Arch Virol DOI 10.1007/s00705-014-2054-y

ORIGINAL ARTICLE

In vitro and in vivo protection against enterovirus 71 by an antisense phosphorothioate oligonucleotide Juan Liu • Zhe Zhou • Kang Li • Mingming Han Jing Yang • Shengqi Wang

•

Received: 18 August 2013 / Accepted: 10 March 2014 Ó Springer-Verlag Wien 2014

Abstract Enterovirus 71 (EV71) is a highly infectious virus that is a major cause of hand, foot, and mouth disease (HFMD), which can lead to severe neurological complications. Currently, there is no effective therapy against EV71. Five antisense oligodeoxynucleotides targeting the 50 -terminal conserved domain of the viral genome were designed using a method based on multiple predicted target mRNA structures. They were then screened for anti-EV71 activity in vitro based on their ability to inhibit an EV71induced cytopathic effect (CPE). A novel antisense oligonucleotide (EV5) was tested both in rhabdomyosarcoma (RD) cells and in vivo using a mouse model, with a random oligonucleotide (EV5R) of EV5 as a control. EV5 was identified as having significant anti-EV71 activity in vitro and in vivo without significant cytotoxicity. Treatment of RD and Vero cells with antisense oligodeoxynucleotide EV5 significantly and specifically alleviated the cytopathic effect of EV71 in vitro. The inhibitory effect was dose

J. Liu and Z. Zhou contributed equally to the work. J. Liu  Z. Zhou  K. Li  M. Han  J. Yang (&)  S. Wang (&) Beijing Institute of Radiation Medicine, Beijing Key Laboratory of New Molecular Diagnosis Technologies for Infectious Diseases, 27 Taiping Road, Haidian District, Beijing 100850, People’s Republic of China e-mail: [email protected] S. Wang e-mail: [email protected] J. Liu  K. Li Beijing University of Technology, Beijing 100124, People’s Republic of China S. Wang Henan University of Traditional Chinese Medicine, Zhengzhou 450008, People’s Republic of China

dependent and specific, with a corresponding decrease in viral RNA and viral protein levels. In vivo, EV5 was specifically effective against EV71 virus in preventing death, decreasing weight reduction and reducing the viral RNA copy number and the level of viral proteins in the lungs, intestines and muscles. These results demonstrate the potential and feasibility of using antisense oligodeoxynucleotides specific for the 50 -terminal conserved domain of the viral genome as an antiviral therapy for EV71 disease.

Introduction Enterovirus 71 (EV71) is a small nonenveloped virus with a single-stranded positive RNA genome of approximately 7,500 nucleotides (nt) [1]. It belongs to the family Picornaviridae, genus Enterovirus, and species Enterovirus A [2, 3]. EV71 infection is a threat to public health and frequently causes epidemics. It was first characterized in neurological disease cases in California in 1969. Since then, epidemics and pandemics have been reported periodically worldwide. Notably, the number of EV71 outbreaks in the Asia-Pacific region has increased significantly since 1997 [4]. Large outbreaks have occurred in Fuyang, China, in 2008 [5]; Singapore in 2008 [6]; and Guangdong, China, in 2009 [7]. Typically, EV71 infection causes hand, foot, and mouth disease and herpangina. Serious pathological conditions, including aseptic meningitis, encephalitis, and pulmonary edema, have been reported in some cases [8–11], and severe neurological complications may lead to rapid clinical deterioration and death in children [12, 13]. EV71 has caused significant mortality worldwide in recent years [4]. Antiviral agents, such as enviroxime [14], pleconaril [15], and 3C protease inhibitors [16], have been developed and used for

