Plant Molecular Biology 20: 289-299, 1992. © 1992 Kluwer Academic Publishers. Printed in Belgium.

289

Import and processing of the precursor of the Rieske FeS protein of tobacco chloroplasts F. Maduefio 1, J.A. Napier 1'3, F . J . C e j u d o 2 and J.C. Gray 1 1Department of Plant Sciences and Cambridge Centre for Molecular Recognition, University of Cambridge, Downing Street, Cambridge CB2 3EA, UK; 2 The Sainsbury Laboratory, John Innes Centre, Colney Lane, Norwich NR4 7UH, UK; 3present address: AFRC Institute of Arable Crops Research, Long Ashton Research Station, Long Ashton, Bristol BS18 9AF, UK Received 10 December 1991; accepted in revised form 13 May 1992

Key words: chloroplast, cytochrome bf complex, presequence, Rieske FeS protein, stromal processing peptidase

Abstract

cDNA clones encoding the precursor of the Rieske FeS protein of tobacco chloroplasts have been characterised and shown to derive from two different genes. The 5' ends of the corresponding transcripts have been cloned using primer extension and PCR. The nucleotide sequences of the cDNAs (and their 5' extensions) predict precursors for the tobacco proteins which differ in 4 amino acid residues out of a total of 228 residues and show high homology with the pea and spinach precursors. The tobacco precursor proteins contain N-terminal presequences of 49 amino acid residues which lack 17 amino acid residues present at the N-terminus of the spinach presequence. The 26 kDa precursor obtained by transcription and translation of one of these cDNAs in vitro was efficiently imported and correctly processed to the mature 20 kDa protein by isolated pea or tobacco chloroplasts. The precursor was also processed to its mature size by a peptidase present in the stroma of chloroplasts.

Introduction

The Rieske FeS protein is a component of the cytochrome bf complex of the chloroplast thylakoid membrane [13, 14]. The Fe2S2 centre receives electrons from plastoquinol and transfers them to the haem iron of cytochrome f. DBMIB, a plastoquinol analogue which inhibits the plastoquinol-plastocyanin oxidoreductase activity of

the cytochrome bf complex, binds close to the Rieske F e 2 S 2 centre and results in a characteristic change in the EPR signal [20, 21]. The isolated Rieske protein is a hydrophobic protein of 1920 kDa, whose primary structure has been determined partially by amino acid sequencing [29] and completely by deduction from nucleotide sequences ofcDNA clones [28, 31, 36]. The mature protein contains an extended region ofhydropho-

The DNA sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession numbers X66009 (cDNA TR3) and X66010 (TR6).

290 bic residues near the N-terminus, and highly conserved regions containing cysteine and histidine residues near the C-terminus [28, 29, 31, 36]. The hydrophobic residues are proposed to hold the protein in the thylakoid membrane by forming one or two transmembrane e-helices [ 36, 39]. The topology of the polypeptide chain in the membrane has not yet been established [39]. The conserved cysteine and histidine residues are proposed to provide the ligands to the Fe2S2 centre [8, 36], which is situated on the luminal side of the thylakoid membrane where it can transfer electrons to cytochrome f. The Rieske protein is encoded by single-copy nuclear genes in spinach [37] and pea [31]. Translation ofcytosolic poly(A) + RNA produces a 26-27 kDa precursor [ 1, 31 ] which is imported by chloroplasts and processed to the mature size [31,3]. The spinach precursor contains an N-terminal presequence of 68 amino acid residues [36], with an N-terminal extension of 17 amino acid residues which is not present in either the pea or tobacco presequences [31, 28]. However, the pea cDNA encodes a precursor protein which is fully competent for import by intact chloroplasts in vitro [31 ]. The imported pea protein is inserted into the thylakoid membrane and integrated into the cytochrome bf complex in intact isolated pea chloroplasts [26]. Little is currently known about the assembly of the cytochrome bf complex, or its regulation, in higher plants. Studies of a Lemna mutant lacking the Rieske FeS centre [22] demonstrated the absence of all the polypeptides of the cytochrome complex [ 19]. This mutant failed to produce transcripts of the Rieske protein gene and, although the chloroplast-encoded polypeptides were synthesised, they were rapidly degraded [5]. These studies indicate the importance of the Rieske protein in regulating the assembly of the cytochrome complex. In order to investigate more fully the role of the Rieske protein in this process in higher plants, we wished to manipulate the levels of the protein in transgenic tobacco plants and examine the consequences for the assembly of the cytochrome complex. In this paper we describe the characterisation of cDNA clones for the Rieske FeS protein from tobacco chloro-

plasts, and show that the encoded precursor proteins are competent for import by isolated chloroplasts.

Materials and methods

Screening of cDNA library A tobacco leaf cDNA library in 2gtll was provided by Catherine Smart, IPSR Cambridge Laboratory, John Innes Centre, Norwich. The library was screened at a density of 200000 pfu per 23 cm x 23 cm dish by hybridization with a 32p_ labelled cDNA probe encoding the pea Rieske FeS protein [31]. Hybond-N nylon membranes (Amersham) were placed on the surface of the plate for 1 or 7 rain (replica filter) followed by denaturing, probing and washing as recomended by the manufacturer. The 0.9 kb pea cDNA used as a probe was labelled by the method of Feinberg and Vogelstein [7].

