Environmental Research 132 (2014) 54–61

Contents lists available at ScienceDirect

Environmental Research journal homepage: www.elsevier.com/locate/envres

Impairment of uterine smooth muscle contractions and prostaglandin secretion from cattle myometrium and corpus luteum in vitro is influenced by DDT, DDE and HCH Michal H. Wrobel, Pawel Bedziechowski, Jaroslaw Mlynarczuk, Jan Kotwica n Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Tuwima Street 10, 10- 748 Olsztyn, Poland

art ic l e i nf o

a b s t r a c t

Article history: Received 12 December 2013 Received in revised form 21 February 2014 Accepted 24 February 2014

The aim of this study was to investigate the effect of dichlorodiphenyltrichloroethane(DDT), dichlorodiphenyldichloroethylene (DDE) and γ-hexachlorocyclohexane (HCH) (10 ng/ml) on myometrial motility and the secretory function of the myometrium and corpus luteum (CL) collected from cows on days 8–12 of the estrous cycle. All of the xenobiotics increased (Po 0.05) myometrial contractility. Moreover, the xenobiotics stimulated the secretion of the following prostaglandins (PGs) from myometrial strips: PGF2α, PGE2 and PGI2. DDT and DDE also increased (P o0.05) the release of PGF2α from CL strips, and HCH had the same effect (P o0.05) on the secretion of PGE2 and PGI2. The studied xenobiotics did not affect (P 40.05) PG synthesis, but DDT and DDE increased the mRNA expression levels of leukemia inhibitor factor (LIF), which can stimulate PG production. In summary, the xenobiotics affected PG secretion from cow myometrium and CL, which may contribute to the mechanism of uterine contraction disturbance. & 2014 Elsevier Inc. All rights reserved.

Keywords: Pesticides Prostaglandins LIF Reproductive tract Cow

1. Introduction 1,1,1-Trichloro-2,2,-bis-4-chlorophenyl-ethane

(DDT)

and

γ-hexachlorocyclohexane (HCH), which is commonly referred to as lindane, are recognized as representative organochlorine pesticides from the group of endocrine disruptors. DDT and HCH are currently used in agriculture and forestry in developing countries of Africa and Asia to control pests of crops and to overcome typhoid, malaria (Gunasekaran et al., 2005; Rogan and Chen, 2005; Nweke and Sanders III, 2009; Hlongwana et al., 2013) or scabies (Ngueleu et al., 2013). Because of their widespread distribution, lipophilic properties and high resistance to biodegradation (Rogan and Chen, 2005; Tsai, 2010), DDT and HCH are still detected in fodder plants (Pazou et al., 2013) and in the bodies of farm animals (Kamarianos et al., 2003) and humans (Toft et al., 2004; Llop et al., 2010). The production and use of DDT and HCH are banned in the USA, Japan and many European countries (Fromberg et al., 1999; Glynn et al., 2000; Li et al., 2006). However, due to the ability of DDT and HCH to spread by air and water, these pesticides are also a problem in places far from the sources of application (Glynn et al., 2000; Ayotte et al., 2001; Burns et al., 2013). In the environment, DDT is degraded to bis 4-chlorophenyl-1,1-dichloroethene (DDE), which is a stable and ubiquitous component and is also n

Corresponding author. Fax: þ48 89 5393146. E-mail address: [email protected] (J. Kotwica).

http://dx.doi.org/10.1016/j.envres.2014.02.018 0013-9351/& 2014 Elsevier Inc. All rights reserved.

found in living tissues (Turusov et al., 2002; Kamarianos et al., 2003; Meeker et al., 2009). When these pesticides enter organisms, they can act as endocrine disruptors and compete as agonists or antagonists with more than one type of nuclear steroid receptors (Kuiper et al., 1998; Turusov et al., 2002; Li et al., 2008). Therefore, there is increasing concern that pesticides may cause an impairment in the endocrine system, followed by alterations in reproductive physiology. The unaffected regulation of uterine motility is one of the crucial factors for the initiation and maintenance of pregnancy. Prostaglandins (PGs) are a group of important regulators of the reproductive process, including contractile activity of the myometrium. PGF2α mediates the stimulation of myometrial contractions, but PGE2 and PGI2 can cause the excitation or relaxation of the myometrium (Senior et al., 1993; Coleman et al., 1994). However, the initiation of uterine contractions and/or labor after PGE2 induction may be a result of cervical ripening rather than its direct myometrial effect (Chiossi et al., 2012). The positive feedback loop between luteal oxytocin (OT) and uterine PGF2α in cow is well documented (Skarzynski et al., 1997; Kotwica et al., 1999). However, it has also been reported that LIF, which plays an important role in mammalian implantation, enhances PGE2 production and expression for its uterine receptors (Horita et al., 2007). Epidemiological observations in humans show a correlation between the presence of DDT, its metabolite (DDE) or HCH in the blood of mothers and an increased risk of miscarriages

