Protoplasma DOI 10.1007/s00709-014-0653-9
ORIGINAL ARTICLE
Improved callus induction, shoot regeneration, and salt stress tolerance in Arabidopsis overexpressing superoxide dismutase from Potentilla atrosanguinea Amrina Shafi & Tejpal Gill & Yelam Sreenivasulu & Sanjay Kumar & Paramvir Singh Ahuja & Anil Kumar Singh
Received: 25 February 2014 / Accepted: 27 April 2014 # Springer-Verlag Wien 2014
Abstract Superoxide dismutase (SOD) catalyzes the dismutation of superoxide radicals (O2 · −) to molecular oxygen (O2) and hydrogen peroxide (H2O2). Previously, we have identified and characterized a thermo-tolerant copper-zinc superoxide dismutase from Potentilla atrosanguinea (PaSOD), which retains its activity in the presence of NaCl. In the present study, we show that cotyledonary explants of PaSOD overexpressing transgenic Arabidopsis thaliana exhibit early callus induction and high shoot regenerative capacity than wild-type (WT) explants. Growth kinetic studies showed that transgenic lines have 2.6–3.3-folds higher growth rate of calli compared to WT. Regeneration frequency of calli developed from transgenic cotyledons was found to be 1.5– 2.5-folds higher than that of WT explants on Murashige and Skoog medium supplemented with different concentrations of
Handling Editor: Bhumi Nath Tripathi Electronic supplementary material The online version of this article (doi:10.1007/s00709-014-0653-9) contains supplementary material, which is available to authorized users. A. Shafi : T. Gill : Y. Sreenivasulu : S. Kumar : P. S. Ahuja (*) : A. K. Singh (*) Division of Biotechnology, CSIR-Institute of Himalayan Bioresource Technology, Palampur HP 176061, India e-mail: [email protected] e-mail: [email protected] A. K. Singh e-mail: [email protected] A. Shafi : P. S. Ahuja : A. K. Singh Academy of Scientific and Innovative Research, New Delhi, India Present Address: T. Gill National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institute of Health, Bldg 10 CRC, 1-5256, 9000 Rockville Pike, Bethesda, MD 20892, USA
naphthalene acetic acid (NAA) and 6-benzylaminopurine (BAP) within 2 weeks. A positive regulatory effect of PaSOD and H2O2 was observed on different stages of callusing and regeneration. However, this effect was more pronounced at the early stages of the regeneration processes in transgenic lines as compared to WT. These results clearly indicate that plant regeneration is regulated by endogenous H2O2 and by factors, which enhance its accumulation. Transgenics also exhibited salt stress tolerance with higher SOD activity, chlorophyll content, total soluble sugars, and proline content, while lower ion leakage and less reduction in relative water content, as compared to WT. Thus, it appears that the activation of PaSOD at regeneration stage accompanied by increased H2O2 production can be one of the mechanisms controlling in vitro morphogenesis. Keywords Arabidopsis thaliana . Growth kinetics . H2O2 . In vitro morphogenesis . Potentilla atrosanguinea . Shoot regeneration . Superoxide dismutase
Introduction Oxygen is essential for the existence of aerobic life. However, as a consequence of aerobic metabolism, highly toxic reactive oxygen species (ROS) are produced, which include the superoxide anion (O2 ·−), hydroxyl radical (OH·), and hydrogen peroxide (H2O2). Production of ROS is an inevitable result of the leakage of electron onto molecular oxygen in chloroplast; mitochondria and plasma membrane linked electron transport in plant cells (Asada 1994). ROS are considered to be damaging factors in plants exposed to stressful environmental conditions such as drought (Badawi et al. 2004), salinity (Munns and Tester 2008), and chilling stress (Wise and Naylor 1987). In order to protect against damaging effects
A. Shafi et al.
of ROS, plant cells have developed redox homeostatic mechanisms that scavenge ROS and keep it below harmful levels. Enhancement of antioxidant defense in plants can thus increase tolerance against different stress factors. Antioxidant defense (ROS scavengers) includes enzymes such as superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), and glutathione reductase (GR). SOD enzyme is considered as the first line of cellular defense against oxidative stress by early scavenging of superoxide radicals and converting them to hydrogen peroxide (Perl-Treves and Galun 1991). H2O2 is then disposed off enzymatically by APX or CAT or non-enzymatically by ascorbate to prevent the formation of the highly toxic hydroxyl radical (Foyer et al. 1994). Since H2O2 is most stable and probable candidate for ROSmediated signal transduction, it has ability to cross the membrane barrier and reach the site of action due to its uncharged nature (Foyer et al. 1997). H2O2 can act as a signaling molecule that regulates plant development, stress adaptation, and programmed cell death (Klaus and Heribert 2004). Thus, it is a cellular secondary “messenger” capable of inducing gene expression and protein synthesis and promoting somatic embryogenesis and in vitro shoot regeneration (Cui et al. 1999; Luo et al. 2001; Papadakis and Roubelakis-Angelakis 2002; Libik et al. 2005). Regeneration process is controlled by various genes whose expression is governed by certain physical and chemical conditions (Imani et al. 2001; Papadakis et al. 2001). So far, in vitro regeneration has been achieved by a variety of means including treatment with plant growth regulators (PGR), temperature shocks, osmotic stress, and through application of various chemical substances (Szechynska-Hebda et al. 2007; Touraev et al. 1997; Zavattieri et al. 2010). The consequence of these processes has been generally considered as ROS overproduction, which is detrimental for plant as such (Scandalios 1997). However, recent pieces of evidence suggest that ROS participate in signal transduction cascade (Prasad et al. 1994) and have a positive role in plant growth and development (Tian et al. 2003). A change in the activity of antioxidant enzymes has also been detected during in vitro shoot initiation and development (Batkova et al. 2008; Gupta 2010). Several groups have reported the involvement of H2O2 in in vitro regeneration of plants (Cui et al. 1999; Luo et al. 2001; Papadakis et al. 2001; Tian et al. 2003; Libik et al. 2005; Zheng et al. 2005). Furthermore, it has been reported that the cytosolic Cu/ZnSOD was induced in regenerating tobacco protoplasts (Papadakis et al. 2001), which supports the hypothesis that SOD is involved in plant morphogenesis. One possible link between oxidative stress and plant morphogenesis could be H2O2 that may serve as a signaling molecule to mediate cellular response during plant morphogenesis, since several studies have implicated H2O2 in this process (Cui et al. 1999; Luo et al. 2001; Papadakis and Roubelakis-Angelakis 2002;
Libik et al. 2005). However, the effect of overexpression of SOD on callus growth and in vitro morphogenesis has not been studied, yet. Salinity results in osmotic and ionic stresses. Osmotic regulation is an important mechanism for plant cellular homeostasis in saline conditions. Under salt stress, plants accumulate several compatible solutes in the cytosol, such as polyols, betaine, trehalsose, ectoine, proline, and others (Hasegawa et al. 2000). Proline is one of the most efficient compatible solutes, which play an important role in osmotic balancing and in increasing the turgor pressure, necessary for cell expansion (Hasegawa et al. 2000; Matysik et al. 2002). The reactive oxygen species that are by-products of hyperosmotic and ionic stresses cause membrane dysfunction, ion leakage, and cell death (Bohnert and Jensen 1996). The present study was aimed to investigate the role of PaSOD and H2O2 on callus growth and in vitro regenerative capacity of the PaSOD transgenic plants. Here, we show that overexpression and changes in the activity of PaSOD in Arabidopsis affect the endogenous H2O2 levels, resulting in enhanced callus induction and shoot regeneration capacity. Our results suggest that proper maintenance of redox homeostasis is crucial for successful regeneration at the early stages of shoot organogenesis.