123

J. Liu et al.

treating enterovirus infections and have shown efficacy against the neurotropic EV71. However, there is currently no effective antienteroviral therapy. Antisense oligodeoxynucleotides (ASODNs) are short, single-stranded deoxyribonucleotide oligomers (*20 nucleotides) with a nucleotide sequence designed to be complementary to specific mRNA transcripts. They induce catalytic degradation of target mRNA by RNase H and/or by forming a stable DNA-RNA duplex and a special local structure that may hinder RNase H cleavage activity, resulting in blockage of protein translation [17, 18]. Since the United States Food and Drug Administration (FDA) approved the first antisense drug, Vitravene, for the treatment of cytomegalovirus (CMV) retinitis in 1998 [19], more than 30 types of ASODNs have been evaluated in clinical trials [20]. For antiviral therapy, previous studies have shown that ASODNs can inhibit various viral pathogens such as flaviviruses [21], hepatitis B virus [22], coxsackie B3 virus [23], and influenza A virus [24, 25] by interactions with essential viral genes [26]. AVI BioPharma has developed an antisense treatment that rescued penguins infected with West Nile virus in 3 days after ASODN treatment at the Milwaukee County Zoo [27]. Recently, the US Defense Threat Reduction Agency and the US Department of Defense invested hundreds of millions of US dollars in the development of antisense drugs in response to disease outbreaks, including bioterrorism threats such as infections with Junin, influenza, dengue, Ebola, and Marburg virus infections [20]. Designing and searching for effective ASODN sequences for antisense treatment is challenging. We used a method developed in our laboratory based on multiple predicted target mRNA structures [28] and designed five ASODNs targeting the 50 -terminal conserved sequence found in EV71 RNA. Through screening for inhibition of virus-induced CPE, we identified an effective ASODN, which we refer to as EV5. Next, we investigated the antiviral activities of EV5 both in vitro and in vivo. Our results showed that EV5 exhibits therapeutic efficacy in cell culture and in an EV71 infection mouse model.

Materials and methods Cells, virus, and mice Rhabdomyosarcoma (RD) and Vero cells, frequently used to isolate EV71 from clinical specimens, are highly susceptible to EV71 [29]. They were routinely grown in Dulbecco’s Modified Eagle Medium High Glucose 1 9 (DMEM, Gibco, Grand Island, NY, USA) supplemented with 10 % fetal calf serum (FCS). The EV71 BrCr strain was propagated in RD cells and titrated in a 50 % tissue culture infective dose (TCID50) assay. Specific-pathogen-free 7-day-old ICR mice

123

were used to assay antiviral activity in vivo. 7-day-old ICR mice were purchased from the Experimental Animal Center of the Chinese Academy of Medical Sciences (Beijing, China) and were housed in microisolator cages and provided autoclaved water and chow ad libitum. All animal work was approved by the IACUC/ethics committee at the Experimental Animal Center of the Chinese Academy of Medical Sciences (Beijing, China) (approval number: SCXK-2007004) and conformed to the National Institutes of Health Guide for Care and Use of Laboratory Animals (publication no. 85–23, revised in 1985). Oligonucleotides and compounds Oligonucleotides, including EV1-EV5 (20-mer antisense phosphorothioate oligodeoxynucleotides), EV5S (sense phosphorothioate oligodeoxynucleotide of EV5 used as a control), and EV5R (scrambled sequence of EV5 used as a control), were synthesized using an ABI3900 nucleic acid synthesis system for in vitro experiments (Applied Bio¨ KTA oligopilot II for systems, Foster City, CA, USA) or A in vivo experiments (Amersham Pharmacia Biotech, Uppsala, Sweden) and purified using an oligonucleotide purification cartridge (OPC, Perkin-Elmer, Waltham, MA, USA). All of the DNA sequences of the oligonucleotides and their target sites are listed in Table 1. ASODN treatment and infection of cells in tissue culture RD cells (8–10 9 103) or Vero cells (10–12 9 103) were seeded into a 96-well plate. Twenty-four hours later, to test the prophylactic activity of EV5, the cell medium was replaced by a maintenance medium containing 2 % FCS together with a serial twofold dilution of oligonucleotide EV5 from at 0.25 lM to 2 lM and 2 lM EV5R. One hour later, cells were infected with EV71 at a multiplicity of infection (MOI) of 1, with oligonucleotides in the medium. After 1 h, the medium was replaced with a maintenance medium containing 2 % FCS and a serial dilution of oligonucleotides. For evaluation of the therapeutic effect, the cells were infected with EV71 for 1 h, and the medium was then replaced by a maintenance medium containing 2 % FCS and a serial of dilution of oligonucleotide EV5. Ribavirin was used as a positive drug control. Forty-eight hours later, the cells were observed for virus-induced cytopathic effect (CPE), and the supernatants were collected for detection of EV71 RNA. Cell proliferation and viability assay Pathological changes in cells infected with EV71 were observed using an inverted microscope (Olympus CKX41).

