrations of PE. Sequencing of clones from the 14th selection round revealed the presence of semiconserved sequence motifs in loop regions of the RNA aptamers. Among these, three aptamers showed the highest affinity to PE in electrophoretic mobility shift assays and in dot blots. These three aptamers also inhibited the interaction of PE with vitronectin as revealed by ELISA. Moreover, pre-treatment of H. influenzae with the aptamers significantly inhibited binding of vitronectin to the bacterial surface. Biacore experiments indicated that one of the aptamers had a higher binding affinity for PE as compared to the other aptamers. Our results show that it is possible to

Electronic supplementary material The online version of this article (doi:10.1007/s12033-014-9749-x) contains supplementary material, which is available to authorized users. A. Barfod (&)  U. Johanson  P. Kjellbom Department of Biochemistry and Structural Biology, CMPS, Lund University, Box 124, 221 00 Lund, Sweden e-mail: [email protected] B. Singh  K. Riesbeck Medical Microbiology, Department of Laboratory Medicine Malmo¨, Lund University, Ska˚ne University Hospital, 205 02 Malmo¨, Sweden

select RNA inhibitors against bacterial adhesins using SELEX in order to inhibit interactions with target proteins. Keywords SELEX  Protein E  Non-typeable Haemophilus influenzae  RNA aptamer  Inhibitor  Vitronectin

Introduction Haemophilus influenzae is a common human respiratory pathogen. Clinical isolates of H. influenzae are divided into encapsulated strains and unencapsulated strains. Encapsulated strains are on the basis of distinct capsular antigens classified into six different serotypes, i.e., a, b, c, d, e, and f. Introduction of a vaccine against H. influenzae capsule type b (Hib) in the early 1990s dramatically reduced the incidence of invasive infections caused by this particular serotype [1]. In contrast to the capsulated H. influenzae, the unencapsulated isolates do not contain capsular antigens and hence are classified as non-typeable H. influenzae (NTHi). NTHi is responsible for an array of mucosal and respiratory infections. After Streptococcus pneumoniae, NTHi is the leading cause of middle ear infections, i.e., acute otitis media (AOM), which has an 80 % morbidity rate in children under the age of 3 years [2]. NTHi also plays an important role in the pathogenesis of chronic obstructive pulmonary disease (COPD), both during exacerbations and in chronically infected patients. There is not yet any vaccine available against NTHi. For invasion and survival in the host, H. influenzae expresses a number of various membrane proteins. These proteins include, e.g., Hap, Hia, and high molecular weight (HMW1/HMW2) proteins [3]. Some of their eukaryotic binding targets have been identified. For example, the

123

Mol Biotechnol

autotransporter Hap binds to extracellular matrix proteins [4], and the HMW1/HMW2 proteins bind to a glycoprotein receptor [5]. The receptor for Hia has not yet been identified, whereas Hsf binds to the serum complement regulator vitronectin [6]. Recently, a H. influenzae 16 kDa surface lipoprotein designated protein E (PE), which functions as an adhesin in the interaction between bacteria and human epithelial cells, was discovered in our lab [7]. PE is a lipoprotein that is anchored to the outer membrane of H. influenzae by a lipid moiety covalently attached to amino acid residue 16, a cysteine located after the end of the N-terminal signal peptide. The structure of PE has recently been solved by X-ray diffraction [8, 9]. When the pe gene was analyzed for prevalence in clinical NTHi isolates, the gene was found in all samples (n = 186). Of these, 86 isolates were tested for the presence of PE and all isolates tested expressed the protein which indicates that the protein is ubiquitous and constitutively expressed in NTHi [10]. The serum component vitronectin has been shown to bind to PE with a KD value of 0.4 lM [8, 11, 12]. It was also demonstrated that a peptide fragment of PE spanning the amino acid positions 84 to 108 was required for vitronectin binding. Vitronectin is a multifunctional and multidomain protein that plays a crucial role in many biological processes including cell migration, adhesion, and angiogenesis [13]. Interestingly, soluble vitronectin binds directly to complement proteins and modulates their functions. The mechanism of binding and mode of regulation is not fully understood, but vitronectin inhibits the terminal complement pathway by interacting with the C5b-7 complex and inhibits C9 polymerization [10, 14]. Pathogens such as H. influenzae have in general evolved different sophisticated mechanisms to avoid the complement-mediated defense by expressing proteins that bind complement regulators. It has been shown that vitronectin when bound to the surface of NTHi leads to a reduced bactericidal activity induced by the membrane attack complex (MAC). Furthermore, serum depleted of vitronectin resulted in a significantly decreased bacterial survival [11, 12]. Since PE is ubiquitous among NTHi strains and important for pathogenesis, measures to find new molecules that bind and neutralize PE as well as other NTHi surface proteins are desired for potential drug development. Systematic evolution of ligands by exponential enrichment (SELEX) methodology has successfully been used to isolate high-affinity inhibitors for numerous target proteins [15]. SELEX [16, 17] is a combinatorial in vitro technique in molecular biology to select RNA or DNA oligonucleotides that bind to a variety of target ligands, including small molecules, peptides, and proteins. Through a number of iterative cycles of selection and amplification, a limited number of RNA or DNA molecules are selected that bind the target ligand preferably in the low

123

nanomolar range. Targets can be diverse but especially surface proteins are interesting since intracellular targets are difficult to reach for RNA/DNA aptamers that like antibodies are large, charged, and hydrophilic molecules that do not readily cross biological membranes. SELEX has for instance been used to select for DNA/RNA aptamers to surface proteins of RNA viruses of the family Orthomyxoviridae, i.e., influenza viruses [18, 19]. Obtaining large DNA/RNA aptamer libraries are not costly as they easily can be synthesized, first as DNA oligonucleotides containing a variable region of a certain length. These DNA oligonucleotides can then be amplified using flanking regions and transcribed using native or mutant RNA polymerase, the latter for producing modified RNA. As compared to native RNA, modified RNAs are stable in serum and so far few side effects have been reported when RNA aptamers have been used as drugs [20]. Since H. influenzae PE can be expressed in a pure and soluble active form it constitutes an excellent protein target for the SELEX methodology. In this study, a 20 F-modified RNA library was used for the selection with the aim of identifying aptamers that bind to PE with high specificity and affinity. The selected aptamers were shown to bind to PE and inhibit vitronectin from binding to PE. This was also established using a live NTHi isolate where selected aptamers inhibited the binding of vitronectin to the surface of the bacteria. Further development and characterization of the selected aptamers might facilitate future therapeutic use of them since they potentially may abolish adherence of pathogens and hence bacterial survival in the human host.