M.H. Wrobel et al. / Environmental Research 132 (2014) 54–61

(Gerhard et al., 1998; Korrick et al., 2001; Longnecker et al., 2005; Venners et al., 2005) and preterm deliveries (Saxena et al., 1980; Longnecker et al., 2001; Torres-Arreola et al., 2003; Pathak et al. 2010; Mustafa et al., 2013). However, data from other studies did not confirm these observations (Berkowitz et al., 1996; Farhang et al., 2005; Fenster et al., 2006; Wood et al., 2007; Cioroiu et al., 2010). In our in vitro study, we showed that DDT and DDE affect the endometrial secretion of PGF2α and PGE2 (M. Wrobel et al., 2009), which are natural regulators of uterine contractions (Senior et al., 1993; Coleman et al., 1994). Because PG secretion could also be followed by the stimulation of myometrial contractions in pregnant cows by these compounds (Mlynarczuk et al., 2010) and because the endometrium is a main source of PGs in the reproductive tract, the involvement of the secreted PGs from the myometrium and corpus luteum (CL) in the adverse effects of organochlorined pesticides on myometrial contractions should be investigated. Therefore, the aim of this study was to determine the effect of DDT, DDE and HCH on (a) uterine smooth muscle contractions and (b) the synthesis and secretion of PGF2α, PGE2 and PGI2 from myometrial and luteal cells. 2. Materials and methods 2.1. Animals and tissues collection Uterine horns and CL from healthy cows and mature heifers on days 8–12 of the estrous cycle (Ireland et al., 1980; Fields and Fields, 1996) were collected in a commercial slaughterhouse within 20 min after slaughter. These tissues were placed in ice-cold saline and transported to the laboratory within 1 h. Each medium used was supplemented with gentamycin (20 μl/ml). All materials used in these studies were purchased from Sigma-Aldrich (PL) unless otherwise stated.

55

then washed twice with M-199 supplemented with 0.1% BSA. After the washes, the cells were incubated in DMEM/Ham's F-12 culture medium with 0.1% BSA and were subjected to xenobiotic treatment. When the incubation was longer than 24 h, the medium was supplemented with the following antioxidants: ascorbic acid (20 mg/ ml; Merck, USA), sodium selenite (5 ng/ml; INC, USA) and transferrin (5 mg/ml), to prevent the free radicals accumulation. 2.4. Treatments. DDT, DDE ( Z 98% purity) and HCH (97% purity) were dissolved in DMSO, and its final concentrations in culture medium did not exceed 0.1%. Therefore 0.1% of DMSO was added to the control samples. There have been found 0.2–0.3 ng/ml of DDT, 0.8–3.7 ng/ml of DDE and 0.7– 6.1 ng/ml of HCH in the follicular fluid of cattle (Kamarianos et al., 2003). In our previous studies on the effect of DDT and DDE on the function of bovine reproductive tract, these xenobiotics were used in the dose of 0.1–10 ng/ml and the highest of them was the most effective (M. Wrobel et al., 2009; Wrobel et al., 2012). It should be also emphasized that during pregnancy, uterus can accumulate a 3–10-fold higher amount of HCH or other chlorinated compounds than that found in female fat or blood (Polishuk et al., 1977). Therefore, we used all xenobiotics at a dose of 10 ng/ml in the present study. 2.5. The effect of xenobiotics on myometrial and luteal cell viability It was shown that DDT and DDE (10 ng/ml) did not affect the viability of uterine, ovarian (M. Wrobel et al., 2009) and oviductal cells (Wrobel et al., 2012). However, to avoid the criticism that HCH could affect the viability of myometrial (n ¼4) and luteal (n¼ 6) cells, they were incubated (72 h) with this compound (10 ng/ml). Actinomycin D (Act D; 500 ng/ml) is an inhibitor of RNA synthesis and stimulator of apoptosis. Since it greatly reduces the survival of cells, it was used as a negative control to verify the method of cells viability measurement. 2.6. The effect of xenobiotics on contractions of myometrial strips Myometrial strips from six cows (n¼6) were treated separately with DDT, DDE or HCH (10 ng/ml) for 48 h. The force of the contractions was then measured.