Cloning procedures and sequence analysis Restriction endonucleases and T4 DNA ligase were purchased from Boehringer Corporation (London) and used according to the manufacturer's recomendations. DNA was prepared from recombinant 2gtll clones as described by Sambrook et al. [32], and, after digestion with Eco RI, the cDNA inserts were subcloned into the Eco RI site of pUC18 for restriction analysis and sequencing. The nucleotide sequence was determined using the dideoxynucleotide chain-termination method of Sanger et al. [33]. Oligonucleotide primers for sequencing and for the primer extension experiment were made using an Applied Biosystems 380B DNA synthesiser.

Preparation of genomic DNA and Southern blotting Genomic DNA from tobacco leaves was extracted as described by Smith et al. [35]. Genomic DNA samples (10 #g) were digested for 16 h with

291 restriction enzymes (100 units) in a final volume of 400/21, then precipitated with ethanol and finally resuspended in 10 #1 of TE (10 m M TrisHC1 pH 8.0, 1 mM Na2EDTA). These samples were subjected to electrophoresis in a 0.770 agarose gel. After ethidium bromide staining and visualisation on a short-wave UV transilluminator the D N A was capillary blotted to GeneScreen Plus (DuPont) according to the manufacturer's recommendations. Probing of the membrane was carried out at 65 °C following the manufacturer's recommendations in a Hybaid Oven using 32p_ labelled TR3 c D N A as a probe.

Preparation of poly(A) + RNA and northern analysis Poly(A) + tobacco RNA was extracted from young developing leaves essentially as described by Apel and Kloppstech [2]. Poly(A) + RNA was denatured and electrophoresed on a 1.2~o agarose gel containing formaldehyde [32]. The RNA was capillary-blotted onto a Hybond-N membrane (Amersham) in 25 m M sodium phosphate pH 6.4 and probed with 32P-labelled TR3 c D N A at 42 °C in the presence of 47~o formamide. Washes were carried out at 42 ° C with 0.1 x S SC,

0.5% SDS.

were resolved in a 6 70 polyacrylamide-7 M urea sequencing gel, which was exposed to film without being allowed to dry. Bands containing the primer extension products were excised from the gel and the D N A eluted from them as described by Maxam and Gilbert [23]. G-tailing of the primer extension products was conducted by supplementing 25 #1 of the c D N A solutions extracted from the gel with 1 #1 of 1 mM dGTP, 7 #1 of 5 x terminal transferase buffer (BRL) and 2 #1 (30 U) of terminal deoxynucleotidyl transferase (BRL). After 30 min at 37 ° C, the reactions were stopped by adding EDTA pH 8.0 to 20 mM final concentration and incubating at 65 ° C for 10 rain. Polymerase chain reactions were carried out using as substrate essentially all the G-tailed primer extension product obtained, 65 pmol of each primer and 1 unit of Taq polymerase (NBL) in a volume of 50/~1. The temperature cycle employed was 15 s at 94 °C, 30 s at 52 °C and 1 min at 72 °C; this cycle was repeated 30 times and then the reactions were incubated at 72 °C for 10 min. The oligonucleotide used for the initial primer extension reaction was 32p end-labelled using T4 polynucleotide kinase [32] in a reaction which contained 100ng of the oligonucleotide and 200 #Ci of 7-[32P] ATP. The Hpa I digest of pBR322 was 32p-labelled with Klenow fragment of D N A polymerase I [ 33 ] in a reaction containing 2 #g of D N A and 60 #Ci of ~_[32p] ATP.

Primer extension The primer extension used M-MLV H - (Superscript) reverse transcriptase (Gibco-BRL) in a reaction containing: poly(A) + RNA (2#g), 106 dpm of 32p-end-labelled primer, 25 nmol of each of four dNTPs, and 200 nmol of DTT, in a volume of 14/21 of Superscript reverse transcriptase buffer (Gibco-BRL). The reaction mixture was heated at 70 °C for 5 min and allowed to anneal at 50 °C for 30 min. Reverse transcriptase (200 units in a volume of 1 #1) was added and the reaction incubated at 42 °C for 90 min. Products of this reaction, together with a 32p_ labelled HpaI digest of pBR322 (about 20 000 dpm per lane) as molecular size marker,

Transcription and translation in vitro RNA was transcribed from the pSP65 plasmid containing the 0.8 kb TR3 c D N A Eco RI insert using SP6 polymerase, as described by Newman and Gray [27], with the plasmid in the supercoiled state. RNA was used to programme a wheat germ translation system (Amersham) according to the manufacturer's instructions, in the presence of L-[35S]-methionine (50#Ci, 1200 mCi/mmol). Translation products were examined by electrophoresis on 15~o polyacrylamide gels in the presence of SDS [18] followed by fluorography [4].