Materials and Methods Production of Truncated H. influenzae PE in the Expression Host Escherichia coli The construct pET26b-PE was used for expression of a C-terminal His-tagged version of PE that did not contain the 21 aa N-terminal signal peptide [12]. E. coli BL21(DE3) containing the construct was grown in 500 ml LB medium with kanamycin at 37 °C. When OD600 reached 0.8–1, the expression of PE was induced by 1 mM IPTG and cultivation was continued for another 3 h at 37 °C. Bacteria were harvested at 5,0009g for 15 min at 4 °C. The protein purification was performed as described elsewhere [11]. In Vitro Selection: SELEX The DNA library was generated using oligo A (50 -G CGTAATACGACTCACTATAGGGAATTCGAGCTCG GTACC-30 ) (sequence for T7 promoter underlined) and oligo B (50 -CGACTGCAGAGCTTGCTACG(N)50GGT

Mol Biotechnol

ACCGAGCTCGAATTCCC-30 ). Oligos were synthesized and purchased from IBA. Oligo B contained a central sequence of 50 randomized nucleotides flanked by constant regions for annealing to oligo A and an annealing site for reverse transcription using primer 1 (50 -CGACT GCAGAGCTTGCTACG-30 ). A double-stranded DNA library was made by annealing 3 lM of oligo A and oligo B (95 °C, 5 min followed by cooling for 15 min at 25 °C), subsequently a Klenow fragment (Fermentas) was added in the supplied Klenow buffer and incubated at 37 °C for 2 h. Double-stranded DNA was purified on a Microcon YM-30 column (Merck Millipore) and eluted with RNAse-free water. The 20 F-modified library was made by transcription of 40 lg template using T7 R&DNATM Polymerase (Epicentre) in the supplied transcription buffer, 10 mM DTT (Epicentre), and 1.25 mM ATP, GTP, 20 F-dCTP, and 20 F-dUTP (Epicentre). RNA was labeled with 0.37 MBq [a-32P]-ATP (GE Healthcare) in a 20 ll reaction volume. DNA/RNA was precipitated using 0.2 M NaOAc, 70 % EtOH. The transcribed RNA was separated using 10 %, 8 M urea PAGE. RNA was then extracted with 1 M NaOAc (pH 4.7) overnight and filtered through glass wool and precipitated with 70 % EtOH and 0.05 % glycogen. The first selection cycle was performed with 32 lg ([1 nmol) radioactively labeled 20 F-RNA on 165 lg (*5 nmol) purified truncated His-tagged PE immobilized on Ni–NTA agarose (Qiagen) in 1.6 mL PBSM (PBS with 1 mM MgCl2) incubated at room temp for 1 h. In later rounds, Ni–NTA agarose was exchanged for Ni–NTA magnetic beads (Qiagen) and protein levels were gradually decreased to 5 lg in 1.6 mL binding buffer (*100 nM) in the last two rounds. Between 7.5 lg and 14 lg of transcribed 20 F-RNA was used in the selection rounds. Bound RNA was washed 3 times with 1.5 ml PBS and eluted with 300 mM imidazole in PBS. Selection 3 was washed four times with 300 mM NaCl in PBS. RNA was extracted with phenol/chloroform. In selections 6 and 8, yeast RNA (265 lg) was added to the binding buffer. The RNA was precipitated as described earlier and desalted on a Millipore Microcon YM-10 column. RNA purity was monitored by measuring the UV absorption with a Nanodrop spectrophotometer and the integrity of the aptamers was routinely checked by subjecting them to denaturing PAGE. Singlestranded DNA was generated by adding primer 1 in threefold molar excess of the isolated RNA with 20 units of M-MuLV-RT (Fermentas) and 1 mM dNTP. 20 F-RNA was degraded by addition of 0.1 M NaOH at 37 °C for 30 min. Single-stranded DNA was purified using a YM-30 column and the concentration was determined using a Nanodrop spectrophotometer. Double-stranded DNA was generated with Klenow fragment (Fermentas) by addition of oligo A. The dsDNA was amplified by PCR using Taq DNA polymerase (Fermentas) with a maximum of 12–14 cycles

using primers 1 and 2 (50 -GCGTAATACGACTCACTATAG-30 ). PCR products were pooled and purified with a PCR purification kit (EZNA) and used as template for the next SELEX cycle. Cloning and Sequencing of RNA Aptamers PCR-amplified dsDNA from the final selection round was cloned into the TOPO vector pCRÒ4 from Invitrogen and transformed into the E. coli strain TOP10 (Invitrogen). Insert was confirmed by PCR using M13-reverse and forward primers. Positive clones were re-streaked on 100 lg/mL amp-LB plates, and plasmids were isolated with miniprep (EZNA). PCR products or plasmids were sent to Eurofins MWG/Operon for sequencing. Sequences were aligned and screened for conserved motifs using the MEME/MAST system motif discovery search version 3.5.4 [21]. Secondary RNA structure predictions were generated using the mfold web server (http://mfold.rna.albany.edu) based on the work of Zuker [22] or the RNAfold server at the University of Vienna (http://rna.tbi.univie.ac.at). Electrophoretic Mobility Shift Assay (EMSA) DNA from SELEX pools or individual aptamers from the final SELEX round was transcribed with T7 R&DNATM Polymerase (Epicentre) and 0.37 MBq [a-32P]-ATP (GE Healthcare) in a 20 ll reaction volume. Transcription products were purified from denaturing gels as described earlier. Labeled 20 F-RNA (5–25 ng) was incubated with varying concentrations of purified PE (0.09–1.1 lM) in 20 ll PBS buffer with 1 mM MgCl2, 1 lg of BSA, and 1 lg salmon testis ssDNA. Samples were incubated 20 min at RT. DNA loading buffer (6x) (Fermentas) was added and samples were run on 1 mm 7 % native PAA gel buffered with a standard 1 9 Tris/Borate buffer, pH 7.9 (without the addition of 2 mM EDTA) and run at 90 Volts in a BioRad mini gel system. Competition experiments were done by adding a 17to 30-fold molar excess of cold 20 F-RNA prior to the addition of [32P]-labeled RNA. Native gels were transferred to Whatman paper, dried, and the labeled RNA was detected by exposure on Fuji phosphorimager plates. Nitrocellulose Filter Assay 32

P-labeled 20 F-RNA (5–100 ng) from selected clones was incubated with varying concentrations of PE (15 nM– 800 nM) for 30 min in 120 or 200 ll PBS buffer or 40 mM Tris–HCl buffer pH 7.9 with varying salt concentrations (150–300 mM NaCl). BSA (8 lg) and ssDNA (&9 lg) from salmon testis were added. Protein was captured by filtering through pre-soaked 0.45 lM nitrocellulose filters with vacuum suction using a 96-well Schleicher & Schuell

123

Mol Biotechnol

filter block. All filtered samples were washed with 200 ll PBS or Tris–HCl buffer. Filters were air-dried and bound RNA was detected using Fuji phosphor-imaging plates.

analysis was performed using GraphPad PrismÒ version 5.0 (GraphPad Software, La Jolla, CA, USA) to measure the statistical significance between different groups.