Materials and methods Plasmid construction and transgenic plant development Previously, a full length complementary DNA (cDNA) of Potentilla atrosanguinea copper-zinc superoxide dismutase (PaSOD), which retains catalytic activity in the presence of NaCl (Kumar et al. 2002), was overexpressed in Arabidopsis thaliana as described by Gill et al. (2010). Briefly, coding nucleotide sequences was amplified using the gene specific primers with incorporated NcoI and BglII restriction sites at the tails. PCR products were cloned into a cloning vector pGEMT easy (Promega) and then subcloned into binary plant vector pCAMBIA1302 under the cauliflower mosaic virus 35S promoter (Fig. 1a). The prepared plasmid construct was mobilized into Agrobacterium tumefaciens strain GV3101 and used for plant transformation. Arabidopsis plants (5 weeks old) were infected with the A. tumefaciens via vacuum infiltration method (Bechtold et al. 1993) and grown in the greenhouse. The collected seeds were screened on Murashige and Skoog (1962) medium supplemented with 20 μg ml−1 hygromycin. Homozygous (T3 generation) transgenic PaSOD lines (S26 and S15) were screened for integration of genes in the host genome, using gene specific primers with PCR conditions as mentioned in Table 1. Total RNA was isolated from transgenic and the wild-type Arabidopsis plants using Total RNA Extraction Kit (Real
Callus induction, shoot regeneration, and salt stress tolerance Fig. 1 Overexpression of PaSOD in Arabidopsis improved callus induction. a Schematic representation of construct showing T-DNA region with different constituents and the position of introduced PaSOD in between NcoI and BglII restriction sites. b Expression analysis of PaSOD gene under control (0 mM NaCl) and salt stress (100 mM NaCl) in WT and transgenic lines. 26S rRNA was used as a reference gene. c Transgenic lines S15 and S26 showed higher growth of calli as compared to WT. The growth curve analysis of callus, based on d dry weight (DW mg/l) and e fresh weight (FW mg/l), which were determined every 2 days after inoculation. Bar indicates the standard deviation (n=3)
Genomics). One microgram of total RNA was used for oligo (dT) primed first-strand cDNA synthesis in 20-μl reaction using Superscript III reverse transcriptase (Invitrogen). This cDNA was used in 27-cycle PCR using gene specific primers for PaSOD gene. Constitutively expressed 26S rRNA gene was amplified simultaneously in 27 cycles to ensure equal amounts of template cDNA used. Plant growth, callus induction, and regeneration Arabidopsis seeds were surface sterilized, sown in petri dishes containing Murashige and Skoog (MS) medium. The plates were kept at 4 °C for 2 days and then shifted to 21±1 °C. After 10 days of germination, cotyledons were excised from seedlings and cut into two pieces and placed on MS callus induction medium containing 30 g l−1 sucrose and 8.0 g l−1 agar (Sigma-Aldrich, St. Louis, MO, USA), supplemented with 1 mg l−1 2,4dichlorophenoxyacetic acid (2,4-D) (Sigma-Aldrich, St. Louis, MO, USA). The explants were cultured in the dark at 25±2 °C.
Callus formation started after 1 week of inoculation on callus induction medium. After 1 month, compact proliferating callus was selected and transferred to fresh MS medium with 1.0 mg l−1 2,4-D, 30 g l−1 sucrose, and 8.0 g l−1 agar. After 1-month subculture, proliferating callus was transferred to regeneration medium (half strength MS medium with 30 g l−1 sucrose, 8.0 g l−1 agar, supplemented with 0.5–1.0 mg l−1 2,4-D, and 0.5–1.0 mg l−1 benzylaminopurine (BAP) (Sigma-Aldrich, St. Louis, MO, USA) for regeneration in a culture room with a 16-h photoperiod (60–70 μmol m−2 s−1 cool white fluorescent irradiance) for 4 weeks at 25±2 °C. Callus with clearly differentiated shoots were counted as regenerated, with each piece of callus counted as one unit. After 4 weeks, the regenerated plantlets were transferred to 100-ml flasks containing the same medium for further growth. SOD activity and H2O2 content were determined at different stages of culture. Regeneration frequency was calculated as the number of regenerated explants per total number of cultured explants. Three replications were used in each experiment.
Table 1 Primer sequence, PCR conditions, and amplicon size for the PaSOD and 26S rRNA (reference gene) used for semiquantitative PCR Gene
Sequence 5′-3′
PCR conditions
Amplicon size (bp)
PaSOD
F:CCATGGATGGCAAAGGGCGTTGCTG R:TCTAGATCCTTGAAGGCCAATAATACC F:CACAATGATAGGAAGAGCCGAC R:CAAGGGAACGGGCTTGGCAGAATC
94 °C, 4 min; 94 °C, 1 min, 56 °C, 30 s, 72 °C, 1 min, 27 cycles; 72 °C, 7 min 94 °C, 4 min; 94 °C, 1 min, 57 °C, 30 s, 72 °C, 1 min, 27 cycles; 72 °C, 7 min
456
26S rRNA
534
A. Shafi et al.
Callus growth measurement Following callus induction after 3 weeks of culture, callus was aseptically transferred onto liquid medium in culture flasks. The flasks were incubated in the dark at 27±1 °C for 4 weeks. Growth kinetics was studied by determination of fresh and dry weights of fresh callus of 5, 10, 15, 20, 25, and 30 days old. Dry weight of fresh callus was determined after drying in a vacuum oven at 65 °C until constant weight. The cultures were incubated for 16-h photoperiods at 25 °C. SOD enzyme activity assay Total SOD activity was estimated as intensity of nitro blue tetrazolium (NBT) reduction using spectrophotometer as described earlier (Gill et al. 2010). Briefly, leaf samples (100 mg) were homogenized in a precooled mortar in homogenizing buffer containing 2 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.5 % (v/v) Triton-X100, and 10 % (w/v) PVPP in 50 mM phosphate buffer pH 7.8. The homogenate was transferred to 1.5-ml microfuge tube and centrifuged at 13,000 rpm for 20 min at 4 °C. The supernatant was collected, and total SOD activity was estimated. The total SOD activity was measured by adding 5-μl enzyme extract to a reaction mixture (200 μl) containing 1.5 μm riboflavin, 50 μm NBT, 10 mM DL-methionine, and 0.025 % (v/v) Triton-X100 in 50 mM phosphate buffer. One unit of enzyme activity was defined as the amount of enzyme required for 50 % inhibition of NBT reduction per min at 25 °C. Specific activity of SOD was calculated accordingly. Protein content was estimated according to the dye-binding method of Bradford using BSA as standard. Determination of H2O2 content by peroxidise-coupled assay The level of H2O2 was measured following Sonja et al. (2002) method with some modifications. Arabidopsis leaves (100 mg) were ground to a fine powder in liquid nitrogen, and the powder was extracted in 2 ml 1 M HClO4. Extraction was performed in the presence of insoluble PVP (5 %). Homogenates were centrifuged at 12,000×g for 10 min at 4 °C, and the supernatant was neutralized with 2.5 M K2CO3 to pH 5.6 in the presence of 100 μl 0.1 M phosphate buffer (pH 5.6). The homogenate was centrifuged at 12,000×g for 1 min to remove KClO4. The sample was incubated prior to assay for 10 min with 1 U ascorbate oxidase (Sigma-Aldrich, India) to oxidize ascorbate. The reaction mixture consisted of 0.1 M phosphate buffer (pH 6.5), 3.3 mM 3-(dimethylamino)benzoic acid (DMAB), 0.07 mM 3-methyl-2-benzothiazoline hydrazone (MBTH), and 50 ng horseradish peroxidase (POX) (Sigma-Aldrich, India). The reaction was initiated by addition of an aliquot (50 or 100 μl) of the sample. The absorbance change at 590 nm was monitored at 25 °C. For each assay, H2O2 contents in the extract
were quantified by reference to an internal standard (1.5 nmol H2O2, added to the reaction mixture on completion of the absorbance change due to the sample). Microscopy Explants were collected at 0, 1, 2, 3, and 4 weeks from initiation and evaluated using scanning electron microscopy (SEM) and light microscopy (LM). Samples were fixed in formalin, glacial acetic acid, and 50 % ethyl alcohol (FAA) (1:1:18) at room temperature. Samples were subsequently dehydrated in a tertiary butyl alcohol series, embedded in paraffin (melting point 58–60 °C), and 8–10-mm thick sections were cut using a Finesee microtome. Sections were stained with 1 % safranin in water and with 4 % fast green in clove oil for 4 h and for 30 s, respectively. These were mounted in Canada balsam and examined using bright field microscope (Zeiss LSM510 meta GmbH, Germany) equipped with a Zeiss Axiovert 100 M inverted microscope. For SEM analysis, samples were fixed in two steps: first with a mixture of 2 % paraformaldehyde and 2.5 % glutaraldehyde in 0.1 mol/l cacodylate buffer, pH 7.4 for 1 h and then with 1 % OsO4 in 0.1 mol/l cacodylate buffer, pH 7.4 for 30 min. After critical point drying, the samples were sputtercoated with gold, and the coated samples were viewed with a Hitachi S-3400N field emission SEM using an accelerating voltage of 30 kV. For tracking different stages of regeneration in WT and PaSOD lines, samples at each stage were collected and visualized under stereoscope (Zeiss meta Gmbh, Germany). Evaluation of salt stress tolerance Seeds of transgenic lines (T3) overexpressing PaSOD (S26 and S15) and WT were grown in MS medium for 10 days and transplanted thereafter to the mixture of vermiculite/peat moss/perlite (1:1:1) in the greenhouse under a 16-h light and 8-h dark cycle at 20±1 °C. For stress treatment, 21-day-old seedlings of WT and transgenics were supplemented with desired concentration of NaCl (0, 50, 100, and 150 mM). Three biological replicates were collected from each sample at respective time points after salt stress.