292

Protein import into chloroplasts Import reactions were carried out essentially as described by Newman and Gray [27]. Intact pea chloroplasts were isolated from 10-day-old pea shoots by differential centrifugation and then purified on a 40~o/85~o Percoll stepped gradient. Intact tobacco chloroplasts were isolated from young leaves (5-8 cm long) by the same method. Each import reaction contained 25 #g of chlorophyll and the [35S]-methionine-labelled products of the translation reaction. Import was performed in the presence of 1 mM methionine in a final volume of 100 #1 of import buffer (50 mM HepesKOH pH 8.0, 330 mM sorbitol) for 30 min at 20 ° C. Thermolysin (100 #g/ml final concentration) was added and incubated for 30 min on ice before intact chloroplasts were reisolated through 40~o Percoll. The chloroplasts were washed in import buffer, resuspended in SDS-sample buffer and analysed on 15~o polyacrylamide gels in the presence of SDS [18].

Processing by stromal extracts Stromal extracts for processing experiments were obtained by lysing intact isolated pea chloroplasts in 10 mM Hepes-KOH pH 8.0 at a chlorophyll concentration of 0.8 mg/ml for 5 rain in ice. Thylakoid membranes were removed by centrifugation at 13 000 x g for 5 min and the clear supernatant was used immediately or stored at - 140 ° C. Processing experiments were carried out in a volume of 15 #1 with 10 #1 stromal extract and 4 x 10 4 dpm 35S-labelled precursor in 25 m M Hepes-KOH pH 8.0, 1 m M MgC12 at 20 °C for 30 min.

Results

Identification of cDNA clones A tobacco leaf c D N A library in 2gtll was screened by hybridisation with a 32P-labelled c D N A encoding the pea chloroplast Rieske FeS

protein [ 31], and about 800 plaques out of 200 000 gave a positive signal. Six of these clones were plaque-purified and D N A was isolated from them. Restriction analysis showed that all six contained an Eco RI insert, and these ranged in size from ca. 0.75 to 0.85 kb. About 250 bp of nucleotide sequence was determined at each end of all six clones, and, in all the cases, the deduced amino acid sequences showed homology with both pea and spinach Rieske FeS proteins. Two slightly different nucleotide sequences could be distinguished between the analysed clones, two clones representing one type and four clones representing the other. The entire nucleotide sequences of the longest clones of each type (TR3 and TR6) were determined (Fig. 1). The nucleotide sequence of TR3, the c D N A clone with the longest 5' end, contains a long open reading frame of 684 nucleotides encoding a protein of 228 amino acid residues showing extensive homology to spinach and pea Rieske FeS proteins (Fig. 2). The nucleotide sequence of TR6, although containing a longer 3' end than TR3, is 21 nucleotides shorter at the 5' end than TR3 and does not contain a complete open reading frame.

Cloning the 5' ends of the transcripts The polypeptide deduced from the nucleotide sequence of TR3 is the same size as the pea Rieske FeS protein but is 17 amino acids shorter at the N-terminus than the precursor predicted for the spinach Rieske FeS protein (Fig. 2). Since the sequence upstream of the first A T G codon of TR3 did not contain any in-frame stop codons, it was possible that the m R N A encoded a longer polypeptide. The 5' ends of the transcripts for tobacco Rieske FeS protein were therefore examined by nucleotide sequence analysis of primer extension products of tobacco RNA, amplified by PCR. The primer extension experiment was carried out on poly(A) + RNA extracted from young tobacco leaves using the oligonucleotide 5'-GCGCGGATCCGGCTTCACTAGCAAACATTGTG-3' as a primer. The last 22 nucleotides are

293 -30 -38

T ACTTCCTCTGAATACCTTTTTCTCAGGAACATTCAGAA

Leu G T C ATGGCTTCTTCTACTCTTTCTCCAGTAACTCAGCTATGCTCAAGCAAGAGTGGCTTGTCTTCAGTTTCACAATGTTTGCTAGTGAAGCCAATGAAGATTAACAGTCATGGATTGGGAAAA MetA•aSerSerThrLeuSer•r•Va•ThrG•nLeuCysSerSerLysSerG•yLeuSerSerVa•SerGlnCysLeuLeuVa•Lys•r•MetLysIleAsnSerHisGlyLeuGlyLys

G

C G C GATAAGAGGATGAAAGTGAAATGCATGGCTACAAGTATTCCAGCAGATGATAGAGTGCCTGATATGGAAAAGAGGAATCTCATGAATTTGcTTCTTTTGGGTGCTCTTTCTCTACCCACT AspLysArgMetLysVa~LysCy~MetA~aThrSer~iePr~A~aAspAspArgVaiPr~AspMetG~uLysArgAsnLeuMetAsnLeuLeuLeuLeuG~yAiaLeuSerLeuPr~Thr

120 120

240 240

I i 2 II

Ala Ala C C GCTGGGATGTTGGTAcCTTATG~TAcTTTCTTTGTACCAcCTGGGTCAGGGGGTGGTAGTG~TGGAAc~CCTGCCAAGGATGCATTAGGTAATGATGTCATTGcATCTGAATGGCTCAAA AlaGlyMetLeuVal~Ty~GlyThrPhePheVa~Pr~Pr~G~ySerG~yGlyG~y~erG~yG~yThrpr~A~aLysAspA~aLeuGlyAsnAspVa~IleA~aSerG~uTrpLeuLys