RNA Aptamer/PE-Binding Studies Using Surface Plasmon Resonance (Biacore)

Binding of [125I]-Labeled Vitronectin to the Surface of H. influenzae

A CM5 chip was prepared with carbodiimides (EDC) and Nhydroxysuccinimide (NHS) for amine coupling of PE using a standard protocol recommended in the manual of Biacore (GE Healthcare Biosciences). Purified PE (100 lg/ml) was injected for 15 min at 10 ll/min on the chip in a Biacore 3000 giving rise to an increase of roughly 2,100 resonance units (RU) compared to the empty flow cell. The ethanolamine step was discarded as it might affect the stability of PE and its native dimeric state. Instead the chip was washed with the running buffer (PBS with 1 mM MgCl2 and 0.05 % Tween 20) overnight at 10 ll/min. Next day 150 ll of different RNA aptamers at 400 nM were injected at 10 ll/min. The dissociation was run for 250 ll and the PE surface was regenerated with 50 ll of the running buffer with a high salt concentration (1.15 M NaCl) followed by 150 ll of the standard running buffer before injecting the next RNA aptamer. The rates from the Biacore data were calculated when fitting 800 s of association or dissociation to a one- or twophase non-linear regression. With the two-phase non-linear regression only the fast rates were used in calculating the kon and the KD. The KD was calculated as koff 9 [L]/(kobs ? koff), where [L] is the ligand concentration and kobs is the observed association rate.

Vitronectin was labeled with iodine using the chloramineT method [23]. The clinical H. influenzae isolate NTHi3655 [24] was grown overnight in LB medium and washed with PBS with 1 % BSA. To inhibit vitronectin binding, bacteria (1 9 107) were preincubated with various concentrations of 20 F-RNA transcribed from clones 2, 7, and 9 for 45 min. Total RNA extracted from the human lung alveolar epithelial cell line A549 was sheared by sonication and used as a negative control. Iodine-labeled human vitronectin (100,000 cpm) was added and incubated for 1 h followed by washes with PBS with 1 % BSA. Bound [125I]-labeled vitronectin was measured in a gamma counter.

Measurement of the PE: Vitronectin Interaction with Enzyme-Linked Immunosorbent Assay (ELISA) PE (200 ng/well) was resuspended in a coating buffer consisting of 100 mM Tris–HCl, pH 9.0, added in 96-well ELISA plates (PolySorp, Nunc) and incubated overnight at 4 °C. Thereafter, the plates were blocked for 1 h with PBS with 2.5 % BSA followed by 2 washes with PBST (0.05 % Tween20). 20 F-RNA aptamers (100–500 ng/well) in 100 ll was incubated for 45 min at RT followed by 4 washes with PBST. Vitronectin (20 ng/100 ll) was added for 1 h followed by four washes with PBST. Anti-vitronectin goat antibodies (AbD Serotec) were added to a final dilution of 1:2,000 in 100 ll/well for 1 h at RT followed by 4 washes with PBST. Thereafter HRP-conjugated anti-sheep/goat secondary (AbD Serotec) antibodies (1:4,000) were added for 1 h at RT, followed by 4 washes with PBST. Plates were developed and the absorbance was measured at 450 nm in a microplate reader. Samples of vitronectin preincubated for 1 h with 1-2 lg heparin were also included and added to the PE-coated ELISA plates. The remaining protocol was identical to the one used for samples treated with 20 F-RNA. Two-way ANOVA

123

Results In Vitro Selection of a 2’F-RNA Library with H. influenzae PE Recombinant PE has previously been shown to be stable and functionally active [12], and was, therefore, used as the target for an in vitro selection (SELEX) using a 20 F-modified RNA library. The outline of the selection, the concentrations of PE and 20 F-RNA, and ratio of PE to 20 F-RNA are described in Fig. 1a. The recovery of bound RNA after extraction and precipitation is shown in Fig. 1b, c. A drop in recovery was observed in rounds 6 and 8 when yeast RNA was added to block non-specific interactions. A slightly increased recovery was observed after round 10. However, to increase the stringency by lowering the protein concentration through the last selection cycles (11–14), we obtained a lower but stable RNA recovery through the last four selection rounds. In the final round (cycle 14), 4.4 % of the 20 F-RNA was recovered at 100 nM PE with a PE to RNA ratio close to 1. Matrix binding was analyzed and no binding on magnetic Ni–NTA beads without PE was detected with the concentration of beads used in the later selection rounds (data not shown). The number of PCR cycles used in each selection round was closely monitored, as excessive cycles in early rounds might lead to an amplification artifact and false bands as well as loss of the correct product [25]. In early rounds no more than 12 to 14 PCR cycles could be performed, but in the last two rounds considerably more cycles were run without artifacts amplified in the PCR (data not shown). This indicated that the final pools were less complex

Mol Biotechnol Fig. 1 a A schematic overview of the SELEX procedure performed in this study. b The table in the figure shows the concentrations of 20 F-RNA and PE, their ratio, and the percentage of recovered (bound) 20 F-RNA after elution, phenol/ chloroform extraction, and precipitation. c Graphical display of the recovery in percent through the 14 selection rounds

b a Initial 2 F-RNA library (size 1014)

Discard nonbinding 2 F- RNA

Selection on immobilized PE Enriched library. Transcribe DNA to 2 F-RNA

Elute and collect bound 2 F- RNA

14 SELEX cycles

Reverse transcription and PCR amplification

Cycles

PE (µM)

2’F-RNA (µM)

Ratio

Recovery (%)

1

6.5

1.33

5:1

4.9

2

6.0

0.335

18 : 1

22

3

2.5

0.23

10 : 1

5.6 6.3

4

0.8

0.230

3.5 : 1

5

0.26

0.230

1.1 : 1

2.9

6

0.125

0.275

1 : 2.2

1.9

7

0.43

0.175

2.5 :1

3.4

8

0.22

0.270

1 : 1.2

2.0

9

0.43

0.195

2.2: 1

5.2

10

0.43

0.175

2.5 : 1

8.5

11

0.15

0.2

1: 1.3

3.9

12

0.15

0.175

1 : 1.2

3.9

13

0.1

0.2

1:2

3.2

14

0.1

0.175

1 : 1.8

4.4

12

14

c RNA recovery

25% 20% 15% 10% 5% 0% 1

2

3

4

5

6

7

8

9

10

11

13

SELEX cycle

than the pools recovered in early rounds. Hence, pool 14 was chosen for cloning and sequencing. Cloning and Sequencing of Selected Aptamers Reveals a Conserved Nucleotide Motif In the initial bacterial colony PCR screen, a large percentage (21 %) of the 66 clones from pool 14 that tested positive for insert revealed clones with shorter inserts than expected. A total of 40 clones were selected for sequencing, 39 of which were of expected length and one of shorter length. The sequences of the initially randomized region of the clones are shown in Table 1. Thirty unique sequences and 10 duplicates were found among the 40 analyzed clones indicating that the final pool contained a limited number of unique sequences as a result of a converging selection. The random region of the 30 individual sequences was analyzed with the motif-finding tool MEME. A seven-nucleotide motif A[TA][CT]C[AC]A[ACG] was found in all 30 sequences (E value = 0.084, Fig. 2). The 10 clones that displayed the lowest P values for the MEME motif found for all 30 sequences are shown in Table S1. These 10 clones were further divided into two groups of 6 and 4 members,