2.2. Uterine strip preparation and incubation 2.7. The effect of xenobiotics on PG secretion from myometrial and CL slices To measure the uterine contractions, four strips (3–4 mm wide and 6–7 mm long) of the myometrium were dissected from each animal, and they were cut in the direction of the longitudinal muscle. The slices were immediately immersed in 4 ml of aerated (95% air and 5% CO2) physiological buffer (PSS; pH¼ 7.4), which was composed of NaCl (116 mM), KCL (4.6 mM), NaH2PO4∙H2O (1.16 mM), MgSO4∙7 H2O (1.16 mM), NaHCO3 (21.9 mM), CaCl2∙2 H2O (1.8 mM), dextrose (11.6 mM) and CaNaEDTA (0.03 mM) (Tsai et al., 1996). The strips were then incubated at 4 1C with the treatments for 48 h, as described previously (Wrobel et al., 2005). The medium and all treatments were changed after 24 h. After incubation, the contractility of the strips was measured. To measure the prostaglandin secretion, 15 slices (40–60 mg) from both the myometrium and CL were obtained from each animal. The strips were preincubated for 24 h (38 1C; 95% O2 and 5% CO2) in 2 ml of DMEM/Ham's F-12 supplemented with 5% FCS. The strips were then incubated in DMEM/Ham's F-12 medium with 0.1% BSA and studied treatments. All myometrial and CL strips used in one experiment were obtained from the same animal. 2.3. Preparation and incubation of myometrial and luteal cells The myometrium was separated from the endometrium and perimetrium. The tissue (7 g per uterus) was minced with scissors and placed (2 h) in warmed (38 1C) and oxygenated (95% O2 and 5% CO2) digestion mixture containing medium (20 ml of M199 with 0.1% BSA) supplemented with collagenase IA (1.5 mg/ml) and dispase (0.2 mg/ml; Gibco, GB), as previously described (Wrobel and Kotwica, 2005). Luteal cells were obtained by perfusion of the CL with collagenase IA (1 mg/ml) through one of the branches of the ovarian artery (Okuda et al., 1992). Cells obtained from four CL tissues were pooled and used in one experiment. Both myometrial and luteal cells were collected by centrifugation (3 times for 10 min; 1800g and 1000g, respectively). After each centrifugation, the cells were washed with medium (10 ml of M199 with 0.1% BSA). The collected cells were counted, and their viability was estimated using the exclusion of 0.04% trypan blue dye. Only cells with viability greater than 85% were used. Finally, the cells were suspended (2.5  105/ml) in DMEM/Ham's F-12 with 5% FCS and sieved (0.5 ml/well) into 48-well plates (Nunclon, NUNC, DE) to measure the cytotoxic effect of HCH. The cells used to measure mRNA expression were suspended in the same medium (5  105/ml) and placed (4 ml/well) into 6-well plates (Nunclon, NUNC, DE). The myometrial and luteal cells were cultured for 96 and 24 h, respectively, in a controlled atmosphere (air balanced with 5% CO2) at 100% humidity and 38 1C (Memmert INC 108, Germany) to allow the cells to attach to the bottom of the plate. The cells were