360 360

I i 2 II

% C T C ACTCATCCACCTGGCAACCGAACTCTCACGCAAGGACTAAAGGGAGACCCTACTTATCTTGTTGTGGAGAATGATGGAACACTTGCAAcCTATGGTATTAATGCTGTGTGTACTCACCTT ThrHisPr•Pr•G•yAs•ArgThrLeuThrG•nGlyLeuLysGlyAspPr•ThrTyrLeuVa•Va•G•UAsnAspG•yThrLeuA•aThrTyrG•yI•eAsnA•aValCysThrHisLeu

480 480

I i 2 II

T GGTTGTGTTGTGCCATTTAATGCTGCTGAGAACAAGTTTATTTGCCCcTGCCATGGATCTCAATACAACAACCAAGGAAGAGTTGTTAGAGGACCTGCTCCTTTGTCCTTGGCATTGGCT G•yCysVa•Va•Pr•PheAsnA•aAlaGluAsnLysPheI•e•ysPr•CysHisG•ySerG•nTyrAsnAsnG•nG•yArgVa•ValArgG•yPr•A•aPr•LeuSerLeuA•aLeuA•a

2 II

Ala C C CATG•TGATATTGATGATGGGAAGGTGGTGTTTGTCCCATGGGTTGAAACAGA•TTCAGAACTGGTGAAGATCCATGGTGGGCTTAGATC Hi•AlaAspI•eAs•AspG•yLysValVa•PheVa•Pr•Tr•Va•G•uThrAspPheArgThrG•yG•uAspPr•TrpTrpA•a

1 2

A A TCTTGTATCTTTGTTACAT-AAAGC

TC A T G TTATCTCCTTTT TATGAAGTAAAAAGAAATA-TTCATTTTGAG

600 600

AACTTATCTAG T A .......... TCCTTATCACTATATTATCC

ATGTAACTATTGAAGCATAACCCTTGCAGTCCTATAATGACATTT

TTTG

720 710

837 776

Fig. I. Nucleotide and derived amino acid sequences of the two cDNAs encoding the tobacco Rieske FeS protein. The nucleotide sequences of the TR6 (1) and TR3 (2) cDNAs have been completed by the addition of the sequences obtained from the primer extension products. The nucleotide sequence corresponding to TR3 is shown in its entirety, with differences in the sequences corresponding to TR6 noted above. The derived amino acid sequence is given for the longest reading frame present in the sequence corresponding to TR3 (II), with differences in the polypeptide for TR6 (I) noted above the nucleotide sequence. Sequences are numbered starting at the first possible methionine residue. Accordingly, the TR3 c D N A starts at nucleotide -6, TR6 c D N A at nucleotide 16 and the primer extension products for TR3 and TR6 at nucleotides -38 and -30, respectively. The sequence complementary to the oligonucleotide used in the primer extension experiment is underlined and the stop codon upstream of the proposed translation initiation codon is shown in bold. The putative processing site of the precursor protein is marked by an arrowhead.

complementary to a sequence located 73 or 52 nucleotides from the 5' ends of TR3 or TR6, respectively (see Fig. 1) and the remaining sequence includes a Barn HI site (underlined). Several products of different lengths, the longest ones 129bp and 137 bp, were obtained (data not shown). The five longest primer extension products were extracted from the gel and subjected to a terminal transferase reaction in order to provide them with a poly-G tail to convert them into suitable substrates for PCR. The D N A samples were then amplified by PCRs in which the oligonucleotide employed for the primer extension experiment was used as one of the primers, and the oligonucleotide 5 ' - A A T T C G C C A T G G A T C T A GA(C)15 (which contains restriction sites for Eco RI*, Nco I and Xba I, underlined) used as the

second primer. The products of these reactions were subcloned into pUC18 linearized with Barn HI and Xba I. The determination of the nucleotide sequence of these clones showed that all were primer extension products of transcripts corresponding to either TR3 or TR6 cDNAs. For the 129 nucleotide extension (the second longest one), clones were found with sequences matching either TR3 or TR6 cDNAs. In the case of the 137 nucleotide extension, only sequences matching TR3 were found after analysing three different subclones. These sequences are included in Fig. 1. The nucleotide sequence of the primer extension products shows the presence of an in-frame stop codon 39 nucleotides upstream of the first A T G codon in the TR3 cDNA. The same stop codon is also

294 5O

'

TO SP PE NO SY

~zsIvNQLHLTmNssm~s~TLs~s~T~Ps~Qmcs~s~G~mAP~A-H~K~G~N~s~m~G~mTcQAT ~ NSNTTL~PTNPS~QLCS~GNSNISCPNIAL~WTRTQ-MTGRGN-KGM~_KJITCQAT

~ MAQF~ MTQI~

i00 TO SP PE NO SY

I mApI-~W DI~QK]StETLINmLIELlCJ~ms mmTGYM~HmF~S~FV]mPI~~C]~ TIGGITIIAK~GND~I AAEWN~THAm ~~ApI-~V~~IMS~I~T ~IN~LI~IJ~ALSL~T A ~ I ~ G S~L~]~~ I ~ S STMT~A~I~N~VATSWlI~KTHA~