Antisense oligonucleotide against enterovirus 71 Table 1 The sequences of the oligonucleiotides and their target locations

Code

Sequence(50 –30 )

Target location

EV1

GTAGTCGGTTCCGCTGCAGA

530–549

0.20 ± 0.18

EV2

ATTCAGGGGCCGGAGGACTA

445–464

74.42 ± 5.14

EV3

TGCACACCGGATGGCCAATC

630–649

-0.24 ± 0.63

[2

EV4

GCCGCATTCAGGGGCCGGAG

450–469

30.11 ± 4.97

[2

EV5

GATTAGCCGCATTCAGGGGC

455–474

93.32 ± 3.12

EV5S

GCCCCTGAATGCGGCTAATC

EV5R

CTGGCGGAGATATGCCGACT

Cell viability was tested using a Cell Counting Kit-8 (CCK-8, Dojindo Laboratories, Kumamoto, Japan). CPE inhibition data were calculated according to the absorbance measured at 450 nm with a microplate reader (Model 680, Bio-Rad, Hercules, CA, USA) and expressed as the 50 % effective (viral CPE inhibitory) concentration (EC50). Each experiment was performed in triplicate and repeated three times. Real-time reverse transcription (RT)-PCR for detecting EV71 RNA Viral RNA was isolated from the cell supernatant using an RNeasy Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. Real-time RT-PCR was performed in a Roche LightCycler2.0 (Roche Molecular Biochemicals, Mannheim, Germany) using a Quant One Step qRT-PCR (Probe) Kit (TIANGEN) according to the manufacturer’s instructions, with EV71-specific primers and probes. The forward (fp) and reverse (rp) primers were EV71-1F (50 -CAAGTCTCAGTGCCATTTAT-30 , nt 3002-3021) and EV71-1R (50 -ATTCGGGCATGCCCCAT ACT-30 , nt 3118-3099), respectively, and the probe was 50 -TCACCTGCAAGCGCATACCAATGGT-30 (nt 30233047). Absolute quantification of viral RNA was done using a standard curve. Inhibition rates were calculated according to the following formula: inhibition rate (%) = [(A virus control - A test)/A virus control] 9 100%. Assays were performed in triplicate, and the average inhibition rate was expressed in terms of mean ± standard deviation (SD).

Inhibition rate at 2 lM (%)

EC50 (lM) [2 1.55

0.55

blotting was performed following standard procedures. In brief, 30 lg of total proteins for each slot was separated by 10 % SDS polyacrylamide gel electrophoresis (PAGE) using a Mini PROTEAN@ Tetra cell (Bio-Rad, USA) and transferred onto polyvinylidene fluoride membranes (Millipore) using a semi-dry transfer unit (Hoefer Semiphor, Pharmacia Biotech, USA). The membranes were then blocked with 5 % nonfat milk in Tris-buffered saline– Tween buffer and then incubated with primary EV71-VP1 monoclonal antibody (Abnova, Taipei City, Taiwan) and beta-actin monoclonal antibody (ProteinTech Group, Chicago, IL, USA). The membranes were washed and then incubated with HRP-labeled secondary antibody (1:2000 dilution; Santa Cruz Biotechnology). They were washed again and developed with an enhanced chemiluminescence reagent (GE healthcare) and exposed to X-Omat BT Film (KodakRochester). Bands were quantified by densitometry using an ATTO Densitograph (ATTO Corporation), normalized relative to beta-actin as an internal control. In vitro cytotoxicity assays The cytotoxicity of EV5 for RD cells and Vero cells was evaluated as the 50 % cytotoxic concentration (CC50 in lM). Briefly, monolayer cultures of RD cells or Vero cells were exposed to several concentrations of compounds in maintenance medium (2 % FCS) at 37 °C for 2 days. Cell viability was assayed using the CCK8 method following the manufacturer’s instructions. Each experiment was performed in triplicate and repeated three times. In vivo antiviral assays

Western blot analysis Cells were grown in 6-cm culture dishes according to the experimental setup described earlier. At 48 h post-treatment, the cells were harvested for the analysis of total proteins. The cells were lysed using Radio-Immunoprecipitation Assay (RIPA) Lysis Reagent (Applygen Technologies, Beijing, China). Phenylmethylsulfonyl fluoride (PMSF) solution (100 mM, GenStar Therapeutics, San Diego, CA, USA) was mixed in a ratio of 1:100. Western

Groups of 7-days-old suckling ICR mice (n = 9) were injected intraperitoneally on one side of the abdomen with 60 lL of 0.9 % normal saline or 60 lL of 0.9 % normal saline containing the indicated amount of EV5 or EV5R 1 h before intraperitoneal injection of a lethal dose of EV71 (5 LD50) on the other side of the abdomen. Following EV71 infection, mice received EV5 intraperitoneally at the same site every 24 h for the next 4 days. After challenge, the animals were observed for illness at least