Estimation of electrolyte leakage, relative water content, total soluble sugars, proline, and chlorophyll content Electrolyte leakage was measured using an electrical conductivity meter as described by Lutts et al. (1996). Relative water content (RWC) was measured according to Barrs and Weatherley (1962). Total soluble sugar (TSS) content was determined by anthrone method. Free proline content was estimated using the acid ninhydrin method described by
Callus induction, shoot regeneration, and salt stress tolerance
Bates et al. (1973). Chlorophyll content was estimated by the method of Arnon (1949). Statistical analysis All experiments were conducted with at least three independent repetitions in triplicate. All values are shown as the mean±standard deviation. The statistical analysis was performed using Statistica software (v.7). The statistical significance between the mean values was assessed by Analysis of Variance (ANOVA) applying Duncan’s multiple range test (DMRT). A probability level of P≤0.05 was considered significant.
Results and discussion Confirmation and expression analysis of PaSOD in Arabidopsis Agrobacterium-mediated transformation was used to overexpress PaSOD in Arabidopsis, and 29 independent transgenic lines (T1) were taken to T2 generation. Out of these lines, two single copy insertion lines with high SOD activity (S15 and S26) were selected for further analysis. Selection on hygromycin plate confirmed these lines to be homozygous in T3 generation. Semiquantitative RT-PCR analysis confirmed overexpression of PaSOD in the transgenic lines (Fig. 1b). Variation in transgene expression is a frequently seen phenomenon (Schubert et al. 2004) and has been hypothesized to be due to different integration sites of the transgene which is influenced by the chromatin type, position effects, or due to the interaction of these factors (Tang et al. 2003). PaSOD calli have early and enhanced growth rates than WT calli in suspension culture Callus initiation is the primary stage in many tissue culture processes for the establishment of cell suspension cultures (Kumar and Kanwar 2007; Ngara et al. 2008). This study was aimed to determine the difference in callus growth kinetics between WT and PaSOD lines. The growth of callus was determined based on the fresh and dry weights of the cultures. Growth kinetics showed a typical curve with lag phase, exponential phase followed by stationary phase after incubation. The pattern of the growth curve obtained in WT and PaSOD lines was different (Fig. 1d, e). Upon transferring the calli of PaSOD lines (S26 and S15) to the suspension medium, very little increase in biomass was observed during the first 4 days of culture (the lag phase). After 6 days of culture, the calli were found in their exponential phase as the cells rapidly divided and proliferated. After 14 days, culture reached the
stationary phase. While in WT, exponential phase began after 14 days of incubation and stationary phase was reached after 22 days. Growth rates during the exponential phase in WT, S15, and S26 lines were 0.22, 0.57, and 0.73 g (dry weight)/ day, respectively, (Fig. 1d) while on the basis of fresh weight, growth rates during the exponential phase in WT, S15, and S26 were 0.38, 0.98, and 1.22 g (fresh weight)/day, respectively (Fig. 1e). These results clearly demonstrate that growth rate of PaSOD calli was significantly higher than that of WT calli. Callus induction and in vitro regeneration frequency vary between WT and PaSOD lines In the present study, cotyledons of WT and PaSOD Arabidopsis plants were used as explants due to their high regeneration potential as suggested by various previous studies (Ozcan et al. 1992; Patton and Meinke 1988; Mante et al. 1989). To find out whether PaSOD plays a role in de novo organ regeneration, we compared the developmental rates of shoot regeneration between WT and the PaSOD transgenic explants. In the case of WT explants, callus induction started within 7 days of culturing on MS media supplemented with 1 mg l−1 2,4-D, while callus induction from PaSOD explants was observed within 3–4 days on the same media (Fig. 2A, F, K). Histological sections during early stages of callus formation revealed that parenchyma cells in the subepidermal region resumed meristematic activity and produced an undifferentiated mass of cells called primary callus (Fig. 2a, f, k). It was also observed that the fresh and dry weights and the diameter of calli were 1.5–2-folds higher in PaSOD lines as compared to that of WT (Fig. 1c, d, e; Table 2). Calli from both WT and PaSOD lines regenerated shoots when cultured on the regeneration media with different concentrations of BAP and NAA (Table 2). Transfer of callus to regeneration media led to the formation of meristemoids (Fig. 4Cc, Gg, Ll). The meristemoids (nodules or growth centers) are localized clusters of cambium-like cells which may become vascularized due to the appearance of tracheid cells in the center. Formation of meristemoids in callus cultures may represent their association with an early stage development of shoot bud (Kulchetscki et al. 1995). However, an early shoot initiation response was observed from the PaSOD calli as compared to WT calli on the regeneration medium containing 0.5 mg l−1 NAA and 1.0 mg l−1 BAP. After 2 weeks on the regeneration medium, shoot meristem appeared in approximately 70 % PaSOD calli (Fig. 2h, m). Whereas in the case of the WT calli, such shoot meristems could be identified only after 3 weeks of culturing on the regeneration medium (Fig. 2Dd). Electron micrographs also depicted the same results where shoot primordia were observed much earlier in PaSOD line (Fig. 3q) as compared to WT calli (Fig. 3k). Histological sections revealed that apical meristem of PaSOD
A. Shafi et al.
Fig. 2 Light micrographs showing the early stages of callus induction and plant regeneration in WT and PaSOD lines, (S15 and S26) cotyledon explants cultured on media supplemented with 0.5 mg l−1 NAA and 1 mg l−1 BAP. A, F, K non-embryogenic callus showing the loose structure. B, G, L callus with a very compact, nodular greenish structure. H, M initiation of shoot regeneration in S26 and S15 lines. I, N regenerated callus with multiple shoots after 3 weeks, and J, O well-established shoot clusters 4 weeks after transfer to the regeneration medium.