150

200

TO SP PS

~]NNT~]TpGLKGDP Ty~END GTLAT~G[f~-X~tCTKLGCVWI~NaA~NKFIIICP CHGSQ~NNQR~VVRGPAp~s Nel~TIZlrNG:KGe~ Ty~NNESDKTU~r~GlZNaNCT~LGCVVPIF~}~ayNK~lZlC~CHGS e~INNQN~VWGPae~S /e[eNIZlTpGLKGDP TYI~FNEXDaT LaT~alZ~ANCTHLGCVVeF~laayN~FlZlC~eHGSe~lNeQNa~vaGpap z s

NO SY

~JOR[RJVL~A~GL K GO p T y~I~]Q GD D r i A N y G NL.N__~VIC I T H LG CVVPIW~AS~NKFNC

GptPJAIL~/p GL KGDp T yII[VNE NK QA I KD y GF NAIIICT HL GCVVPIW~VANNKFNF p C HG S QND E TNKIVVRGp Ap L s p C HG S Q~NAEN~VVRGP

Ap L S

25O

~ SY

l ~ c ~ v ~ w ~ w w ~ ~ p ~ I s .

ILALANA- T y TDD~]D~LVL S T ~ T ~ T D F R T p E D p W N - A

Fig. 2. Comparison of amino acid sequences of Rieske FeS proteins from photosynthetic organisms. The sequences of proteins from Nicotiana tabacum (TO), Pisum sativum (PE) [31], Spinacia oIeracea (SP) [36], Nostoc muscorum (NO) [ 15] and Synechocystis PCC 6803 (SY) [24] have been aligned. Residues identical in all species are boxed. The sequence shown for the tobacco protein is that derived from cDNA TR3. The amino acid changes between TR3 and TR6 are Val-28(TR3)/Leu(TR6), Gly-88/Ala, Val92/Ala and Asp-224/Ala.

p r e s e n t in transcripts c o r r e s p o n d i n g to T R 6 . This indicates t h a t this A T G c o d o n at nucleotide 40 in T R 3 or 31 in T R 6 ( w h e n c o n s i d e r i n g the c D N A s c o m p l e t e d b y the addition o f the sequences o f the primer extension) is the p r o b a b l e site o f translation initiation, a n d the p r e c u r s o r o f the t o b a c c o Rieske F e S protein is 17 a m i n o acid residues shorter at the N - t e r m i n u s t h a n the p r o p o s e d spinach precursor.

Messenger RNA

A n o r t h e r n blot o f p o l y ( A ) + R N A purified f r o m t o b a c c o leaves w a s p r o b e d with riP-labelled T R 3 c D N A . A single m e s s e n g e r o f a b o u t 1 kb w a s d e t e c t e d (Fig. 3), slightly larger t h a n the c D N A s . T h e slight difference in size c a n p r o b a b l y be attributed to the i n c o m p l e t e n a t u r e o f the 3' ends o f the c D N A s . N o n e o f the clones s e q u e n c e d c o n t a i n e d a p o l y ( A ) tail, a l t h o u g h the n o r t h e r n

Fig. 3. Northern Not of poly(A) + RNA from tobacco leaves probed with 32p-labelled TR3 cDNA for the tobacco Rieske FeS protein. Size markers are cytosolic and chloroplast ribosomal RNAs, sizes are in kb.

blot indicated the p r e s e n c e poly(A) + RNA.

o f transcripts

in

Genomic Southern blot

A S o u t h e r n blot o f E c o R I , H i n d I I I a n d S t y I digests o f t o b a c c o D N A p r o b e d with 32p-labelled

295 TR3 is shown in Fig. 4. Only two bands of 5.2 and 6.1 kb are visible in the Sty I digest, but five and six bands are visible in Eco RI and Hind III digests, respectively. The presence of only two bands in the Sty I digest suggests that there may be only two copies of the gene for the Rieske FeS protein in tobacco, possibly corresponding with the two cDNAs characterised above. As there are no recognition sites for Eco RI in the TR3 or TR6 cDNAs and only one Hind III site in each of these cDNAs, the appearance of many bands in the Eco RI and Hind III digests suggests the presence of introns in those genes.

Import and processing of the Rieske FeS precursor by chloroplasts To verify that the TR3 c D N A encodes the complete precursor of the tobacco Rieske FeS pro-

Fig. 4. Southern blot of tobacco genomic DNA digested with Eco RI (lane 1), Hind III (lane 2) and Sty I (lane 3), probed with labelled TR3 cDNA for the tobacco Rieske FeS protein. Marker sizes in kb.

tein, with a complete transit sequence containing all the information required for recognition and uptake of the protein by chloroplasts, a precursor protein was synthesised from TR3 by transcription and translation in vitro, and import of the protein by isolated intact chloroplasts was examined. The TR3 c D N A was inserted into the expression vector pSP65, transcribed with SP6 polymerase and the resulting RNA translated in a wheat germ extract in the presence of [35S] methionine. The major translation product is a polypeptide of about 26 kDa (Fig. 5, lane 1), with smaller translation products probably corresponding to products derived from initiation at internal methionine codons. The translation products were incubated with intact pea or tobacco chloroplasts and, after reisolation of the chloroplasts, proteins which had been bound or imported by the chloroplasts were assayed by SDS-PAGE (Fig. 5). Incubation of translation products with chloroplasts (lane 2) shows that

Fig. 5. Uptake and processing of Rieske FeS precursor by isolated pea or tobacco chloroplasts. The TR3 cDNA in pSP65 was transcribed, translated in the presence of [35S]methionine and the translation products were incubated with intact pea (A) or tobacco (B) chloroplasts. Binding and import of translation products were assayed by re-isolating the chloroplasts and separating in an SDS-polyacrylamide gel. Imported translation products were assayed by treating the chloroplasts with thermolysin (100gg/ml final concentration) before reisolation and separation. Lane 1: total translation products. Lane 2: chloroplasts incubated with translation products. Lane 3: chloroplasts incubated with translation products, then treated with thermolysin.