Slices of the myometrium and CL from six cows were incubated (24 h) with DDT, DDE, or HCH (10 ng/ml). Arachidonic acid (AA; 20 μg/ml), which is a substrate to PGs synthesis (Goff, 2004), was used as a positive control. Each treatment was performed in triplicate. After the incubation, medium was collected into tubes containing 10 μl of 0.3 M EDTA in 1% acetylsalicylic acid (Meyer et al., 1989) and stored at  20 1C to determine the PG concentration. 2.8. The effect of xenobiotics on COX-2, PGFS, PGES and PGIS mRNA expression in myometrial and luteal cells as well as LIF mRNA expression in myometrial cells Myometrial and luteal cells were incubated (24 h) with DDT, DDE or HCH (10 ng/ml). Each experiment was repeated four times. After incubation, the medium was removed, and the cells were covered with Phenozol (300 ml for each well; A&A Biotechnology, PL). The plates were stored (at  70 1C) for further realtime PCR analysis of COX-2, PGFS, PGES and PGIS mRNA expression in myometrial and luteal cells as well as LIF mRNA expression in myometrial cells. 2.9. Determination of cell viability Viability of cells after treatment with HCH was measured by a TOX-1 test (in vitro toxicology assay kit, MTT based) according to the manufacturer's instructions. This method is based on the ability of mitochondrial dehydrogenase in living cells to convert a tetrazolium salt (MTT; yellow color) into formazan (blue color). The myometrial and luteal cells were incubated with MTT (20 ml/well) for 4 and 2 h, respectively. The absorbance of the reaction product was measured at λ ¼ 570 nm (ELISA, Multiscan EX, Labsystem, FI). 2.10. Measurement of smooth muscle contractions Myometrial strips were individually placed into the chambers of a HSE Schuler Organbath apparatus (March-Hugstetten, DE) connected with computer. Each chamber containing Krebs–Ringer's solution (KRS; pH ¼ 7.4; 10 ml), which was composed of NaCl (120.3 mM), KCl (5.9 mM), CaCl2 (2.5 mM), MgCl2 (1.2 mM), NaH2PO4 (1.2 mM), NaHCO3 (15.5 mM) and glucose (11.5 mM) (Kotwica et al., 2003). Each strip was tied to both the base and the isometric contraction transducer (HSE Type 372) with a stationary hook and surgical silk, respectively.

56

M.H. Wrobel et al. / Environmental Research 132 (2014) 54–61

The KRS was maintained at 38 1C and oxygenated (95% O2 and 5% CO2). All preparations were allowed to equilibrate for 2 h. The force of isometric contractions of smooth muscle was measured every 2 s for 20 min, as previously described (Wrobel et al., 2005).

repeated measures followed by the Newman–Keuls test after testing for normality. The Prism 5 software (GraphPad Software, Inc., USA) was used to prepare all statistical analyses and figures, and the real-time PCR Miner algorithm was used to analyze the relative mRNA quantification data (Zhao and Fernald, 2005).

2.11. Prostaglandin determination

3. Results The concentration of PGFM (13,14-dihydro-15-keto-PGF2α, a metabolite of PGF2α) in the culture medium reliably reflects the amount of PGF2α secreted from bovine endometrial cells (Skarzynski et al., 1999). The PGFM concentration was determined by EIA using horseradish peroxidase-labeled PGFM as a tracer (final dilution of 1:40,000) and anti-PGFM serum (final dilution of 1:80,000). The standard curve ranged from 62.25 to 1600 pg/ml. The intra- and inter-assay coefficients of variation were 6% and 12%, respectively. To measure the PGE2 concentration, horseradish peroxidase-labeled PGE2 as a tracer (final dilution of 1:30,000) and anti-PGE2 serum (final dilution of 1:35,000) were used. The standard curve ranged from 78 to 20,000 pg/ml. The intra- and inter-assay coefficients of variation were 7% and 12%, respectively. The PGI2 concentration was measured using a 6-Keto Prostaglandin F1α EIA Kit (Cayman Chemical Company, USA, No. 515211). The standard curve ranged from 1.6 to 1000 pg/ml. The intra- and inter-assay coefficients of variation were 5% and 11%, respectively. Finally, the prostaglandin concentration was expressed per 1 mg of strip mass.

2.12. Measurement of mRNA expression using real-time PCR Total RNA was isolated using the Total RNA Kit (A&A Biotechnology, PL) according to the manufacturer's instruction. The concentration and purity of the isolated RNA samples were determined using a spectrophotometer (NanoDrop 1000; Thermo Scientific, USA). The ratio of absorbance (A260:A280) of all samples was between 1.8 and 2. Total RNA (0.5 mg for each sample) was reverse transcribed (42 1C for 1 h) using reverse transcriptase. Based on the gene sequences available in GenBank (NCBI), the Primer Express software was used to design primers for prostaglandin I synthase (PGIS) and LIF. The primers for COX-2, prostaglandin E synthase (PGES) and F synthase (PGFS) were used as previously described (Slonina et al., 2009; Wrobel et al., 2012). The TATA box binding protein (TBP) was used as the most stable housekeeping gene to normalize gene expression in bovine CL and myometrium (Rekawiecki et al., 2012, 2013). The primer sequences generated using IBB PAN PL are shown in Table 1. Real-time PCR (25 ml volume) was performed using the APB Prism 7900 sequence detection system (Applied Biosystems, USA). The reaction mixture contained cDNA (5 ml; 200 ng/ml), SYBR Green PCR master mix (12.5 ml; mix-B, lot. 171011; A&A Biotechnology, PL), Hi-ROX (0.4 ml; lot. 41011; A&A Biotechnology, PL), both PCR primers (2.5 ml of each; 200 nM) for each studied gene and water (2.1 ml). The PCR reactions for each pair of primers were performed as follows: initial denaturation (95 1C for 10 min) followed by 40 cycles of denaturation (95 1C for 15 s) and annealing (60 1C for 1 min for annealing and extension). Melting curves were set up by stepped increases from 60 to 95 1C to ensure the specificity of the amplified product. PCR products were electrophoresed on a 2% agarose gel to confirm their specificity.