respectively, based upon conserved sequences within the MEME motif. Among the 10 clones, clones 1 and 2 representing the two groups were chosen for further analyses. In addition, three more clones were selected for subsequent studies. Clones 7 and 15 were selected based on their frequency within the sequenced clones, as they appeared five and three times, respectively. Finally, clone 9 was included since it was the only sequenced clone with a short insert. Mfold predicted secondary structures of the RNAs encoded by the five clones are shown in Fig. 2. Both the mfold method and the RNAfold method generated very similar secondary structures. However, the secondary structures of the RNA molecules seen in Fig. 2 are stabilized by the flanking regions and removing these regions influence the predicted structures. The secondary structures of the five selected aptamers show RNA folds with high melting points and low DG values. The common 7 nucleotide MEME motif was located almost exclusively in the loops of the predicted structures. The MEME motif analysis also revealed the presence of longer semiconserved regions. Such a region was found in 11 clones and spanned 43 nucleotides of the randomized 50 oligonucleotide region with an E value of 7.6 9 10-4 (Fig. S1).

123

Mol Biotechnol Table 1 Sequence of the initially randomized region of 30 unique identified sequences originating from 40 sequenced clones of pool 14 of selection on protein E. The 7-nt MEME identified sequence is shown underlined

Clone 1*

Sequence

Freq.

TGATCAAATCGAGCTTTAACCCAACAGAGCATCCGTATCTATCCAAATG

1 1

Clone 2*

TTGTAATTCAAAACAAAGGTTTCCTGGACTCCCCGCAGGTCTTGTGAAT

Clone 3

ATCCAAACTACAGAGCAACGATCCCGATTAAGCAGAGGCATACACAATCC

1

Clone 4

TGATCCAAGGACCGATGTTCACCCAGGCAGAAGCATTCTATCAAGTCAG

1

Clone 5

AATTAAACTACCTGCTCACCCAAAAAGTGCAAGCTCACTACACTAATCCT

1

Clone 6

CAGCCGAGCCAGAACCCAGCAGAATAAACGCACGATACCTTACTCTGTGA

1

Clone 7* Clone 8

AATCCACGTATCGACTAGCTCAAACCAGCCTGATAGAGCCATTCGCTTTA GAACAATCATAAGGACAGAGCTCACACTTCGGGCTGCCACGGAATTCAGC

5 1

Clone 9*

GACTATCTGCACGGGCATTCAACC

1

Clone 10

TACCACTCGAGTCCTTAGCCACAGAGAATCCAGTCGCTGCGAGATCACGT

1

Clone 11

ATATTTACAAAGGATCCCATGATGCCAATTCCACGCATCGTGACTCTCC

1

Clone 12

AAATCAACACGAGCGATCCCAAGACACCGCCATCCGAATCCAAAGGATGT

1

Clone 13

TAGCCGACTTGAACCCCAGAGTACTTCTGCTGCACTAATCCCGATGTGTA

1 2

Clone 14

GAAATTCAAAGGGCAAAGCTATCCAGCAGAACTAGCGCGTGGATCTACAT

Clone 15*

AAAGTAGCTCCAACCCGCCAGAGTAATCAGTTACGGCGAAACTAACGCGC

3

Clone 16

TTGTATCTGTCAATCAACAGCAGGTACGCATCCGAGGCACCCGCGCATAG

1

Clone 17

AAACTCAAGACCAAGCTCAACCTAACAGAGCAACTCAAAATCCAACGAGT

2

Clone 18

GATGATCCAAAGGTACTATAAAGAGCACCAGCAAAGTTTGTGATC

1

Clone 19

AAATATTCTAGCGCCGACTCACCTTCAGACAAACCGCGTAATCCCAGACG

1

Clone 20

ATTCAAGTATGCGAGCAACCCCAATCAGAAGCGCGCACGAATTAATTCAT

1

Clone 21

TTAATCCTACAAGTTGCCGAGTACCCACCAGAGCACTACAGCAATCTAG

2

Clone 22 Clone 23

AATCAGAACGATGCCGAGCCCCAAAGAGCTAAGCGGTCCAACTAAACAGC TTGAGCCCAATCAAAATGGCCAAGACAATTTCTAACAACCGAGCGCACCT

1 2

Clone 24

AAAACCCACCGTACACCAGTTCGCCTACCACACACGGACAAATTCCCGTC

1

Clone 25

TAGAATCTCCGACAAATCCAACGCCGGGGAAACGAGCTCACCAACGAAAC

1

Clone 26

AAATTCCAACGTACTGAGCAAACTCAAGCAGCCTTAACTAACAACCCCAG

1

Clone 27

TAAACTCTCATACGGAGCTCACCCAGTGATTCAGAGAACGTGCTAACCAAACTCAAC

1 1

Clone 28

AAATTCAGATTACCGACTCACCCAATCACCAACGAACTCAAATAGGTGAA

Clone 29

AGTATGCAACGTGCCTATGTATTCACCAATCTGCACATTGCGCAGACTTC

1

Clone 30

TAAAAAATCAAGTACCTGCAACTCTAACCCGGCCGACCTCGCTACTCTATT

1

The frequency of the sequence is shown to the right. Clone 9 has a shorter than expected random region. Clones used in further studies are marked with an asterisk

RNA Aptamers Bind to PE to Form a Slow Migrating Complex in an Electromobility Shift Assay To analyze the 20 F-RNA/PE interaction, complexes containing [32P]-labeled 20 F-RNA were resolved on native polyacrylamide gels, designated EMSA. Two negative controls were included, pool 0 (naı¨ve library) and the unrelated 90-nt aptamer d12, which was isolated in a previous study with an unrelated target protein [26]. The initial EMSA run with SELEX pools 8 and 14 was performed without the presence of non-specific competitor oligonucleotides (ssDNA). Interestingly, at PE concentrations of 1.1 lM (0.8 lg) the majority of labeled 20 F-RNA could not be detected in the gels, neither as free probe nor aggregated with protein in the loading wells (data not shown). Only a