296

Fig. 6. Processing of Rieske FeS precursor by chloroplast stomat extract. 3ss-labelled Rieske FeS precursor was incubated with pea stromal extract for 30 min at 20 °C and then the products analysed by SDS-PAGE and fluorography. Lane 1: translation products. Lane2: translation products after incubation with stromal extract.

the precursor was bound and processed to its mature size (20 kDa). Protease treatment (lane 3) shows that only the mature form was protected, presumably by translocation across the chloroplast envelope. The precursor form was accessible to thermolysin digestion and was therefore bound to the outside of the chloroplast envelope. These experiments indicate that the c D N A sequence contains all the information required for uptake and processing of Rieske FeS protein by chloroplasts. Finally, in order to study the location of the peptidase activity responsible for the processing of the Rieske FeS precursor in the chloroplast, the processing activity of a chloroplast stromal extract was examined. A sample of 35S-labelled Rieske FeS precursor synthesised in vitro was incubated with pea stromal extract and the products of this reaction were assayed by SDS-PAGE. As can be seen in Fig. 6, the pea stromal extract was able to process the tobacco precursor only to a product of 20 kDa which correspond to the size of the mature Rieske protein. This result suggests that the peptidase activity responsible of the processing of the Rieske FeS precursor resides in the chloroplast stroma.

Discussion

The results presented above suggest that the chloroplast Rieske FeS protein is encoded by two different genes in the tobacco nuclear genome, whereas in both spinach and pea the protein is encoded by a single-copy nuclear gene [31, 37].

The higher gene-copy number in tobacco is probably a consequence of its origin as an allopolyploid species following hybridisation of the diploid progenitors N. sylvestris and N. tomentosiformis [10]. The two different tobacco genes encoding the Rieske protein would have been contributed by the two parental species. Both of the genes are expressed in leaf tissue, and the similar frequency of c D N A products of both genes obtained in either the screening of the 2gtl 1 library or in the primer extension experiment suggests that both genes are transcribed in a quantitatively similar fashion. The transcripts of both genes appear to be similar in size because a single band of 1 kb was observed on northern blots. The sequences of the tobacco Rieske FeS proteins deduced from the cDNAs are almost identical, differing only in four amino acid replacements. One of the changes, Val or Leu at position 28, is within the N-terminal presequence, whereas the other changes, Gly or Ala at position 90, Val or Ala at position 94 and Asp or Ala at position 224, are located in the mature polypeptide. While this paper was in preparation, Palomares et al. [28] published the sequence of a c D N A encoding the tobacco Rieske FeS precursor. The published sequence appears to match that of the TR3 c D N A although there are 6 nucleotide differences with respect to our sequence. Two of the differences result in changes of the predicted amino acid sequence for the protein. Pro-86 (conserved throughout all the species compared in Fig. 2) is changed to serine in the sequence presented by Palomares et al. [28] and Leu-148 (conserved in spinach, pea, TR3 and TR6) is changed to valine. It is not clear if these changes represent strainspecific differences or are the result of sequencing errors. The N-terminal presequence of the tobacco Rieske FeS protein precursor is predicted to consist of 49 amino acid residues, because of the conservation of the N-terminal sequence (ATSIPAD) of the mature protein from pea [31] and spinach [29, 36]. This would place the proteolytic cleavage site between Met-49 and Ala-50. However a good match to the cleavage site consensus (Ile/Val-X-Cys/Ala) of Gavel and yon Heijne [9] immediately precedes this bond (Val-Lys-Cys-

297 Met). This might suggest that cleavage occurs between Cys-48 and Met-49, and the Met-49 is then removed by an aminopeptidase. The tobacco presequences show a higher level of similarity to the pea presequence (identical residues at 54~o of comparable positions) than to the spinach presequence (44~o identical residues). The spinach precursor, deduced from cDNA sequence [36], has an N-terminal extension of 17 amino acid residues not found in the tobacco or pea presequences. The integrity of the precursors encoded by the tobacco and pea cDNAs is indicated by the ability of the proteins synthesised from these cDNAs in vitro to be efficiently imported and processed by isolated chloroplasts (Fig. 5 and [ 31 ]). Moreover, in the case of the tobacco cDNAs the integrity has been confirmed by sequencing the 5' ends of the corresponding transcripts. The N-termini of the tobacco and pea presequences (MASSTLSP and MSSTTLSP, respectively) are similar to the consensus for presequences of the Rubisco small subunit precursors (MASSMXSS) originally proposed by KarlinNeumann and Tobin [16]. Apart from the N-terminal MA sequence, the original homology block I is reported not to be conserved in chloroplast presequences [38]. The proposed Nterminus of the spinach presequence (MIISIFN) [36] is atypical of chloroplast transit peptides [38], but a sequence (MASFTLSS) very similar to the tobacco and pea sequences and to homology block I is found in the spinach precursor starting at position 18. It is tempting to speculate that the codon corresponding to Met-18 is the translation start for the spinach chloroplast Rieske protein. The sequences of the mature tobacco Rieske FeS proteins show a high degree of similarity to the Rieske FeS proteins of spinach and pea chloroplasts [31, 36] and the cyanobacteria Nostoc and Synechocystis [15,25]. The amino acid sequences CTHLGCV and CPCHGS, proposed to be involved in complexing the FeaS2 cluster [8, 36], are perfectly conserved in the tobacco Rieske FeS proteins. Comparison of the sequences of the mature Rieske FeS proteins from higher plants indicates that the tobacco proteins are marginally