2.13. Statistical analysis The mean ( 7SEM) values of contraction force were expressed as mN and were calculated using all measurements collected every two seconds for 20 minutes and compared by one-way ANOVA followed by the Newman–Keuls test after testing for normality. All other mean ( 7 SEM) values were compared by one-way ANOVA for

Neither myometrial (Fig. 1A) nor luteal (Fig. 1B) cell viability was affected by HCH (P 4 0.05), in contrast to Act D (P o 0.001). Compared to the control, DDT, DDE and HCH increased (P o 0.05) the force of contractions with DDE having the greater effect (Fig. 2). All studied xenobiotics increased (P o 0.05) the secretion of PGF2α, PGE2 and PGI2 from the myometrium (Fig. 3) compared to the control. Moreover, DDT and DDE increased (P o 0.05) PGF2α secretion (Fig. 4A), and HCH increased (P o 0.05) the release of PGE2 (Fig. 4B) and PGI2 from the CL strips (Fig. 4C) to the culture medium. The incubation of the strips with AA (as positive control) caused an increase of PGFM, PGE2 and PGI of 222, 675 and 127%, respectively, in the myometrium and of 421.25, 1136 and 210%, respectively, in the CL compared to the control (data not shown). HCH increased (P o 0.05) COX-2 mRNA expression in luteal cells (Fig. 5A), but none of the tested xenobiotics affected (P 4 0.05) the mRNA expression of prostaglandin synthases in the myometrium and CL (Fig. 5B and D). Both DDT and DDE increased (P o 0.05) LIF mRNA expression in myometrial cells (Fig. 6).

4. Discussion The viability of both myometrial and luteal cells was not affected by HCH exposure. Because DDT and DDE do not affect the lifespan of bovine uterine and ovarian cells at the same used dose (M. Wrobel et al., 2009), we assume that the observed changes in the function of the myometrium and CL were not evoked by cytotoxic effects of these applied compounds. All tested xenobiotics increased the force of myometrial contractions with DDE exerting the greatest effect. Similarly, DDE, to a greater extent than DDT, stimulates the force of myometrial contractions in early pregnancy (Mlynarczuk et al., 2010) and oviductal motility in the estrous cycle (Wrobel et al., 2012) in pregnant cows. Moreover, the frequency of myometrial contractions in pregnant rats is increased by DDT (Juberg et al., 1991; Juberg and Loch-Caruso, 1992) and PCBs (Tsai et al., 1996; Bae et al., 2001) but the motility of the rat uterus is inhibited by HCH (Criswell and Loch-Caruso, 1999; Wang and Loch-Caruso, 2002). However, the doses of HCH applied in the previously published

Table 1 Primer sequences used to analyze gene expression in myometrial and luteal cells. Gene

Accession no.

Sequence (50 –30 )

Product size (bp)

COX-2

AF004944.1

Forward: GCCTGATGACTGCCCAACA Reverse: GCAAAGAATGCAAACATCAGATTT

140

LIF

NM_173931.1

Forward: TCTTGGCGGCAGGAGTTG Reverse: GTTGAGTTGTCCCAGCTGGTTT

160

PGES

NM_001166554.1

Forward: CCGAGATCAAGTTCTCCTCCTACA Reverse: CGCCTTCATGGGTGGATAGT

131

PGFS

S54973

Forward: TGTGGTGCACGTATCACGACAReverse: AATCACGTTGCCGTCCTCATC

160

PGIS

NM_174444.1

Forward: GGAGAGTGAAGAAAAGACACCAAAA Reverse: CACCCGTAGCTTTAGCGGATT

115

TBP

NM_001075742.1

Forward: CAGAGAGCTCCGGGATCGT Reverse: ACACCATCTTCCCAGAACTGAATAT

194

Viability of cells (%)