123

J. Liu et al.

twice daily for 14 days. Apparent antiviral activity of EV5 in mice was evaluated by clinical observation for abnormal behavior or appearance, including cachexia, reduced movement, paralysis, apparent weakness, or death. Additionally, mice were weighed once daily as a measure of illness. To detect viral RNA in tissues, the lungs, brains, intestines, and skeletal muscles of the infected and treated suckling mice were harvested on day 6 postinfection. Total RNA was isolated and subjected to real-time RT-PCR as described above. Total protein was subjected to western blot analysis.

Fig. 2 Antiviral activity of EV5 in vitro by prophylactic treatment. c RD cells and Vero cells were treated with various concentrations of ODNs before EV71 infection. Forty-eight hours later, morphological changes in RD cells were observed under a light microscope at 25 9 magnification (A), EV71-induced CPE was evaluated using the CCK8 assay, EV71 RNA levels were assayed by real-time RT-PCR (B, results in RD cells; C, results in Vero cells), and EV71 VP1 protein expression was detected by western blot analysis (D, E). All tests were carried out independently three times. *P \ 0.05 indicates significant differences from the infected control. A. (a) Uninfected RD cells; (b) Uninfected RD cells treated with 2 lM EV5; (c) EV71infected RD cells in the absence of ODN; (d) EV71-infected RD cells treated with 0.5 lM EV5; (e) EV71-infected RD cells treated with 1 lM EV5; (f) EV71-infected RD cells treated with 2 lM EV5; (g) EV71-infected RD cells treated with 2 lM EV5S; (h) EV71infected RD cells treated with 2 lM EV5R

Results Antiviral activity of five oligonucleotides RD cells were seeded into 96-well plates. The next day, the cell medium was replaced by maintenance medium containing serial twofold dilutions of oligonucleotides from 0.25 lM to 2 lM. One hour later, EV71 was added. Fortyeight hours later, the virus-induced cytopathic effect (CPE) was evaluated, and the EC50 was calculated. As shown in Table 1, EV1 and EV3 did not show significant antiviral activity below 2 lM, while EV5 exhibited more antiviral activity. Therefore, EV5 was used for further study. Cytotoxicity of EV5 The viability of RD cells and Vero cells was determined after 2 days of continuous exposure to the compounds. Observation under an inverted microscope showed that EV5 did not exhibit significant cytotoxicity on RD cells or

Fig. 1 Cytotoxicity of EV5. RD cells and Vero cells were treated with various concentrations of EV5 for 48 h. Cell viability was tested using a Cell Counting Kit-8 assay. We assumed that the OD value of the control cells was 1. The OD ratios are expressed as mean ± SD from three independent experiments

123

Vero cells at a concentration of up to 500 lM, and that concentrations of EV5 [ 500 lM resulted in cell shrinkage, malformation and shedding over 2 days. As evaluated using the CCK8 staining, the CC50 value of EV5 and RD cells or Vero cells was 645 lM and 997 lM, respectively (Fig. 1). Antiviral activity of EV5 in vitro The prophylactic and therapeutic anti-EV71 activities of EV5 in vitro were determined with respect to the inhibition of EV71-induced CPE and EV71 replication by measuring cell viability and viral RNA and VP1 protein levels in RD and Vero cells. To exclude nonspecific effects caused by oligonucleotides, sense and scrambled oligonucleotides (EV5S and EV5R) were used as negative controls. To test the prophylactic activity of EV5, RD or Vero cells pretreated with EV5 for 1 h were infected with EV71. Observations under an inverted microscope and results of CPE analysis showed that EV71-induced CPE in cells was delayed by up to 48 h after infection (Fig. 2A, B, C). The EC50 value of EV5 determined by CPE analysis in RD and Vero cells was 0.58 lM and 0.41 lM, respectively. The selectivity index (SI) was 1719 and 1573, respectively. The results of real-time RT-PCR analysis showed that treatment with various concentrations of EV5 resulted in a decrease in viral copy numbers (Fig. 2B, C). The EC50 value in RD cells and Vero cells was 0.22 lM and 0.18 lM, respectively. The SI was 4532 and 3583, respectively. The results of western blot analysis showed that EV5 reduced VP1 protein expression in a dose-dependent manner (Fig. 2D, E). For evaluation of the therapeutic effect, RD cells and Vero cells were treated separately with EV5 at 1 h after infection with EV71, and the antiviral effects were observed (Fig. 3A, B). The EC50 values for the therapeutic effect of EV5 against virus-induced CPE and viral RNA in RD cells were 0.90 lM and 0.415 lM, respectively. The