more similar to the spinach protein (identical residues at 85 ~o of comparable positions) than to the pea protein (83 ~o identical residues). Similarity to the Nostoc and Synechocystis proteins is much less with identical residues at only 59~o and 62~o of comparable positions, respectively. There is no simple model for the import and assembly of nuclear-encoded proteins that are targeted to the thylakoid membrane. Several integral membrane proteins and soluble luminal proteins are synthesised with a bipartite presequence composed of an N-terminal chloroplast import domain and a thylakoid transfer domain resembling bacterial and eukaryotic signal sequences [38, 35]. In some instances these domains are sequentially removed by the action of two different peptidases, one located in the stroma [30] and the other in the thylakoid lumen [11, 12]. Other thylakoid membrane proteins, including the light-harvesting chlorophyll protein LHCII, are synthesised with an N-terminal presequence which acts as a chloroplast import domain, but the thylakoid targeting sequences are located within the mature protein [6, 17]. Experiments carried out with the spinach Rieske FeS precursor suggest that this protein falls into the latter category [ 3 ]. Although chloroplast stromal extracts are known to contain several peptidase activities [25], the fact that treatment of the Rieske FeS precursor with stromal extract gave only a product with the same molecular weight as the mature form suggests that the proteolytic cleavage observed was probably being carried out by the chloroplast stromal processing peptidase. This would support the idea that the Rieske protein precursor does not contain an additional cleavable domain for targeting the protein to the thylakoid membrane and is in agreement with the idea of the targeting information for thylakoid integration being contained within the mature region of the Rieske FeS protein.

Acknowledgements F.M. was supported by an EMBO fellowship and the Spanish Ministry of Education and J.C. by a

298

fellowship from the EEC. This work was supported by grants from the U.K. Science and Engineering Research Council.

References 1. Alt J, Westhoff P, Sears BB, Nelson N, Hurt E, Hauska G, Herrmann RG: Genes and transcripts for the polypeptides of the cytochrome b6/f complex from spinach thylakoid membranes. EMBO J 2:979-986 (1983). 2. Apel K, Kloppstech K: The plastid membrane of barley (Hordeum vulgate). Light-induced appearance of mRNA coding for the apoprotein of the fight-harvesting chlorophyll a/b protein. Eur J Biochem 85:581-588 (1978). 3. Bartling S, Clausmeyer S, Oelmfiller R, Herrmann RG: Towards epitope models for chloroplast transit sequences. Bot Mag Tokyo (special issue 2): 119-144 (1990). 4. Bonner WM, Laskey RA: A film detection method for tritium-labelled proteins and nucleic acids in polyacrylamide gels. Eur J Biochem 46:83-88 (1974). 5. Bruce B, Malkin R: Biosynthesis of the chloroplast cytochrome b6f complex: studies in a photosynthetic mutant of Lemna. Plant Cell 3:203-212 (1991). 6. Clark SE, Oblong JE, Lamppa GK: Loss of efficient import and thylakoid insertion due to N- and C- terminal deletions in the fight-harvesting chlorophyll a/b binding protein. Plant Cell 2:173-184 (1990). 7. FeinbergAP, Vogelstein B: Atechnique for radiolabelling restriction endonuclease fragments to high specific activity. Anal Biochem 132:6-13 (1983). 8. Gatti DL, Meinhardt SE, Ohnishi T, Tzagaloff A: Structure and function of the mitocondrial bc 1 complex. A mutational analysis of the yeast Rieske iron-sulfur protein. J Mol Biol 205:421-435 (1989). 9. Gavel Y, von Heijne G: A conserved cleavage-site motif in chloroplast transit peptides. FEBS Lett 261:455-458 (1990). 10. Gray JC, Kung SD, Wildman SG, Sheen SJ: Origin of Nicotiana tabacum L. detected by polypeptide composition of Fraction I protein. Nature 252:226-227 (1974). 11. Hageman J, Robinson C, Smeekens S, Weisbeek P: A thylakoid processing protease is required for complete maturation of the lumen protein plastocyanin. Nature 324: 567-569 (1986). 12. Halpin C, Elderfield PD, James HE, Zimmermann R, Dunbar B, Robinson C: The reaction specifieities of the thylakoidal processing peptidase and Escherichia coli leader peptidase are identical. EMBO J 8:3917-3921 (1989). 13. Hurt E, Hanska G: A cytochrome fib 6 complex of five polypeptides with plastoquinol-plastocyanin oxidoreductase activity from spinach chloroplasts. Eur J Biochem 117:591-599 (1981).