Histological sections of shoot base-derived regenerating callus with emergence of shoot meristemoids, after 1 week of culture (c, g, l) and section of callus with regenerating shoot and vascular connection (j, o). Black arrows indicate callus differentiation in S26 (g, h, i) and S15 (l, m, n) lines (c, d, e). Red arrows indicate vascular connection of regenerating shoot apex with parent calli, which appeared earlier in S26 and S15 lines as compared to WT. Bars=50 μm
Table 2 Callus induction and shoot regeneration from WT and transgenic lines Average diameter (mm) of calli in MS media
Percent shoot regeneration in primary calli
Lines
MS1
MS2
MS3
MS4
MS1
MS2
MS3
MS4
WT S26 S15
5.16±0.06h 8.82±0.09c 6.14±0.06f
6.86±0.11d 14.3±0.13a 10.3±0.13b
4.36±0.09i 6.44±0.06e 5.5±0.06g
4.16±0.06i 6.68±0.13d 6.02±0.08f
24.8±0.48h 59.6±0.65c 35±0.70e
31.2±0.48f 79.8±0.85a 63±1.22b
20.2±0.48i 34.8±0.48e 30.6±0.31f
14.8±0.48j 37.2±0.48d 27.6±0.32g
Each value represents mean ± SE of five replicates for each parameter. The induction media contained 1 mg l−1 2,4-D and regeneration media supplemented with BAP and NAA in different concentrations, MS1 (0.5 mg l−1 NAA/0.5 mg l−1 BAP), MS2 (0.5 mg l−1 NAA/1 mg l−1 BAP), MS3 (1 mg l−1 NAA/0.5 mg l−1 BAP) and MS4 (1 mg l−1 NAA/1 mg l−1 BAP). In each section of the table, means were compared with ANOVA and data followed by the same letters within the columns are not significantly different at the level of P≤0.05, as determined by a least-significant difference (LSD)
Callus induction, shoot regeneration, and salt stress tolerance
Fig. 3 Light and scanning electron micrographs of different types of regenerating structures of Arabidopsis cotyledon explants, cultured on media supplemented with 0.5 mg l−1 NAA and 1 mg l−1 BAP in WT (a–l) and S26 (m–x) transgenic line. a, d, m, p Callus formed on 2,4-D containing media. h, n, k, q Leaf surface at 1 week on induction medium showing rounded protrusions. i, o, l, r Bud development with shoot meristems at 2 weeks after induction. s, v Non-synchronous development
of numerous shoots with meristems and leaf primordia at 3 weeks on regeneration medium. f, w Numerous elongated structures with varying degrees of apical development at 4 weeks on regeneration medium. Red arrows indicate elongated structures with club-like (q) and meristem development at apical areas (w) formation in S26 line and in WT (k, l), also at 4 weeks on regeneration medium
line exhibits tunica-corpus organization and parenchymatous cells subtended to apical meristem regions (Fig. 2h, m). After 3 weeks on the regeneration medium, more shoot meristems and primordia emerged from the PaSOD calli than those from the WT calli (Fig. 2i, n). After 4-week incubation on the regeneration medium, the percentage of shoots from the PaSOD calli was much higher than that of the WT calli (Fig. 2Jj, Oo; Table 2). Adventitious shoots with leaf primordia were numerous in the case of PaSOD line (Fig. 2i, n) and had provascular strands (Fig. 2j, o). Along with higher morphogenic potential of S26 and S15 lines, they also had phenotypically higher number of shoots as compared to WT (Fig. 4a). Similarly, in a previous report, higher regeneration efficiency was observed in transgenic pepper plants carrying SOD gene as compared to the wild type (Chatzidimitriadou et al. 2009).
PaSOD activity and H2O2 content differ at various stages of culturing in WT and PaSOD lines In order to determine the possible involvement of SOD and H2O2 in the callus induction and regeneration in Arabidopsis cultures, we measured changes in both H2O2 content and SOD activity. SOD functions in the removal of the superoxide radical, simultaneously producing H2O2 as a reaction product (Alscher et al. 2002). In the present study, SOD activity was found to vary among WT and PaSOD lines at each stage of culturing. SOD levels were found to be decreased in calli comparing to that of cotyledon stage, then increased in regenerated shoots and roots (Fig. 4b). In the case of PaSOD lines, SOD activity was found to be higher than that of WT at all the stages. However, the increase in the SOD activity of PaSOD lines as compared to WT was more during the regeneration
A. Shafi et al.
expression of SOD in a specific developmental manner has also been observed (Papadakis et al. 2001; Racchi et al. 2001). Endogenous H2O2 content was also estimated in WT and PaSOD lines, and it was observed that its level also varied with different stages of culturing (Fig. 4c). Difference in H2O2 content between calli and regenerated shoots was also evident in both WT and PaSOD lines, but content was higher in PaSOD lines than WT. In our study, PaSOD activity and H 2 O 2 contents were found to be highest at shoot regeneration stage both in WT and PaSOD lines which was also reported by Tian et al. (2003), where H2O2 levels and SOD activity increased during early phases of shoot regeneration. Transgenic explants with increased SOD activities and H2O2 production were highly regenerative, whereas explants with decreased SOD activities and H2O2 production were poorly regenerative (Fig. 4a, b, c). High regeneration capacity was observed in strawberry calli which had higher levels of H2O2 compared to calli which showed lower regeneration capacity (Tian et al. 2004). A modification in endogenous H2O2 content can be regarded as one of the early responses of the explant, possibly related to the ability to regenerate. H2O2 has been implicated as a potential mediator between oxidative stress and plant morphogenesis in vitro (Cui et al. 1999; Luo et al. 2001; Papadakis and Roubelakis-Angelakis 2002; Pua and Gong 2004). However, it is not clear if H2O2 is the cause or the consequence of plant morphogenesis. Calli with low CAT activity and high H2O2 concentration displayed a regeneration potential which might support the hypothesis that the H2O2 produced in excess may promote the expression of some genes responsible for the induction of morphogenesis processes (Libik et al. 2005). Numerous studies have been reported relating to the variation in the patterns of the antioxidant enzyme activity during different stages of organogenesis (Franck et al. 1998; Chen and Ziv 2001; Racchi et al. 2001; Meratan et al. 2009; Vatankhah et al. 2010). Thus, we make a hypothesis that in PaSOD lines, enhanced shoot regeneration rates are associated with higher H2O2 accumulation due to Cu/ Zn-SOD overexpression. PaSOD lines exhibit improved salt stress tolerance
Fig. 4 Number of regenerating shoots (a), superoxide dismutase activity (b) and H2O2 content (c) in WT and PaSOD lines (S15 and S26) during in vitro culturing on regeneration media supplemented with BAP and NAA in different concentrations: MS1 (0.5 mg l−1 NAA/0.5 mg l−1 BAP), MS2 (0.5 mg l−1 NAA/1 mg l−1 BAP), MS3 (1 mg l−1 NAA/ 0.5 mg l−1 BAP), and MS4 (1 mg l−1 NAA/1 mg l−1 BAP)
stages. Similar observations have also been reported earlier by few groups (Bagnoli et al. 1998; Cui et al. 1999). The
Transgenic PaSOD lines and WT were evaluated under salt stress for tolerance by estimation of SOD activity, accumulation of compatible solutes, membrane damage, and electrolyte leakage under control and at different levels of NaCl stress. The PaSOD lines maintained higher transcript levels of PaSOD under 100 mM salt stress (Fig. 1b) along with higher SOD activity (Fig. 5a), which indicates active synthesis of PaSOD. Although PaSOD was driven by a constitutive CaMV35S promoter, the expression was higher under salt stress as compared to the control. Stress-mediated inducibility of gene, in spite of being under the control of a constitutive promoter, has been reported earlier as well by Shi et al. (2003).