Antisense oligonucleotide against enterovirus 71

A

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

B

D

C

E

123

J. Liu et al.

Fig. 3 Antiviral activity of EV5 in vitro by therapeutic treatment. RD cells and Vero cells were treated with various concentrations of ODNs after EV71 infection of cells. Forty-eight hours later, EV71induced CPE was evaluated using the CCK8 assay, and EV71 RNA

levels were assayed by real-time PCR. All tests were carried out independently three times. A. results in RD cells; B. results in Vero cells

chemotherapeutic index was 1108 and 2402, respectively. The EC50 values in Vero cells were 0.64 lM for CPE and 0.41 lM for viral RNA. The chemotherapeutic index was 1009 and 1573, respectively. Antiviral activities of EV5R and EV5S were not observed in either of the experiments (Figs. 2, 3), indicating that the antiviral activity of EV5 was specific.

showed that none of the mice in that group died and that there was no significant change in weight between the EV5-treated group and the control group treated with 0.9 % normal saline. According to our previous data [24] showing that the maximal nontoxic dosage of the oligonucleotides is more than 1000 mg/kg in mice, the LD50 of EV5 might be more than 1000 mg/kg, and this will be investigated further. Examination of viral titers in the lungs, brains, intestines, and muscles of mice by real-time RT-PCR and western blot analysis showed that viral titers were lower in the EV5-treated mice than in EV5R-treated mice and the EV71-infected mouse control, particularly in the lungs, intestines, and muscles (Fig. 5A, B); these differences were statistically significant (P \ 0.05). However, no significant reduction in viral titers was seen in the brains of mice treated with EV5 (P [ 0.05).

Antiviral activity of EV5 in vivo To determine the ability of EV5 to provide in vivo protection against lethal EV71 infection, 7-day-old ICR mice were pretreated by intraperitoneal injection with 40 mg of EV5 or EV5R per kg 1 h before intraperitoneal injection with a lethal dose of EV71. Mice receiving 0.9 % normal saline or 40 mg of EV5 per kg were included as uninfected control groups, and mice receiving EV71 were included as the EV71-infected control group. Injections were given every 24 h for the next four consecutive days after inoculation in all groups, and mortality was monitored for 14 days. Two trials were carried out. As shown in Fig. 4A, suckling mice treated with 40 mg of EV5 per kg showed significant protection against EV71 infection. A total of 70–90 % of infected mice treated with 40 mg of EV5 per kg survived. In contrast, less than 30 % of infected mice that received no treatment or those treated with EV5R survived. Additionally, EV5-treated infected mice gained weight over the duration of the study, consistent with the weight gain of EV5-treated normal mice. Control EV71-infected mice showed weight loss starting at 6 days post-challenge, which was consistent with the weight loss observed in the EV5R group following EV71 infection (Fig. 4B). To monitor the toxicity of EV5 in vivo, 40 mg of EV5 per kg was injected intraperitoneally into 7-day-old ICR mice for five days. The results

123

Discussion In the present study, we found that the ASODN EV5 effectively inhibited EV71 amplification both in vitro and in vivo in a sequence-specific and dose-dependent manner. EV5 was also capable of providing effective protection to EV71-infected mice and inhibited EV71 replication in the lungs, intestines and muscle of infected mice. ASODNs are promising synthetic chemicals for fighting viral infections. Since their introduction in 1978 by Zamecnic and Stephenson [30], three ASODNs, mipomersen, Vitravene (an antiviral drug), and Macugen have been approved by the FDA [19, 31, 32]. Since no effective antiviral drugs are currently available for treating severe EV71 infection and because of the impact of EV71 on public health, we developed an ASODN against EV71. The