123

weak new band of a slower migrating 20 F-RNA was present on the native gel. However, when competing with 25- to 30-fold excess of non-labeled 20 F-RNA from pools 8 and 14 labeled 20 F-RNA migrated with the front similar to when PE was not present (data not shown). Individual selected aptamers were thereafter tested in the presence of non-specific competitor (ssDNA). The 20 F-RNA molecules (aptamers) generated from transcription of individual clones are for future reference named on basis of their respective clone number. The 20 F-RNA of clone 1 formed a RNA/PE complex at a lower concentration than clone 15, indicating a stronger binding (Fig. 3a). To investigate whether the formed complex was specific, an attempt to compete with an excess of cold 20 F-RNA was performed. With a 25- to 30-fold excess of cold competitor from the

Mol Biotechnol

Fig. 2 Predicted structures of the five clones (1, 2, 7, 9, and 15) that were used for further studies. The mfold predicted structure and the respective DG values (kcal/mol) of each clone are shown. The semiconserved 7-nt MEME motif (E = 0.084) found in all 30

sequences is shown for the 5 selected aptamers with their respective p values and position within the aptamer. The sequence identified as a common motif in MEME is highlighted within the predicted structures of the 5 clones

same aptamer the labeled complexes of both clone 1 and 15 were essentially abolished (Fig. 3a). In Fig. 3b the generation of a labeled RNA/PE complex was competed by a 17to 20-fold molar excess of either cold 20 F-RNA from the same clone or with another clone. It is not clear why nonlabeled clone 1 has a limited effect on competing out labeled clone 1 while clone 15 can compete out essentially all labeled clone 15. However, non-labeled 20 F-RNA of clone 15 did not have a strong effect as a competitor of clone 1 while non-labeled clone 1 competed out essentially all labeled clone 15. We suggest that clone 1 binds to the

same epitope and with higher affinity compared to clone 15 but not vice versa. This result suggested that clone 1 binds with substantially higher affinity as compared to clone 15. EMSA was also performed with clone 7, which was the most abundant aptamer found among the sequenced clones (Fig. 3b). This aptamer did not form a clear RNA/PE complex upon addition of protein. Instead a long ‘‘smear’’ was seen along the sides of that lane. This feature was observed for several other clones tested (data not shown). 20 F-RNA from d12 (unrelated aptamer not selected on PE) exhibited a double band when run on an EMSA gel

123

Mol Biotechnol

a

a

PE

PE Clone 15

Clone 1

Buffer (40 mM Tris-HCl+ NaCl in mM)

Protein E (nM)

100

150

100

300

300

150

300

300

300

PBS+150 mM NaCl

800

Clones

b Clone 1

Clone 7

b

Clone 15

Tris-HCl+150 mM NaCl

C1 C2

C7 C15

d12

Protein E in nM (Protein/RNA ratio)

15 (1/1)

50 (3.3/1)

150 (10/1)

455 (30/1)

PE Comp. -

+

+

-

C1

+

-

+

-

+

+

+

C15 -

-

-

-

C15

C1

Fig. 3 Electromobility shift gel assay (EMSA). a EMSA gels of clone 1 and clone 15. Samples (volume 23 ll) were run on 7 % native polyacrylamide gels at 90 V. [32P]-labeled 20 F-RNA (12 ng; 20 nM) was incubated with 0-600 ng of PE corresponding to 0, 53, 133, 407, and 815 nM. Lane 6 is empty to avoid spillover. The last lane (star) shows the competition with 300 ng (500 nM) cold 20 F-RNA from the same clone using 407 nM PE. b EMSA gels of individual SELEX clones. Between 8 and 15 ng [32P]-labeled 20 F-RNA was incubated with 480 ng (0.65 lM) protein E. Competition with 240 ng cold 20 FRNA from either clone 1 or clone 15 is indicated (17- to 20-fold excess)

(Fig. 3b), whereas only one band was seen under conditions when samples were mixed with denaturing loading buffer and run on 8 M urea PAGE gels. 20 F-RNA from Pool 0 also gave rise to a double band on EMSA gels, but only a single band on denaturing urea gels (data not shown). No shifted bands were observed for clone d12. RNA Aptamers Binding to PE was Confirmed by a Nitrocellulose Filter Assay Since the EMSA experiments were partially difficult to quantitatively evaluate, dot blots were performed. Binding of 20 F-RNA from selected clones to recombinant PE was monitored using a nitrocellulose filter assay. The binding of 50 nM labeled 20 F-RNA of clones 1, 2, 7, and 15 was performed with varying concentrations of PE (Fig. 4a). All tested selected aptamers showed increased binding in comparison to the negative control d12. RNA aptamers

123

Clones C1

C2

C7

C15

d12

Fig. 4 Nitrocellulose filter binding. Labeled RNA is captured on the nitrocellulose filter when bound to PE. a Varying concentrations of purified PE (100–800 nM) was incubated with *150 ng (50 nM) [32P]-labeled 20 F-RNA of clones 1, 2, 7, and 15 with 85 lg/ml ssDNA in either PBS or Tris–HCl buffer with salt concentrations as indicated in the figure. RNA molecule d12 is a negative control not selected on PE. b Varying concentrations of purified PE (15–455 nM) was incubated with *50 ng (15 nM) [32P]-labeled 20 F-RNA of clones 1, 2, 7, and 15 in Tris–HCl buffer with 165 mM NaCl. Values within brackets represent the RNA/protein ratio

interacted with PE in a dose-dependent manner, as increasing the concentration of PE resulted in an enhanced signal intensity. A clear effect of the salt concentration on the binding was observed. Increasing the NaCl concentration from 150 to 300 mM, at a constant PE concentration (300 nM), showed a dramatic decrease in the PE–RNA interaction. In addition, the PE–RNA interaction was influenced by different buffers. As observed, binding of PE– RNA was higher in PBS in comparison to Tris–HCl buffer. The buffer effect was also seen for the negative control 20 FRNA (d12). Hence, more unspecific binding might also be expected with PBS than with the Tris–HCl buffer. At the lowest PE concentration, clones 2 and 7 showed slightly stronger binding than clones 1 and 15. When the concentration of 20 F-RNA was decreased to 15 nM (50 ng), a similar result was observed (Fig. 4b). A weak binding could be observed at 50 nM PE, but not at the lowest concentration that was used (15 nM PE). In order to clearly observe binding, the PE concentrations were increased to 150 nM, which corresponded to a PE:RNA ratio of 10:1.

Mol Biotechnol

Analysis of RNA Aptamer Binding to PE Using Surface Plasmon Resonance

a

0

1.6

33 nM

66 nM

165 nM

n.s. n.s.