M.H. Wrobel et al. / Environmental Research 132 (2014) 54–61

125

125

100

100

75

75

50

50

***

25

57

***

25

0

0 Ctrl

HCH

Act D

Ctrl

HCH

ActD

Fig. 1. Mean ( 7 SEM) viability of myometrial (n¼ 4; A) and luteal cells (n¼ 6; B) after incubation with HCH (10 ng/ml; 72 h). Actinomycin D (Act D; 500 ng/ml) was used as a negative control. nnn(Po 0.001).

c

Force of contraction (mN)

80

b 60 40

b a

20 0 Ctrl

DDT

DDE

HCH

Fig. 2. Mean ( 7 SEM; n¼ 6) force of myometrial strips contractions after incubation (48 h) with DDT, DDE and HCH (10 ng/ml). Bars with different superscripts are significantly different (P o0.05).

studies were much higher than the amount of HCH measured in living tissues (Kamarianos et al., 2003). Thus, the results correspond rather to accidental exposure to lindane. Therefore, it can be assumed that the amount of HCH is critical for the effect that it evokes, similar to the biphasic effect of estradiol on OT secretion from bovine granulosa cells (Voss and Fortune, 1993). Coordinated uterine contractions are impotrant for successful pregnancy. Hence, the stimulation of myometrial contractions by pesticides can partially explain why numerous epidemiological studies have indicateded that the higher level of organochlorine compounds observed in female blood is correlated to an increased frequency of miscarriages or preterm labors (Taylor et al., 1989; Gerhard et al., 1998; Korrick et al., 2001; Longnecker et al., 2001; Venners et al., 2005). Therefore, these organochlorine compounds have been associated with decreased gestation length. All tested compounds stimulated the secretion of PGF2α, PGE2 and PGI2 from the myometrium. DDT and DDE also stimulated the secretion of PGF2α from the CL, and HCH increased the amount of PGE2 and PGI2 secreted from this tissue. Similarly, the secretion of PGF2α is also stimulated by DDT and DDE from bovine endometrium (M. Wrobel et al., 2009) and oviductal epithelium (Wrobel et al., 2012) as well as by lindane from rat liver cells (Kroll et al., 1999). An increase in PGF2α secretion from bovine myometrial cells treated with PCB 77 has also been observed (M.H. Wrobel et al., 2009).

However, PGE2 secretion from oviductal cells is stimulated by DDT and DDE only after 2 h of incubation (Wrobel et al., 2012). DDT and DDE decrease PGE2 secretion from bovine endometrium after 24 h (M. Wrobel et al., 2009), and DDT decreases PGE2 secretion from the oviduct after 48 h of treatment (Wrobel et al., 2012). Therefore, our earlier results indicated that the stimulation of myometrial contractions under the influence of chloroorganic compounds can increase the PGF2α: PGE2 ratio. A disruption of this ratio between secreted prostaglandins evoked by xenobiotics in this study was observed only in CL explants but not in the myometrium. Because the amount of PGs secreted from CL was markedly lower than that secreted from myometrial strips, the changes in the PG ratio may play a marginal role in the effect of xenobiotics on uterine motility. It should also be noted that the myometrial strips secreted more PGE2 than PGF2α, similar to data obtained from porcine myometrium (Franczak et al., 2006), while the amount of PGI2 secreted from the myometrium was 2–3-fold higher than the amount of PGE2. Despite this large amount of PGI2 and PGE2 secretion from the myometrium compared to PGF2α, the stimulation of myometrial contractions was significantly higher after treatment with all tested xenobiotics. We can only speculate that the effect of PGF2α to increase the contractility of uterus is much stronger than the relaxation effect of PGE2 and PGI2. Moreover, the stimulation of PGE2 receptors (subtype EP3) is followed by a decrease of cAMP in human myometrium and an increase in its contractions (Senior et al., 1993; Coleman et al., 1994). A decrease of cAMP in bovine oviductal cells has also been reported after DDT treatment (Pöhland and Tiemann, 2003). Therefore, because the effect of PGE2 and PGI2 on myometrial contractions can be biphasic (Senior et al., 1993; Coleman et al., 1994), it is also possible that pesticides can modulate the receptivity of myometrial cells via changes in the mediation of the signals obtained from prostaglandin receptors. Untreated myometrial strips produced considerably more PGs when the medium was supplemented with AA (a substrate for their synthesis), which confirmed that bovine myometrium in the present in vitro studies had a high ability to synthesize PGs. However, though the xenobiotics stimulated PG secretion, these compounds had little or no effect on the mRNA expression of enzymes involved in PG synthesis. Similarly, PGE2 production, but not COX-2 mRNA, increases after DDE exposure in human