Antisense oligonucleotide against enterovirus 71

A

B

Fig. 4 EV5-mediated protection of EV71-infected mice. Groups of 7-day-old ICR mice (n = 9) were injected with the indicated amounts of ODNs and infected with EV71 1 h later. Both ODNs and virus were administered intraperitoneally. Additionally, mice received the indicated dose of ODNs every 24 h after infection for 5 days. Mouse mortality and the weight of the surviving mice were monitored for 14 days. Experiments were carried out in duplicate. A. Survival of mice from two independent experiments. Survival rates that are significantly different by the log-rank test are indicated as follows: ** P \ 0.01. B. Changes in initial body weights of mice from two independent experiments. Data are representative of the mean weight of the surviving mice in each group. All mice were observed for at least 14 days, and no obvious changes in survival were noted after 12 days. The analysis of variance (ANOVA) for comparison of weight changes between untreated infected mice and infected mice treated with EV5 yielded a P-value \ 0.01(** P \ 0.01). The ANOVA result for comparison of weight changes between untreated infected mice and infected mice treated with EV5R was P [ 0.05

EV71 genome is a 7,500-nucleotide (nt) single-stranded RNA molecule with positive polarity and contains a single open reading frame (ORF) flanked by 50 and 30 untranslated regions (UTRs). The 50 UTR of 743 bp length contains conserved sequences and structures that play important roles in regulating many aspects of the viral life cycle, including translation and RNA synthesis. Studies on a variety of RNA viruses have identified the 50 genomic terminus of positive-strand RNA viruses, as well as sequences in the 50 UTR of viral mRNA, as target regions for antiviral ASODNs [33, 34]. We previously developed an ASODN (IV-AS) targeting the 50 -terminal conserved sequence of influenza A virus RNA segments. IV-AS was found to be a potential drug for prophylaxis and control of

influenza virus infections [24]. In this study, by targeting the 50 -terminal conserved sequences on EV71 RNA, we found that EV5 inhibited EV71 proliferation in vitro and in vivo. There have been some reports of the antiviral effects on EV71 of siRNA [35–37] or plasmid-based shRNA [38]. In those reports, siRNA or shRNA targeting of the VP1, 3D, or 2C genes or the 3’ UTR of the EV71 genome resulted in antiviral activity. However, while plasmid-derived shRNAs are widely used for inexpensive proof-of-concept studies, they are not suitable for antiviral therapy. In addition, there is currently no approved marketed siRNA drug. ASODNs appear to be the most promising option. In this study, we have shown that the phosphorothioate oligonucleotide EV5 may be developed as a new drug for EV71 therapy. Unmodified oligonucleotides are highly unstable in vivo (in circulation and within cells) due to rapid nuclease digestion. A number of chemically modified oligonucleotides such as classic phosphorothioate oligonucleotides, phosphorodiamidate morpholino oligomers, locked nucleic acids, and gene-silencing oligonucleotides have been developed [39]. Despite advances in oligonucleotide design, the importance of these new chemistries for converting ASODNs into a successful platform technology remains unclear, and first-generation PSO chemistry is considered to be stable and effective for targeting and binding targets [39]. We have shown the following pharmacological results supporting that EV5 may be developed as a potential anti-EV71 therapy: Artificially synthesized ASODN significantly reduced viral RNA in infected cells. Cells transfected with EV5 were protected from CPE development for up to 48 h. EV71-specific protein (VP1) decreased in cells treated with ASODN in a dose-dependent manner, as detected by western blot analysis. We found that the level of b-actin protein was unaffected by EV5 treatment. However, EV5 could downregulate the expression of VP1. These data suggested that the EV5mediated downregulation of VP1 did not occur as a consequence of the downregulation of protein synthesis of housekeeping genes or in comparison with them. The random strand of EV5 could not suppress replication of EV71, indicating that the specificity of EV5 is very good. The in vivo studies suggested that EV5 provides protection by reducing viral amplification in the lungs, intestines, and muscles of EV71-infected mice, but not in the brain. This may be because the blood-brain barrier precludes the entry of therapeutic molecules from the blood to the brain. Therefore, a specific system for delivering EV5 to the brain must be further examined. Kumar et al. reported that a short peptide derived from rabies virus glycoprotein (RVG) enables the transvascular delivery of small interfering RNA (siRNA) to the brain [40], which provided a good reference for the future work.