Callus induction, shoot regeneration, and salt stress tolerance
Fig. 5 Evaluation of WT and PaSOD lines (S15 and S26) under control and salt stress conditions. a Superoxide dismutase (SOD) activity, b electrolyte leakage, c relative water content (RWC), d proline content, e total soluble sugar content, and f chlorophyll content. Data represent the
mean±SE of three independent experiments (n=3). Different letters on top of the bars indicate significant difference at a level of P
ORIGINAL ARTICLE
Improved callus induction, shoot regeneration, and salt stress tolerance in Arabidopsis overexpressing superoxide dismutase from Potentilla atrosanguinea Amrina Shafi & Tejpal Gill & Yelam Sreenivasulu & Sanjay Kumar & Paramvir Singh Ahuja & Anil Kumar Singh
Received: 25 February 2014 / Accepted: 27 April 2014 # Springer-Verlag Wien 2014
Abstract Superoxide dismutase (SOD) catalyzes the dismutation of superoxide radicals (O2 · −) to molecular oxygen (O2) and hydrogen peroxide (H2O2). Previously, we have identified and characterized a thermo-tolerant copper-zinc superoxide dismutase from Potentilla atrosanguinea (PaSOD), which retains its activity in the presence of NaCl. In the present study, we show that cotyledonary explants of PaSOD overexpressing transgenic Arabidopsis thaliana exhibit early callus induction and high shoot regenerative capacity than wild-type (WT) explants. Growth kinetic studies showed that transgenic lines have 2.6–3.3-folds higher growth rate of calli compared to WT. Regeneration frequency of calli developed from transgenic cotyledons was found to be 1.5– 2.5-folds higher than that of WT explants on Murashige and Skoog medium supplemented with different concentrations of
Handling Editor: Bhumi Nath Tripathi Electronic supplementary material The online version of this article (doi:10.1007/s00709-014-0653-9) contains supplementary material, which is available to authorized users. A. Shafi : T. Gill : Y. Sreenivasulu : S. Kumar : P. S. Ahuja (*) : A. K. Singh (*) Division of Biotechnology, CSIR-Institute of Himalayan Bioresource Technology, Palampur HP 176061, India e-mail: [email protected] e-mail: [email protected] A. K. Singh e-mail: [email protected] A. Shafi : P. S. Ahuja : A. K. Singh Academy of Scientific and Innovative Research, New Delhi, India Present Address: T. Gill National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institute of Health, Bldg 10 CRC, 1-5256, 9000 Rockville Pike, Bethesda, MD 20892, USA
naphthalene acetic acid (NAA) and 6-benzylaminopurine (BAP) within 2 weeks. A positive regulatory effect of PaSOD and H2O2 was observed on different stages of callusing and regeneration. However, this effect was more pronounced at the early stages of the regeneration processes in transgenic lines as compared to WT. These results clearly indicate that plant regeneration is regulated by endogenous H2O2 and by factors, which enhance its accumulation. Transgenics also exhibited salt stress tolerance with higher SOD activity, chlorophyll content, total soluble sugars, and proline content, while lower ion leakage and less reduction in relative water content, as compared to WT. Thus, it appears that the activation of PaSOD at regeneration stage accompanied by increased H2O2 production can be one of the mechanisms controlling in vitro morphogenesis. Keywords Arabidopsis thaliana . Growth kinetics . H2O2 . In vitro morphogenesis . Potentilla atrosanguinea . Shoot regeneration . Superoxide dismutase
Introduction Oxygen is essential for the existence of aerobic life. However, as a consequence of aerobic metabolism, highly toxic reactive oxygen species (ROS) are produced, which include the superoxide anion (O2 ·−), hydroxyl radical (OH·), and hydrogen peroxide (H2O2). Production of ROS is an inevitable result of the leakage of electron onto molecular oxygen in chloroplast; mitochondria and plasma membrane linked electron transport in plant cells (Asada 1994). ROS are considered to be damaging factors in plants exposed to stressful environmental conditions such as drought (Badawi et al. 2004), salinity (Munns and Tester 2008), and chilling stress (Wise and Naylor 1987). In order to protect against damaging effects
A. Shafi et al.
of ROS, plant cells have developed redox homeostatic mechanisms that scavenge ROS and keep it below harmful levels. Enhancement of antioxidant defense in plants can thus increase tolerance against different stress factors. Antioxidant defense (ROS scavengers) includes enzymes such as superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), and glutathione reductase (GR). SOD enzyme is considered as the first line of cellular defense against oxidative stress by early scavenging of superoxide radicals and converting them to hydrogen peroxide (Perl-Treves and Galun 1991). H2O2 is then disposed off enzymatically by APX or CAT or non-enzymatically by ascorbate to prevent the formation of the highly toxic hydroxyl radical (Foyer et al. 1994). Since H2O2 is most stable and probable candidate for ROSmediated signal transduction, it has ability to cross the membrane barrier and reach the site of action due to its uncharged nature (Foyer et al. 1997). H2O2 can act as a signaling molecule that regulates plant development, stress adaptation, and programmed cell death (Klaus and Heribert 2004). Thus, it is a cellular secondary “messenger” capable of inducing gene expression and protein synthesis and promoting somatic embryogenesis and in vitro shoot regeneration (Cui et al. 1999; Luo et al. 2001; Papadakis and Roubelakis-Angelakis 2002; Libik et al. 2005). Regeneration process is controlled by various genes whose expression is governed by certain physical and chemical conditions (Imani et al. 2001; Papadakis et al. 2001). So far, in vitro regeneration has been achieved by a variety of means including treatment with plant growth regulators (PGR), temperature shocks, osmotic stress, and through application of various chemical substances (Szechynska-Hebda et al. 2007; Touraev et al. 1997; Zavattieri et al. 2010). The consequence of these processes has been generally considered as ROS overproduction, which is detrimental for plant as such (Scandalios 1997). However, recent pieces of evidence suggest that ROS participate in signal transduction cascade (Prasad et al. 1994) and have a positive role in plant growth and development (Tian et al. 2003). A change in the activity of antioxidant enzymes has also been detected during in vitro shoot initiation and development (Batkova et al. 2008; Gupta 2010). Several groups have reported the involvement of H2O2 in in vitro regeneration of plants (Cui et al. 1999; Luo et al. 2001; Papadakis et al. 2001; Tian et al. 2003; Libik et al. 2005; Zheng et al. 2005). Furthermore, it has been reported that the cytosolic Cu/ZnSOD was induced in regenerating tobacco protoplasts (Papadakis et al. 2001), which supports the hypothesis that SOD is involved in plant morphogenesis. One possible link between oxidative stress and plant morphogenesis could be H2O2 that may serve as a signaling molecule to mediate cellular response during plant morphogenesis, since several studies have implicated H2O2 in this process (Cui et al. 1999; Luo et al. 2001; Papadakis and Roubelakis-Angelakis 2002;
Libik et al. 2005). However, the effect of overexpression of SOD on callus growth and in vitro morphogenesis has not been studied, yet. Salinity results in osmotic and ionic stresses. Osmotic regulation is an important mechanism for plant cellular homeostasis in saline conditions. Under salt stress, plants accumulate several compatible solutes in the cytosol, such as polyols, betaine, trehalsose, ectoine, proline, and others (Hasegawa et al. 2000). Proline is one of the most efficient compatible solutes, which play an important role in osmotic balancing and in increasing the turgor pressure, necessary for cell expansion (Hasegawa et al. 2000; Matysik et al. 2002). The reactive oxygen species that are by-products of hyperosmotic and ionic stresses cause membrane dysfunction, ion leakage, and cell death (Bohnert and Jensen 1996). The present study was aimed to investigate the role of PaSOD and H2O2 on callus growth and in vitro regenerative capacity of the PaSOD transgenic plants. Here, we show that overexpression and changes in the activity of PaSOD in Arabidopsis affect the endogenous H2O2 levels, resulting in enhanced callus induction and shoot regeneration capacity. Our results suggest that proper maintenance of redox homeostasis is crucial for successful regeneration at the early stages of shoot organogenesis.