Selected 20 F-RNA aptamers were tested for their ability to inhibit the PE interaction with vitronectin. Recombinant PE was coated onto ELISA plates and 20 F-RNA from different clones was added. After incubation with 20 F-RNA and several washes, vitronectin was added and bound vitronectin was detected using anti-vitronectin antibodies. The results of the experiment are shown in Fig. 5a. Clones 1 and 15 did not inhibit the vitronectin–PE interaction, whereas clone 2, 7, and 9 inhibited vitronectin binding by approximately 30 % compared to the non-treated samples. The effect was seen already at 33 nM of aptamers and a higher concentration (165 nM) did not lead to increased levels of inhibition. Heparin was used as a positive control since it is known to bind and block the PE-binding site of vitronectin [13, 27]. Vitronectin preincubated with heparin (1.7 lM) inhibited the binding of PE by *65 %. The outcome of the ELISA experiment was encouraging as it showed that the RNA aptamers not only bound to PE as shown in the previous experiments but also had the potential to reduce the binding of vitronectin to PE. RNA Aptamers at Nanomolar Concentrations Inhibit the Binding of Vitronectin to H. influenzae To test whether the 20 F-RNA aptamers that inhibited the PE/vitronectin binding also had the capacity to inhibit vitronectin binding to non-typeable H. influenzae, the clinical isolate NTHi3655 was incubated with various concentrations of 20 F-RNA aptamer prior to addition of [125I]-labeled vitronectin. The results of this experiment are presented as

***

** ***

***

0.8

***

* ** ***

0.6

***

Binding of vitronectin

1

0.4

0

b

Epithelial RNA

Clone 2

20

Clone 7

Clone 9

18 16

H. influenzae (%)

RNA Aptamers Inhibit PE from Interacting with Its Natural Ligand Vitronectin

1.2

0.2

[ 125 I]-Vnbinding to

The sensorgrams obtained from injecting 150 ll of 400 nM aptamer on PE that was immobilized on the CM5 sensor chip can be viewed in Fig. S2. As seen on the sensorgram, it is difficult to establish at which time point the association starts in relation to the immediate jump in resonance units the injected sample gives rise to. It is apparent that different clones give a different response upon injection. The initial association and dissociation were fitted to a twophase non-linear regression since one-phase regression showed very poor fitting with the experimental data even though the time was extended to 800 s. The extracted rates and calculated kon and KD of the initial fast rates of the twophase non-linear regression can be viewed in Table S2. It is evident from Table S2 that clone 7 binds with a slightly higher affinity when compared to the other clones tested, as indicated by the calculated KD value of *70 nM.

(Absorbance at 450 nm)

1.4

14 12 10 8 6 4 2 0

0

100

200

300

400

500

RNA aptamers (ng)

Fig. 5 Inhibition of the vitronectin–PE interaction. a ELISA plates were coated with 200 ng (63 nM) PE and incubated with 0, 0.1, 0.2, and 0.5 lg (33–167 nM) of 20 F-RNA of clones 1, 2, 7, 9, and 15 (in PBS-Tween 20) to block the binding of vitronectin to PE. The last two columns show the addition of 1 lg (0.85 lM) or 2 lg (1.7 lM) heparin in the vitronectin sample before it was incubated with PE to block the PE-binding site of vitronectin. The Y axis displays the OD450 absorbance of the ELISA using vitronectin-specific antibodies. b Surface binding of [125I]-labeled vitronectin to the H. influenzae strain NTHi3655 (107 bacteria) preincubated with 50–500 ng RNA from clones 2, 7, and 9 (16.7–167 nM) and total RNA from human epithelial cells. Cells were thereafter incubated with 50,000 cpm [125I]-labeled vitronectin. Cells were washed and bound vitronectin was determined by scintillation count. For a and b, all measurements were performed in triplicates and error bars indicated standard deviations. The P values indicated in A are, *P B 0.05; **P B 0.01, and ***P B 0.001, respectively. Ns not significant

dose–response curves in Fig. 5b. The three aptamers of clones 2, 7, and 9 inhibited vitronectin binding from approximately 17–18 % for the non-treated cells down to approximately 8 % for bacteria preincubated with 16.7 nM (50 ng) of the 20 F-RNA aptamers. Further increasing the concentrations of aptamers to 167 nM (500 ng) for clones 2 and 9 reduced vitronectin binding down to 4 %, whereas clone 7 only had a minor effect. To test whether the inhibition was specific for the selected 20 F-RNA aptamers, total RNA from epithelial cells was added in the nanogram range, the same concentration as used with the selected

123

Mol Biotechnol

aptamers. Preincubation with up to 200 ng epithelial RNA showed only a minor inhibition of vitronectin binding to PE further demonstrating the specificity of the aptamer binding.

Discussion Aptamers have been successfully selected against viral, protozoan, and bacterial surface proteins as well as against secreted proteins [26, 28–31]. In this paper, we isolated modified RNA molecules that bind to PE that is located at the surface of non-typeable H. influenzae. Binding of these RNA molecules prevented PE-dependent binding to vitronectin. The 20 F-RNA molecules were isolated through 14 selection rounds using purified recombinant PE as bait in the SELEX method. No large increase in recovery was observed in late rounds using 100 nM PE as bait, indicating that additional rounds of selection would most likely not improve the outcome of selection. The presence of a significant fraction of identical (25 %) aptamers corresponding to the sequenced clones shows that the initial starting pool of *1014 RNA molecules had during the selection been decreased to a pool containing a much smaller number of unique RNAs. Nevertheless, a large variation was seen and grouping of clones into specific groups was, therefore, not obvious. Analyses of the random regions of the aptamers in the final pool revealed a consensus MEME motif of 7 nucleotides that according to mfold predictions was located in loop regions of the secondary structures of the 20 F-RNA aptamers (Fig. 2). This indicates that the motif was directly involved in the interaction with PE. The mobility shift experiments suggested a variance in binding affinity between clones. Clone 1 showed a stronger ability to compete with clone 15 for binding to PE than the ability of clone 15 to outcompete clone 1 (Fig. 3b). This could be due to stronger binding of clone 1 as it formed a complex at lower PE concentrations as compared to clone 15 (Fig. 3a). However, some RNA aptamers did not give rise to defined slower migrating complexes but instead formed smears along the edges of the lanes. This could be due to dissociation of the complexes during the gel run. Compared to the results from the EMSA experiments the results from the nitrocellulose filter assays were much easier to quantitatively interpret. This experiment demonstrates that the aptamers corresponding to clones 2 and 7, which mainly gave smears on the EMSA gels, bound well to PE on nitrocellulose. In some regards their binding was slightly better than clone 1 and much better as compared to clone 15. The Biacore experiments were performed with PE coupled to a CM5 chip using amine coupling. The approach might not be considered optimal since PE on the chip can be positioned in various orientations with some orientations