123

J. Liu et al.

A

B

Fig. 5 EV5 reduced viral RNA and protein levels in EV71-infected mouse tissues. Groups of 7-day-old ICR mice (n = 9) were injected with the indicated amounts of ODNs and infected with EV71 1 h later. Both ODNs and virus were administered intraperitoneally. Additionally, mice received the indicated dose of ODNs every 24 h after infection for 5 days. On day 6, the lungs, brains, intestines, and skeletal muscles of the infected and treated suckling mice were harvested. Viral titers in the tissues were determined by real-time RT-PCR to detect EV71 RNA and western blotting to detect VP1 protein. A. EV5

treatment led to a decrease in the viral RNA level in all of the EV71infected mouse tissues except for the brain. GAPDH mRNA was analyzed for normalization. Data are shown as mean ± standard deviation (n = 4 mice per group), assuming the EV71 RNA:GAPDH mRNA levels in the tissues of infected mice as 100 %. Significant differences (P \ 0.05) between untreated infected mice and infected mice treated with the ODNs are indicated by an asterisk. B. Western blotting results. EV5 treatment led to a decrease in the viral VP1 protein level in all of the EV71-infected mouse tissues except for the brain

Taken together, a potential synthesized ASODN of the anti-EV71 virus was developed in this study. We demonstrated that EV5 is essential for resisting EV71 replication, and it may be developed as a potential anti-EV71 drug. It is also possible that prophylactic treatment of humans that targets a region in which EV71 is known to be present would be valuable.

2. Brown BA, Pallansch MA (1995) Complete nucleotide sequence of enterovirus 71 is distinct from poliovirus. Virus Res 39:195–205 3. Pulli T, Koskimies P, Hyypia T (1995) Molecular comparison of coxsackie A virus serotypes. Virology 212:30–38 4. Huang HI, Weng KF, Shih SR (2012) Viral and host factors that contribute to pathogenicity of enterovirus 71. Future Microbiol 7:467–479 5. Mao LX, Wu B, Bao WX, Han FA, Xu L et al (2010) Epidemiology of hand, foot, and mouth disease and genotype characterization of Enterovirus 71 in Jiangsu, China. J Clin Virol 49:100–104 6. Wu Y, Yeo A, Phoon MC, Tan EL, Poh CL et al (2010) The largest outbreak of hand; foot and mouth disease in Singapore in 2008: the role of enterovirus 71 and coxsackievirus A strains. Int J Infect Dis 14:e1076–e1081 7. De W, Changwen K, Wei L, Monagin C, Jin Y et al (2011) A large outbreak of hand, foot, and mouth disease caused by EV71 and CAV16 in Guangdong, China, 2009. Arch Virol 156:945–953 8. Chang LY, Lin TY, Hsu KH, Huang YC, Lin KL et al (1999) Clinical features and risk factors of pulmonary oedema after

Acknowledgements This work was supported by a grant from the National Natural Science Foundation of China (no. 31270197) and two grants from the National Science and Technology Major Projects (no. 2013ZX09-304-102 and 2014ZX09-304-313).

References 1. Schmidt NJ, Lennette EH, Ho HH (1974) An apparently new enterovirus isolated from patients with disease of the central nervous system. J Infect Dis 129:304–309

123

Antisense oligonucleotide against enterovirus 71

9.

10.

11.

12.

13. 14.

15.

16.

17. 18. 19. 20.

21.

22.

23.

24.

enterovirus-71-related hand, foot, and mouth disease. Lancet 354:1682–1686 Ho M, Chen ER, Hsu KH, Twu SJ, Chen KT et al (1999) An epidemic of enterovirus 71 infection in Taiwan. Taiwan Enterovirus Epidemic Working Group. N Engl J Med 341:929–935 Huang CC, Liu CC, Chang YC, Chen CY, Wang ST et al (1999) Neurologic complications in children with enterovirus 71 infection. N Engl J Med 341:936–942 Yi L, Lu J, Kung HF, He ML (2011) The virology and developments toward control of human enterovirus 71. Crit Rev Microbiol 37:313–327 McMinn P, Stratov I, Nagarajan L, Davis S (2001) Neurological manifestations of enterovirus 71 infection in children during an outbreak of hand, foot, and mouth disease in Western Australia. Clin Infect Dis 32:236–242 Lum LC, Wong KT, Lam SK, Chua KB, Goh AY et al (1998) Fatal enterovirus 71 encephalomyelitis. J Pediatr 133:795–798 Heinz BA, Vance LM (1995) The antiviral compound enviroxime targets the 3A coding region of rhinovirus and poliovirus. J Virol 69:4189–4197 Pevear DC, Tull TM, Seipel ME, Groarke JM (1999) Activity of pleconaril against enteroviruses. Antimicrob Agents Chemother 43:2109–2115 Wu KX, Ng MM, Chu JJ (2010) Developments towards antiviral therapies against enterovirus 71. Drug Discov Today 15:1041–1051 Scherer LJ, Rossi JJ (2003) Approaches for the sequence-specific knockdown of mRNA. Nat Biotechnol 21:1457–1465 Dias N, Stein CA (2002) Antisense oligonucleotides: basic concepts and mechanisms. Mol Cancer Ther 1:347–355 Editorial PIP (1998) Advances in CMV management: fomivirsen (Vitravene) approved. Proj Inf Perspect: 7 Rayburn ER, Zhang R (2008) Antisense, RNAi, and gene silencing strategies for therapy: mission possible or impossible? Drug Discov Today 13:513–521 Deas TS, Binduga-Gajewska I, Tilgner M, Ren P, Stein DA et al (2005) Inhibition of flavivirus infections by antisense oligomers specifically suppressing viral translation and RNA replication. J Virol 79:4599–4609 Jensen KD, Kopeckova P, Kopecek J (2002) Antisense oligonucleotides delivered to the lysosome escape and actively inhibit the hepatitis B virus. Bioconjug Chem 13:975–984 Cong Z, Wan M, Wu X, Wang L, Hu X et al (2007) A CpG oligodeoxynucleotide inducing anti-coxsackie B3 virus activity in human peripheral blood mononuclear cells. FEMS Immunol Med Microbiol 51:26–34 Duan M, Zhou Z, Lin RX, Yang J, Xia XZ et al (2008) In vitro and in vivo protection against the highly pathogenic H5N1