14. Hurt E, Hauska G, Malkin R: Isolation of the Rieske iron-sulfur protein from the cytochrome b6ff'-complex of spinach chloroplasts. FEBS Lett 134:1-5 (1981). 15. Kallas T, Spiller, Malkin R: Primary structure of cotranscribed genes encoding the Rieske FeS and cytochrome fproteins of the cyanobacterium Nostoc PCC 7906. Proc Natl Acad Sci USA 85:5794-5798 (1988). 16. Karfin-Neumann GA, Tobin EM: Transit peptides of nuclear-encoded chloroplast proteins share a common amino acid framework. EMBO J 5:9-13 (1986). 17. Kohorn BD, Tobin EM: A hydrophobic, carboxyproximal region of a light harvesting chlorophyll a/b protein is necessary for stable integration into the thylakoid membranes. Plant Cell 1:159-166 (1989). 18. Laemmfi UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685 (1970). 19. Lam E, Malkin R: Characterization of a photosynthetic mutant of Lemna lacking the cytochrome b6/f complex. Biochim Biophys Acta 810:106-109 (1985). 20. Malkin R: Redox properties of the DBMIB-Rieske ironsulfur complex in spinach chloroplast membranes. FEBS Lett 131:169-172 (1981). 21. Malkin R, Aparicio PJ: Identification of a g = 1.9 high potential iron-sulphur protein in chloroplasts. Biochem Biophys Res Commun 63:1157-1160 (1975). 22. Malkin R, Posner HB: On the site of function of the Rieske iron-sulfur center in the chloroplast electron transfer chain. Biochim Biophys Acta 501:552-554 (1978). 23. Maxam AM, Gilbert W: Sequencing end-labelled DNA with base-specific chemical cleavages. Meth Enzymol 65: 499-560 (1980). 24. Mayes SR, Barber J: Primary structure of the psbN-psbHpetC-petA gene cluster of the cyanobacterium Synechocystis PCC 6803. Plant Mol Biol 17:289-293 (1991). 25. Musgrove JE, Elderfield PD, Robinson C: Endopeptidases in the stroma and thylakoids of pea chloroplasts. Plant Physiol 90:1616-1621 (1989). 26. Napier JA, Maduefio F, Gray JC: Association of imported Rieske iron-sulphur protein with two distinct protein complexes in the chloroplast stroma. In preparation. 27. Newman BJ, Gray JC: Characterisation of a full-length cDNA clone for pea ferredoxin-NADP + reductase. Plant Mol Biol 10:511-520 (1988). 28. Palomares R, Herrmann RG, Oelmtiller R: Different blue-fight requirement for the accumulation of transcripts from nuclear genes for thylakoid proteins in Nicotiana tabacum and Lycopersicon esculentum. J. Photochem Photobiol B Biol 11:151-162 (1991). 29. Pfefferkorn B, Meyer HE: N-terminal amino acid sequence of the Rieske iron-sulfur protein from the cytochrome b6/f-complex of spinach thylakoids. FEBS Lett 206:233-237 (1986). 30. Robinson C, Ellis RJ: Transport of proteins into chloroplasts. Partial purification of a chloroplast protease in-

299

31.

32.

33.

34.

35.

volved in the processing of imported precursor polypeptides. Eur J Biochem 142:337-342 (1984). Salter AH, Newman BJ, Napier JA, Gray JC: Import of the precursor of the chloroplast Rieske iron-sulphur protein by pea chloroplasts. Plant Mol Biol, in press. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Coid Spring Harbor, NY (1989). Sanger F, Nicklen S, Coulson AR: DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467 (1977). Smeekens S, Weisbeek P, Robinson C: Protein transport into and within chloroplasts. Trends Biochem Sci 15: 73-76 (1990). Smith CJS, Watson CF, Bird CR, Ray J, Schuch W, Grierson D: Expression of a truncated tomato polygalacturonase gene inhibits expression of the endogenous gene

in transgenic plants. Mol Gen Genet 224:477-481 (1990). 36. Steppuhn J, Rother C, Hermans J, Jansen T, Salnikow J, Hauska G, Herrmann RG: The complete amino-acid sequence of the Rieske FeS-precursor protein from spinach chloroplasts deduced from cDNA analysis. Mol Gen Genet 210:171-177 (1987). 37. Tittgen J, Hermans J, Steppuhn J, Jansen T, Jansson C, Andersson B, Nechushtai R, Nelson N, Herrmann RG: Isolation of cDNA clones for fourteen nuclear-encoded thylakoid membrane proteins. Mol Gen Genet 204: 258265 (1986). 38. von Heijne G, Steppuhn J, Herrmann RG: Domain structure of mitochondrial and chloroplast targeting peptides. Eur J Biochem 180:535-545 (1989). 39. Willey DL, Gray JC: Synthesis and assembly of the cytochrome b-f complex in higher plants. Photosynth Res 17:125-144 (1988).