123

blocking the RNA-binding site. The RNA aptamer is of a similar size as PE on the chip, so steric hindrance might be an important factor. Extrapolation of data from the Biacore experiments was not straightforward as the initial kobs and koff rates were fast and response data collected during extended association and dissociation phases of 800 s would not fit well to a one-phase non-linear regression. Hence a two-phase non-linear regression was applied and only the initial fast rates were used in our calculations. The results from the Biacore experiments support the data from the nitrocellulose dot blots and display rates and KD values in the same range as Biacore values reported by Hwang and Nishikawa [32]. The experiments show that clone 7 has a higher affinity toward PE than the other clones. The conclusion is that the selected aptamers bind to PE rather fast but are not bound strongly due to large koff values. Lastly, a small baseline drift was observed during the course of the Biacore experiment. As PE is proposed to be a dimer under native conditions a small degree of PE dissociation to a monomeric form can be expected during the run. Whether the aptamers bind to monomeric PE or dimeric PE was not established. The binding of RNA aptamers to PE decreased with increasing salt concentration, demonstrating that ionic interactions may be crucial for PE–aptamer interaction (Fig. 4a). It was also observed that the use of Tris buffer resulted in a lower binding between PE and 20 F-RNA aptamers than when PBS was used as buffer. The difference could be due to the change in pH, since the PBS buffer (pH 7.4) is slightly more acidic than the Tris buffer (pH 7.9). At higher pH the net positive charge of PE will decrease and might result in a loss of some electrostatic interactions between PE and the negatively charged 20 F-RNA. The presence of non-specific charge interactions could be responsible for the binding seen for control molecules such as the control d12 (Fig. 4a). In hindsight, the use of a positively charged protein as a target for a selection using a library of negatively charged molecules such as oligonucleotides could putatively identify interactions between molecules that rely on electrostatic binding. It is possible that an even higher salt concentration, in excess of the 300 mM that was used during the selection, might have been beneficial in order to further decrease charge-based interactions. Increasing salt concentration in the SELEX procedure has in some cases been used for selection with positively charged proteins in order to decrease non-specific charge interactions. Even though many selection cycles were performed, and a bias toward stable RNA molecules could be detected, the bias for pyrimidines versus purines as reported by Thiel and co-workers [33] was not seen for our sequenced clones. Moreover, the loss of adenine in their studies was not observed in our data sets. The aptamer displaying the best affinity, clone 7, had a KD value of 70 nM (Table S2). We do not regard a KD of

Mol Biotechnol

70 nM to be a high affinity value. The other isolated aptamers had slightly lower affinities than clone 7 and hence our findings in the EMSA experiments and the dot blots are not surprising. With KD values in the low nanomolar range (1–40 nM) found in some other studies [34, 35], a lower ratio of protein to aptamer is typically expected. The aptamers that showed strongest binding in the nitrocellulose filter-binding assays (clones 2 and 7) also inhibited binding of PE to vitronectin, whereas clones such as clones 1 and 15 did not have any effect. Whether this is caused by a difference in affinity between aptamers or is due to the binding site of the aptamers in relation to the vitronectin binding site on PE was not investigated in this study. A * 30 % inhibition of vitronectin binding was seen for a 1:1 concentration of PE to 20 F-RNA aptamer. Higher concentrations of the RNA aptamers did not lead to higher levels of inhibition (Fig. 5a). The reason for this and for the relatively limited inhibition (ca 30 %) could be that aptamers are only partially blocking the vitronectin-binding region in PE, and thus a complete inhibition is not anticipated. Heparin, which is known to block PE–Vn interaction, was used a positive control. In the ELISA experiment (Fig. 5a), heparin (0.85 lM) blocked PE–Vn interaction by 50–60 %. Interestingly, at the bacterial surface a low nanomolar concentration (16.7 nM) of the selected aptamers inhibited vitronectin binding to the surface of NTHi (Fig. 5b). Residual binding is expected to be due to other Vn-binding proteins of H. influenzae [11, 36]. The epithelial RNA used as a negative control also showed partial inhibition of vitronectin interacting with bacterial cells, but only at higher concentrations. Putatively, this might be due to certain dominating rRNA fragments with tertiary structure that could bind to bacterial proteins and block the vitronectin interaction. The sheared epithelial RNA may not be the optimal control since these RNA molecules are not 20 F modified and since the size range is somewhat larger (100–300 nt) than the aptamers used in this study (90 nt). Earlier work has shown the KD of vitronectin/PE binding to be *0.4 lM [12]. Thus, the isolated aptamers identified in this study are likely to have KD values in the same range or lower, as they have the ability to block the vitronectin binding to PE. This is also consistent with the KD values estimated in the Biacore experiments. A future use of the aptamers could be therapeutic in order to prevent bacterial colonization. For such a use, high-affinity interaction between target protein and aptamer is indispensable. The next obvious step would, therefore, be to map the binding sites for the RNA aptamers on PE. We recently solved the structure of PE by X-ray crystallography [8, 9] and this should help discerning the interacting site of PE that is responsible for binding a specific aptamer. With this additional knowledge a process of aptamer lead optimization should be feasible.

Acknowledgments This work was supported by the Swedish Research Council (VR; grant number 521-2010-4221, www.vr.se), the Research Council Formas, the Research School in Pharmaceutical ¨ K), the Swedish Medical Research Council, the Alfred Sciences (FLA ¨ sterlund, the Anna and Edwin Berger, Anna-Lisa and Sven-Erik O Lundgren, Greta and Johan Kock, the Physiographical Society, the Cancer Foundation at the University Hospital in Malmo¨, and Ska˚ne County Council0 s research and development foundation.