25.

26. 27. 28.

29.

30.

31. 32.

33.

34.

35.

36. 37.

38.

39. 40.

influenza virus by an antisense phosphorothioate oligonucleotide. Antivir Ther 13:109–114 Mizuta T, Fujiwara M, Abe T, Miyano-Kurosaki N, Yokota T et al (2000) Inhibitory effects of an antisense oligonucleotide in an experimentally infected mouse model of influenza A virus. Biochem Biophys Res Commun 279:158–161 McKnight KL, Heinz BA (2003) RNA as a target for developing antivirals. Antivir Chem Chemother 14:61–73 Potera C (2007) Antisense–down, but not out. Nat Biotechnol 25:497–499 Bo X, Lou S, Sun D, Shu W, Yang J et al (2006) Selection of antisense oligonucleotides based on multiple predicted target mRNA structures. BMC Bioinform 7:122 Yamayoshi S, Yamashita Y, Li J, Hanagata N, Minowa T et al (2009) Scavenger receptor B2 is a cellular receptor for enterovirus 71. Nat Med 15:798–801 Stephenson ML, Zamecnik PC (1978) Inhibition of Rous sarcoma viral RNA translation by a specific oligodeoxyribonucleotide. Proc Natl Acad Sci USA 75:285–288 Tse MT (2013) Regulatory watch: antisense approval provides boost to the field. Nat Rev Drug Discov 12:179 Gragoudas ES, Adamis AP, Cunningham ET Jr, Feinsod M, Guyer DR (2004) Pegaptanib for neovascular age-related macular degeneration. N Engl J Med 351:2805–2816 Neuman BW, Bederka LH, Stein DA, Ting JP, Moulton HM et al (2011) Development of peptide-conjugated morpholino oligomers as pan-arenavirus inhibitors. Antimicrob Agents Chemother 55:4631–4638 Stein DA (2008) Inhibition of RNA virus infections with peptide-conjugated morpholino oligomers. Curr Pharm Des 14:2619–2634 Tan EL, Tan TM, Tak Kwong Chow V, Poh CL (2007) Inhibition of enterovirus 71 in virus-infected mice by RNA interference. Mol Ther 15:1931–1938 Sim AC, Luhur A, Tan TM, Chow VT, Poh CL (2005) RNA interference against enterovirus 71 infection. Virology 341:72–79 Tan EL, Tan TM, Chow VT, Poh CL (2007) Enhanced potency and efficacy of 29-mer shRNAs in inhibition of Enterovirus 71. Antiviral Res 74:9–15 Lu WW, Hsu YY, Yang JY, Kung SH (2004) Selective inhibition of enterovirus 71 replication by short hairpin RNAs. Biochem Biophys Res Commun 325:494–499 Jones D (2011) The long march of antisense. Nat Rev Drug Discov 10:401–402 Kumar P, Wu H, McBride JL, Jung KE, Kim MH et al (2007) Transvascular delivery of small interfering RNA to the central nervous system. Nature 448:39–43

123