Materials and methods Plasmid construction and transgenic plant development Previously, a full length complementary DNA (cDNA) of Potentilla atrosanguinea copper-zinc superoxide dismutase (PaSOD), which retains catalytic activity in the presence of NaCl (Kumar et al. 2002), was overexpressed in Arabidopsis thaliana as described by Gill et al. (2010). Briefly, coding nucleotide sequences was amplified using the gene specific primers with incorporated NcoI and BglII restriction sites at the tails. PCR products were cloned into a cloning vector pGEMT easy (Promega) and then subcloned into binary plant vector pCAMBIA1302 under the cauliflower mosaic virus 35S promoter (Fig. 1a). The prepared plasmid construct was mobilized into Agrobacterium tumefaciens strain GV3101 and used for plant transformation. Arabidopsis plants (5 weeks old) were infected with the A. tumefaciens via vacuum infiltration method (Bechtold et al. 1993) and grown in the greenhouse. The collected seeds were screened on Murashige and Skoog (1962) medium supplemented with 20 μg ml−1 hygromycin. Homozygous (T3 generation) transgenic PaSOD lines (S26 and S15) were screened for integration of genes in the host genome, using gene specific primers with PCR conditions as mentioned in Table 1. Total RNA was isolated from transgenic and the wild-type Arabidopsis plants using Total RNA Extraction Kit (Real
Callus induction, shoot regeneration, and salt stress tolerance Fig. 1 Overexpression of PaSOD in Arabidopsis improved callus induction. a Schematic representation of construct showing T-DNA region with different constituents and the position of introduced PaSOD in between NcoI and BglII restriction sites. b Expression analysis of PaSOD gene under control (0 mM NaCl) and salt stress (100 mM NaCl) in WT and transgenic lines. 26S rRNA was used as a reference gene. c Transgenic lines S15 and S26 showed higher growth of calli as compared to WT. The growth curve analysis of callus, based on d dry weight (DW mg/l) and e fresh weight (FW mg/l), which were determined every 2 days after inoculation. Bar indicates the standard deviation (n=3)
Genomics). One microgram of total RNA was used for oligo (dT) primed first-strand cDNA synthesis in 20-μl reaction using Superscript III reverse transcriptase (Invitrogen). This cDNA was used in 27-cycle PCR using gene specific primers for PaSOD gene. Constitutively expressed 26S rRNA gene was amplified simultaneously in 27 cycles to ensure equal amounts of template cDNA used. Plant growth, callus induction, and regeneration Arabidopsis seeds were surface sterilized, sown in petri dishes containing Murashige and Skoog (MS) medium. The plates were kept at 4 °C for 2 days and then shifted to 21±1 °C. After 10 days of germination, cotyledons were excised from seedlings and cut into two pieces and placed on MS callus induction medium containing 30 g l−1 sucrose and 8.0 g l−1 agar (Sigma-Aldrich, St. Louis, MO, USA), supplemented with 1 mg l−1 2,4dichlorophenoxyacetic acid (2,4-D) (Sigma-Aldrich, St. Louis, MO, USA). The explants were cultured in the dark at 25±2 °C.
Callus formation started after 1 week of inoculation on callus induction medium. After 1 month, compact proliferating callus was selected and transferred to fresh MS medium with 1.0 mg l−1 2,4-D, 30 g l−1 sucrose, and 8.0 g l−1 agar. After 1-month subculture, proliferating callus was transferred to regeneration medium (half strength MS medium with 30 g l−1 sucrose, 8.0 g l−1 agar, supplemented with 0.5–1.0 mg l−1 2,4-D, and 0.5–1.0 mg l−1 benzylaminopurine (BAP) (Sigma-Aldrich, St. Louis, MO, USA) for regeneration in a culture room with a 16-h photoperiod (60–70 μmol m−2 s−1 cool white fluorescent irradiance) for 4 weeks at 25±2 °C. Callus with clearly differentiated shoots were counted as regenerated, with each piece of callus counted as one unit. After 4 weeks, the regenerated plantlets were transferred to 100-ml flasks containing the same medium for further growth. SOD activity and H2O2 content were determined at different stages of culture. Regeneration frequency was calculated as the number of regenerated explants per total number of cultured explants. Three replications were used in each experiment.
Table 1 Primer sequence, PCR conditions, and amplicon size for the PaSOD and 26S rRNA (reference gene) used for semiquantitative PCR Gene
Sequence 5′-3′
PCR conditions
Amplicon size (bp)
PaSOD
F:CCATGGATGGCAAAGGGCGTTGCTG R:TCTAGATCCTTGAAGGCCAATAATACC F:CACAATGATAGGAAGAGCCGAC R:CAAGGGAACGGGCTTGGCAGAATC
94 °C, 4 min; 94 °C, 1 min, 56 °C, 30 s, 72 °C, 1 min, 27 cycles; 72 °C, 7 min 94 °C, 4 min; 94 °C, 1 min, 57 °C, 30 s, 72 °C, 1 min, 27 cycles; 72 °C, 7 min
456
26S rRNA
534
A. Shafi et al.
Callus growth measurement Following callus induction after 3 weeks of culture, callus was aseptically transferred onto liquid medium in culture flasks. The flasks were incubated in the dark at 27±1 °C for 4 weeks. Growth kinetics was studied by determination of fresh and dry weights of fresh callus of 5, 10, 15, 20, 25, and 30 days old. Dry weight of fresh callus was determined after drying in a vacuum oven at 65 °C until constant weight. The cultures were incubated for 16-h photoperiods at 25 °C. SOD enzyme activity assay Total SOD activity was estimated as intensity of nitro blue tetrazolium (NBT) reduction using spectrophotometer as described earlier (Gill et al. 2010). Briefly, leaf samples (100 mg) were homogenized in a precooled mortar in homogenizing buffer containing 2 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.5 % (v/v) Triton-X100, and 10 % (w/v) PVPP in 50 mM phosphate buffer pH 7.8. The homogenate was transferred to 1.5-ml microfuge tube and centrifuged at 13,000 rpm for 20 min at 4 °C. The supernatant was collected, and total SOD activity was estimated. The total SOD activity was measured by adding 5-μl enzyme extract to a reaction mixture (200 μl) containing 1.5 μm riboflavin, 50 μm NBT, 10 mM DL-methionine, and 0.025 % (v/v) Triton-X100 in 50 mM phosphate buffer. One unit of enzyme activity was defined as the amount of enzyme required for 50 % inhibition of NBT reduction per min at 25 °C. Specific activity of SOD was calculated accordingly. Protein content was estimated according to the dye-binding method of Bradford using BSA as standard. Determination of H2O2 content by peroxidise-coupled assay The level of H2O2 was measured following Sonja et al. (2002) method with some modifications. Arabidopsis leaves (100 mg) were ground to a fine powder in liquid nitrogen, and the powder was extracted in 2 ml 1 M HClO4. Extraction was performed in the presence of insoluble PVP (5 %). Homogenates were centrifuged at 12,000×g for 10 min at 4 °C, and the supernatant was neutralized with 2.5 M K2CO3 to pH 5.6 in the presence of 100 μl 0.1 M phosphate buffer (pH 5.6). The homogenate was centrifuged at 12,000×g for 1 min to remove KClO4. The sample was incubated prior to assay for 10 min with 1 U ascorbate oxidase (Sigma-Aldrich, India) to oxidize ascorbate. The reaction mixture consisted of 0.1 M phosphate buffer (pH 6.5), 3.3 mM 3-(dimethylamino)benzoic acid (DMAB), 0.07 mM 3-methyl-2-benzothiazoline hydrazone (MBTH), and 50 ng horseradish peroxidase (POX) (Sigma-Aldrich, India). The reaction was initiated by addition of an aliquot (50 or 100 μl) of the sample. The absorbance change at 590 nm was monitored at 25 °C. For each assay, H2O2 contents in the extract
were quantified by reference to an internal standard (1.5 nmol H2O2, added to the reaction mixture on completion of the absorbance change due to the sample). Microscopy Explants were collected at 0, 1, 2, 3, and 4 weeks from initiation and evaluated using scanning electron microscopy (SEM) and light microscopy (LM). Samples were fixed in formalin, glacial acetic acid, and 50 % ethyl alcohol (FAA) (1:1:18) at room temperature. Samples were subsequently dehydrated in a tertiary butyl alcohol series, embedded in paraffin (melting point 58–60 °C), and 8–10-mm thick sections were cut using a Finesee microtome. Sections were stained with 1 % safranin in water and with 4 % fast green in clove oil for 4 h and for 30 s, respectively. These were mounted in Canada balsam and examined using bright field microscope (Zeiss LSM510 meta GmbH, Germany) equipped with a Zeiss Axiovert 100 M inverted microscope. For SEM analysis, samples were fixed in two steps: first with a mixture of 2 % paraformaldehyde and 2.5 % glutaraldehyde in 0.1 mol/l cacodylate buffer, pH 7.4 for 1 h and then with 1 % OsO4 in 0.1 mol/l cacodylate buffer, pH 7.4 for 30 min. After critical point drying, the samples were sputtercoated with gold, and the coated samples were viewed with a Hitachi S-3400N field emission SEM using an accelerating voltage of 30 kV. For tracking different stages of regeneration in WT and PaSOD lines, samples at each stage were collected and visualized under stereoscope (Zeiss meta Gmbh, Germany). Evaluation of salt stress tolerance Seeds of transgenic lines (T3) overexpressing PaSOD (S26 and S15) and WT were grown in MS medium for 10 days and transplanted thereafter to the mixture of vermiculite/peat moss/perlite (1:1:1) in the greenhouse under a 16-h light and 8-h dark cycle at 20±1 °C. For stress treatment, 21-day-old seedlings of WT and transgenics were supplemented with desired concentration of NaCl (0, 50, 100, and 150 mM). Three biological replicates were collected from each sample at respective time points after salt stress.