References 1. Morris, S. K., Moss, W. J., & Halsey, N. (2008). Haemophilus influenzae type b conjugate vaccine use and effectiveness. The Lancet Infectious Diseases, 8, 435–443. 2. Yamanaka, N., Hotomi, M., & Billal, D. S. (2008). Clinical bacteriology and immunology in acute otitis media in children. Journal of Infection and Chemotherapy, 14, 180–187. 3. Murphy, T. F. (2009). Current and future prospects for a vaccine for nontypeable Haemophilus influenzae. Current Infectious Disease Reports, 11, 177–182. 4. Fink, D. L., Green, B. A., & St Geme, J. W., 3rd. (2002). The Haemophilus influenzae Hap autotransporter binds to fibronectin, laminin, and collagen IV. Infection and Immunity, 70, 4902–4907. 5. St Geme, J. W., 3rd. (1994). The HMW1 adhesin of nontypeable Haemophilus influenzae recognizes sialylated glycoprotein receptors on cultured human epithelial cells. Infection and Immunity, 62, 3881–3889. 6. Hallstrom, T., Trajkovska, E., Forsgren, A., & Riesbeck, K. (2006). Haemophilus influenzae surface fibrils contribute to serum resistance by interacting with vitronectin. Journal of Immunology, 177, 430–436. 7. Ronander, E., Brant, M., Eriksson, E., Morgelin, M., Hallgren, O., et al. (2009). Nontypeable Haemophilus influenzae adhesin protein E: characterization and biological activity. Journal of Infectious Diseases, 199, 522–531. 8. Singh, B., Al-Jubair, T., Morgelin, M., Thunnissen, M. M., & Riesbeck, K. (2013). The unique structure of Haemophilus influenzae Protein E reveals multiple binding sites for host factors. Infection and Immunity, 81, 801–814. 9. Singh, B., Al Jubair, T., Fornvik, K., Thunnissen, M. M., & Riesbeck, K. (2012). Crystallization and X-ray diffraction analysis of a novel surface-adhesin protein: protein E from Haemophilus influenzae. Acta Crystallographica, Section F, 68, 222–226. 10. Singh, B., Blom, A. M., Unal, C., Nilson, B., Morgelin, M., et al. (2010). Vitronectin binds to the head region of Moraxella catarrhalis ubiquitous surface protein A2 and confers complementinhibitory activity. Molecular Microbiology, 75, 1426–1444. 11. Singh, B., Jalalvand, F., Morgelin, M., Zipfel, P., Blom, A. M., et al. (2011). Haemophilus influenzae protein E recognizes the C-terminal domain of vitronectin and modulates the membrane attack complex. Molecular Microbiology, 81, 80–98. 12. Hallstrom, T., Blom, A. M., Zipfel, P. F., & Riesbeck, K. (2009). Nontypeable Haemophilus influenzae protein E binds vitronectin and is important for serum resistance. Journal of Immunology, 183, 2593–2601. 13. Singh, B., Su, Y. C., & Riesbeck, K. (2010). Vitronectin in bacterial pathogenesis: A host protein used in complement escape and cellular invasion. Molecular Microbiology, 78, 545–560. 14. Hallstrom, T., Singh, B., Resman, F., Blom, A. M., Morgelin, M., et al. (2011). Haemophilus influenzae protein E binds to the extracellular matrix by concurrently interacting with laminin and vitronectin. Journal of Infectious Diseases, 204, 1065–1074.

123

Mol Biotechnol 15. Bunka, D. H., & Stockley, P. G. (2006). Aptamers come of age— At last. Nature Reviews Microbiology, 4, 588–596. 16. Tuerk, C., & Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 249, 505–510. 17. Ellington, A. D., & Szostak, J. W. (1990). In vitro selection of RNA molecules that bind specific ligands. Nature, 346, 818–822. 18. Gopinath, S. C., Sakamaki, Y., Kawasaki, K., & Kumar, P. K. (2006). An efficient RNA aptamer against human influenza B virus hemagglutinin. Journal of Biochemistry, 139, 837–846. 19. Woo, H. M., Kim, K. S., Lee, J. M., Shim, H. S., Cho, S. J., et al. (2013). Single-stranded DNA aptamer that specifically binds to the influenza virus NS1 protein suppresses interferon antagonism. Antiviral Research, 100, 337–345. 20. Nimjee, S. M., Rusconi, C. P., & Sullenger, B. A. (2005). Aptamers: An emerging class of therapeutics. Annual Review of Medicine, 56, 555–583. 21. Grundy, W. N., Bailey, T. L., Elkan, C. P., & Baker, M. E. (1997). Meta-MEME: motif-based hidden Markov models of protein families. Computer Applications in the Biosciences, 13, 397–406. 22. Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research, 31, 3406–3415. 23. Hunter, R. (1970). Standardization of the chloramine-T method of protein iodination. Proceedings of the Society for Experimental Biology and Medicine, 133, 989–992. 24. Ronander, E., Brant, M., Janson, H., Sheldon, J., Forsgren, A., et al. (2008). Identification of a novel Haemophilus influenzae protein important for adhesion to epithelial cells. Microbes and Infection, 10, 87–96. 25. Eulberg, D., Buchner, K., Maasch, C., & Klussmann, S. (2005). Development of an automated in vitro selection protocol to obtain RNA-based aptamers: identification of a biostable substance P antagonist. Nucleic Acids Research, 33, e45. 26. Barfod, A., Persson, T., & Lindh, J. (2009). In vitro selection of RNA aptamers against a conserved region of the Plasmodium falciparum erythrocyte membrane protein 1. Parasitology Research, 105, 1557–1566.

123

27. Liang, O. D., Rosenblatt, S., Chhatwal, G. S., & Preissner, K. T. (1997). Identification of novel heparin-binding domains of vitronectin. FEBS Letters, 407, 169–172. 28. Ulrich, H., Magdesian, M. H., Alves, M. J., & Colli, W. (2002). In vitro selection of RNA aptamers that bind to cell adhesion receptors of Trypanosoma cruzi and inhibit cell invasion. Journal of Biological Chemistry, 277, 20756–20762. 29. Sayer, N., Ibrahim, J., Turner, K., Tahiri-Alaoui, A., & James, W. (2002). Structural characterization of a 20 F-RNA aptamer that binds a HIV-1 SU glycoprotein, gp120. Biochemical and Biophysical Research Communications, 293, 924–931. 30. Pan, Q., Zhang, X. L., Wu, H. Y., He, P. W., Wang, F., et al. (2005). Aptamers that preferentially bind type IVB pili and inhibit human monocytic-cell invasion by Salmonella enterica serovartyphi. Antimicrobial Agents and Chemotherapy, 49, 4052–4060. 31. Choi, J. S., Kim, S. G., Lahousse, M., Park, H. Y., Park, H. C., et al. (2011). Screening and characterization of high-affinity ssDNA aptamers against anthrax protective antigen. Journal of Biomolecular Screening, 16, 266–271. 32. Hwang, J., & Nishikawa, S. (2006). Novel approach to analyzing RNA aptamer-protein interactions: toward further applications of aptamers. Journal of Biomolecular Screening, 11, 599–605. 33. Thiel, W. H., Bair, T., Wyatt Thiel, K., Dassie, J. P., Rockey, W. M., et al. (2011). Nucleotide bias observed with a short SELEX RNA aptamer library. Nucleic Acid Therapeutics, 21, 253–263. 34. Lee, J. H., Kim, H., Ko, J., & Lee, Y. (2002). Interaction of C5 protein with RNA aptamers selected by SELEX. Nucleic Acids Research, 30, 5360–5368. 35. Kim, M. Y., & Jeong, S. (2004). Inhibition of the functions of the nucleocapsid protein of human immunodeficiency virus-1 by an RNA aptamer. Biochemical and biophysical research communications, 320, 1181–1186. 36. Su, Y. C., Jalalvand, F., Morgelin, M., Blom, A. M., Singh, B., et al. (2013). Haemophilus influenzae acquires vitronectin via the ubiquitous Protein F to subvert host innate immunity. Molecular Microbiology, 87, 1245–1266.