Estimation of electrolyte leakage, relative water content, total soluble sugars, proline, and chlorophyll content Electrolyte leakage was measured using an electrical conductivity meter as described by Lutts et al. (1996). Relative water content (RWC) was measured according to Barrs and Weatherley (1962). Total soluble sugar (TSS) content was determined by anthrone method. Free proline content was estimated using the acid ninhydrin method described by
Callus induction, shoot regeneration, and salt stress tolerance
Bates et al. (1973). Chlorophyll content was estimated by the method of Arnon (1949). Statistical analysis All experiments were conducted with at least three independent repetitions in triplicate. All values are shown as the mean±standard deviation. The statistical analysis was performed using Statistica software (v.7). The statistical significance between the mean values was assessed by Analysis of Variance (ANOVA) applying Duncan’s multiple range test (DMRT). A probability level of P≤0.05 was considered significant.
Results and discussion Confirmation and expression analysis of PaSOD in Arabidopsis Agrobacterium-mediated transformation was used to overexpress PaSOD in Arabidopsis, and 29 independent transgenic lines (T1) were taken to T2 generation. Out of these lines, two single copy insertion lines with high SOD activity (S15 and S26) were selected for further analysis. Selection on hygromycin plate confirmed these lines to be homozygous in T3 generation. Semiquantitative RT-PCR analysis confirmed overexpression of PaSOD in the transgenic lines (Fig. 1b). Variation in transgene expression is a frequently seen phenomenon (Schubert et al. 2004) and has been hypothesized to be due to different integration sites of the transgene which is influenced by the chromatin type, position effects, or due to the interaction of these factors (Tang et al. 2003). PaSOD calli have early and enhanced growth rates than WT calli in suspension culture Callus initiation is the primary stage in many tissue culture processes for the establishment of cell suspension cultures (Kumar and Kanwar 2007; Ngara et al. 2008). This study was aimed to determine the difference in callus growth kinetics between WT and PaSOD lines. The growth of callus was determined based on the fresh and dry weights of the cultures. Growth kinetics showed a typical curve with lag phase, exponential phase followed by stationary phase after incubation. The pattern of the growth curve obtained in WT and PaSOD lines was different (Fig. 1d, e). Upon transferring the calli of PaSOD lines (S26 and S15) to the suspension medium, very little increase in biomass was observed during the first 4 days of culture (the lag phase). After 6 days of culture, the calli were found in their exponential phase as the cells rapidly divided and proliferated. After 14 days, culture reached the
stationary phase. While in WT, exponential phase began after 14 days of incubation and stationary phase was reached after 22 days. Growth rates during the exponential phase in WT, S15, and S26 lines were 0.22, 0.57, and 0.73 g (dry weight)/ day, respectively, (Fig. 1d) while on the basis of fresh weight, growth rates during the exponential phase in WT, S15, and S26 were 0.38, 0.98, and 1.22 g (fresh weight)/day, respectively (Fig. 1e). These results clearly demonstrate that growth rate of PaSOD calli was significantly higher than that of WT calli. Callus induction and in vitro regeneration frequency vary between WT and PaSOD lines In the present study, cotyledons of WT and PaSOD Arabidopsis plants were used as explants due to their high regeneration potential as suggested by various previous studies (Ozcan et al. 1992; Patton and Meinke 1988; Mante et al. 1989). To find out whether PaSOD plays a role in de novo organ regeneration, we compared the developmental rates of shoot regeneration between WT and the PaSOD transgenic explants. In the case of WT explants, callus induction started within 7 days of culturing on MS media supplemented with 1 mg l−1 2,4-D, while callus induction from PaSOD explants was observed within 3–4 days on the same media (Fig. 2A, F, K). Histological sections during early stages of callus formation revealed that parenchyma cells in the subepidermal region resumed meristematic activity and produced an undifferentiated mass of cells called primary callus (Fig. 2a, f, k). It was also observed that the fresh and dry weights and the diameter of calli were 1.5–2-folds higher in PaSOD lines as compared to that of WT (Fig. 1c, d, e; Table 2). Calli from both WT and PaSOD lines regenerated shoots when cultured on the regeneration media with different concentrations of BAP and NAA (Table 2). Transfer of callus to regeneration media led to the formation of meristemoids (Fig. 4Cc, Gg, Ll). The meristemoids (nodules or growth centers) are localized clusters of cambium-like cells which may become vascularized due to the appearance of tracheid cells in the center. Formation of meristemoids in callus cultures may represent their association with an early stage development of shoot bud (Kulchetscki et al. 1995). However, an early shoot initiation response was observed from the PaSOD calli as compared to WT calli on the regeneration medium containing 0.5 mg l−1 NAA and 1.0 mg l−1 BAP. After 2 weeks on the regeneration medium, shoot meristem appeared in approximately 70 % PaSOD calli (Fig. 2h, m). Whereas in the case of the WT calli, such shoot meristems could be identified only after 3 weeks of culturing on the regeneration medium (Fig. 2Dd). Electron micrographs also depicted the same results where shoot primordia were observed much earlier in PaSOD line (Fig. 3q) as compared to WT calli (Fig. 3k). Histological sections revealed that apical meristem of PaSOD
A. Shafi et al.
Fig. 2 Light micrographs showing the early stages of callus induction and plant regeneration in WT and PaSOD lines, (S15 and S26) cotyledon explants cultured on media supplemented with 0.5 mg l−1 NAA and 1 mg l−1 BAP. A, F, K non-embryogenic callus showing the loose structure. B, G, L callus with a very compact, nodular greenish structure. H, M initiation of shoot regeneration in S26 and S15 lines. I, N regenerated callus with multiple shoots after 3 weeks, and J, O well-established shoot clusters 4 weeks after transfer to the regeneration medium.
Histological sections of shoot base-derived regenerating callus with emergence of shoot meristemoids, after 1 week of culture (c, g, l) and section of callus with regenerating shoot and vascular connection (j, o). Black arrows indicate callus differentiation in S26 (g, h, i) and S15 (l, m, n) lines (c, d, e). Red arrows indicate vascular connection of regenerating shoot apex with parent calli, which appeared earlier in S26 and S15 lines as compared to WT. Bars=50 μm
Table 2 Callus induction and shoot regeneration from WT and transgenic lines Average diameter (mm) of calli in MS media
Percent shoot regeneration in primary calli
Lines
MS1
MS2
MS3
MS4
MS1
MS2
MS3
MS4
WT S26 S15
5.16±0.06h 8.82±0.09c 6.14±0.06f
6.86±0.11d 14.3±0.13a 10.3±0.13b
4.36±0.09i 6.44±0.06e 5.5±0.06g
4.16±0.06i 6.68±0.13d 6.02±0.08f
24.8±0.48h 59.6±0.65c 35±0.70e
31.2±0.48f 79.8±0.85a 63±1.22b
20.2±0.48i 34.8±0.48e 30.6±0.31f
14.8±0.48j 37.2±0.48d 27.6±0.32g
Each value represents mean ± SE of five replicates for each parameter. The induction media contained 1 mg l−1 2,4-D and regeneration media supplemented with BAP and NAA in different concentrations, MS1 (0.5 mg l−1 NAA/0.5 mg l−1 BAP), MS2 (0.5 mg l−1 NAA/1 mg l−1 BAP), MS3 (1 mg l−1 NAA/0.5 mg l−1 BAP) and MS4 (1 mg l−1 NAA/1 mg l−1 BAP). In each section of the table, means were compared with ANOVA and data followed by the same letters within the columns are not significantly different at the level of P≤0.05, as determined by a least-significant difference (LSD)
Callus induction, shoot regeneration, and salt stress tolerance
Fig. 3 Light and scanning electron micrographs of different types of regenerating structures of Arabidopsis cotyledon explants, cultured on media supplemented with 0.5 mg l−1 NAA and 1 mg l−1 BAP in WT (a–l) and S26 (m–x) transgenic line. a, d, m, p Callus formed on 2,4-D containing media. h, n, k, q Leaf surface at 1 week on induction medium showing rounded protrusions. i, o, l, r Bud development with shoot meristems at 2 weeks after induction. s, v Non-synchronous development
of numerous shoots with meristems and leaf primordia at 3 weeks on regeneration medium. f, w Numerous elongated structures with varying degrees of apical development at 4 weeks on regeneration medium. Red arrows indicate elongated structures with club-like (q) and meristem development at apical areas (w) formation in S26 line and in WT (k, l), also at 4 weeks on regeneration medium
line exhibits tunica-corpus organization and parenchymatous cells subtended to apical meristem regions (Fig. 2h, m). After 3 weeks on the regeneration medium, more shoot meristems and primordia emerged from the PaSOD calli than those from the WT calli (Fig. 2i, n). After 4-week incubation on the regeneration medium, the percentage of shoots from the PaSOD calli was much higher than that of the WT calli (Fig. 2Jj, Oo; Table 2). Adventitious shoots with leaf primordia were numerous in the case of PaSOD line (Fig. 2i, n) and had provascular strands (Fig. 2j, o). Along with higher morphogenic potential of S26 and S15 lines, they also had phenotypically higher number of shoots as compared to WT (Fig. 4a). Similarly, in a previous report, higher regeneration efficiency was observed in transgenic pepper plants carrying SOD gene as compared to the wild type (Chatzidimitriadou et al. 2009).
PaSOD activity and H2O2 content differ at various stages of culturing in WT and PaSOD lines In order to determine the possible involvement of SOD and H2O2 in the callus induction and regeneration in Arabidopsis cultures, we measured changes in both H2O2 content and SOD activity. SOD functions in the removal of the superoxide radical, simultaneously producing H2O2 as a reaction product (Alscher et al. 2002). In the present study, SOD activity was found to vary among WT and PaSOD lines at each stage of culturing. SOD levels were found to be decreased in calli comparing to that of cotyledon stage, then increased in regenerated shoots and roots (Fig. 4b). In the case of PaSOD lines, SOD activity was found to be higher than that of WT at all the stages. However, the increase in the SOD activity of PaSOD lines as compared to WT was more during the regeneration
A. Shafi et al.
expression of SOD in a specific developmental manner has also been observed (Papadakis et al. 2001; Racchi et al. 2001). Endogenous H2O2 content was also estimated in WT and PaSOD lines, and it was observed that its level also varied with different stages of culturing (Fig. 4c). Difference in H2O2 content between calli and regenerated shoots was also evident in both WT and PaSOD lines, but content was higher in PaSOD lines than WT. In our study, PaSOD activity and H 2 O 2 contents were found to be highest at shoot regeneration stage both in WT and PaSOD lines which was also reported by Tian et al. (2003), where H2O2 levels and SOD activity increased during early phases of shoot regeneration. Transgenic explants with increased SOD activities and H2O2 production were highly regenerative, whereas explants with decreased SOD activities and H2O2 production were poorly regenerative (Fig. 4a, b, c). High regeneration capacity was observed in strawberry calli which had higher levels of H2O2 compared to calli which showed lower regeneration capacity (Tian et al. 2004). A modification in endogenous H2O2 content can be regarded as one of the early responses of the explant, possibly related to the ability to regenerate. H2O2 has been implicated as a potential mediator between oxidative stress and plant morphogenesis in vitro (Cui et al. 1999; Luo et al. 2001; Papadakis and Roubelakis-Angelakis 2002; Pua and Gong 2004). However, it is not clear if H2O2 is the cause or the consequence of plant morphogenesis. Calli with low CAT activity and high H2O2 concentration displayed a regeneration potential which might support the hypothesis that the H2O2 produced in excess may promote the expression of some genes responsible for the induction of morphogenesis processes (Libik et al. 2005). Numerous studies have been reported relating to the variation in the patterns of the antioxidant enzyme activity during different stages of organogenesis (Franck et al. 1998; Chen and Ziv 2001; Racchi et al. 2001; Meratan et al. 2009; Vatankhah et al. 2010). Thus, we make a hypothesis that in PaSOD lines, enhanced shoot regeneration rates are associated with higher H2O2 accumulation due to Cu/ Zn-SOD overexpression. PaSOD lines exhibit improved salt stress tolerance
Fig. 4 Number of regenerating shoots (a), superoxide dismutase activity (b) and H2O2 content (c) in WT and PaSOD lines (S15 and S26) during in vitro culturing on regeneration media supplemented with BAP and NAA in different concentrations: MS1 (0.5 mg l−1 NAA/0.5 mg l−1 BAP), MS2 (0.5 mg l−1 NAA/1 mg l−1 BAP), MS3 (1 mg l−1 NAA/ 0.5 mg l−1 BAP), and MS4 (1 mg l−1 NAA/1 mg l−1 BAP)
stages. Similar observations have also been reported earlier by few groups (Bagnoli et al. 1998; Cui et al. 1999). The
Transgenic PaSOD lines and WT were evaluated under salt stress for tolerance by estimation of SOD activity, accumulation of compatible solutes, membrane damage, and electrolyte leakage under control and at different levels of NaCl stress. The PaSOD lines maintained higher transcript levels of PaSOD under 100 mM salt stress (Fig. 1b) along with higher SOD activity (Fig. 5a), which indicates active synthesis of PaSOD. Although PaSOD was driven by a constitutive CaMV35S promoter, the expression was higher under salt stress as compared to the control. Stress-mediated inducibility of gene, in spite of being under the control of a constitutive promoter, has been reported earlier as well by Shi et al. (2003).
Callus induction, shoot regeneration, and salt stress tolerance
Fig. 5 Evaluation of WT and PaSOD lines (S15 and S26) under control and salt stress conditions. a Superoxide dismutase (SOD) activity, b electrolyte leakage, c relative water content (RWC), d proline content, e total soluble sugar content, and f chlorophyll content. Data represent the
mean±SE of three independent experiments (n=3). Different letters on top of the bars indicate significant difference at a level of P