58

M.H. Wrobel et al. / Environmental Research 132 (2014) 54–61

25

c

600

b

b 400

a 200

PGFM (pg/mg protein)

PGFM (pg/mg protein)

800

0

Ctrl

b

DDE

b

8000

15 10

ab a

5

Ctrl

DDT

DDE

HCH

300

b

6000 4000

b

0

HCH

PGE2 (pg/mg protein)

PGE2 (pg/mg protein)

10000

DDT

b

20

a

2000

b ab

200

a

a

Ctrl

DDT

100

0

Ctrl

DDT

DDE

HCH

0

DDE

HCH

b

20000

b

600

15000 10000

a

5000 0

Ctrl

b

b PGI2 (pg/mg protein)

PGI2 (pg/mg protein)

25000

DDT

DDE

400

200

a

a

a

HCH

Fig. 3. Mean (7SEM; n¼ 6) concentrations of PGFM (A), PGE2 (B) and PGI2 (C) in culture medium after the incubation (24 h) of myometrial strips with DDT, DDE and HCH (10 ng/ml). Bars with different superscripts are significantly different (Po0.05).

trophoblast cells (Dominguez-Lopez et al., 2012). Moreover, it has been reported that PGE2 production is enhanced by LIF in a trophoblast cell line (Horita et al., 2007). Because we showed that DDT and DDE increased LIF mRNA expression, it is possible that these xenobiotics affect PG production indirectly via LIF synthesis without directly affecting PG synthesis enzymes. It should be added that the secretion of LIF is increased after treating endometrial (Takabatake et al., 1997) and oviducal (Reinhart et al., 1998) cells with estradiol. Thus, estrogen-like substances, such as DDT and DDE (Kuiper et al., 1998), can affect the amount of LIF similarly to OH-PCBs, which stimulate the secretion of this protein from bovine oviduct (Reinhart et al., 1999). A previous report has shown the involvement of PGs in the adverse effect of chlorinated xenobiotics on myometrial contractions. PCBs affect an initial step of prostaglandin synthesis, and they increase the release of AA from rat myometrium and the further stimulation of myometrial contractions (Bae et al., 1999). Studies in rats have also revealed that the treatment of myometrial cells with PGF2α results in increased intracellular calcium mobilization (Ruttner et al., 2002), which is involved in the mechanism of muscle contractions (Wray et al., 2003). The increase of calcium

0 Ctrl

DDT

DDE

HCH

Fig. 4. Mean (7SEM; n¼6) concentration of PGFM (A), PGE2 (B) and PGI2 (C) in culture medium after the incubation (24 h) of corpora luteum strips with DDT, DDE and HCH (10 ng/ml). Bars with different superscripts are significantly different (Po0.05).

concentrations is also stimulated in rat (Juberg et al. 1995) and cow (Wrobel and Kotwica, 2005) myometrial cells by metabolites of DDT (DDD) and PCBs, respectively. Admittedly, the direct effect of DDT, DDE and HCH on the mRNA levels of the enzymes involved in prostaglandin synthesis has not been shown here. It should be noted that DDT and DDE increase the OT secretion from bovine granulosa and luteal cells (M. Wrobel et al., 2009), which is followed by increase of PGs release from the uterus (Kotwica et al., 1999). Since stimulation of oviductal motility by DDT and DDE (Wrobel et al., 2012) and myometrial contractions by PCB 77 (M.H. Wrobel et al., 2009) was decreased by an inhibitor of prostaglandin synthesis, it seems to be evident that the PGs are involved in the mechanism of the adverse effect of orangochlorine pesticides on smooth muscle contractions in the reproductive tract. In summary, DDT, DDE and HCH affect uterine motility, and PGs are involved in this mechanism. All tested xenobiotics stimulated prostaglandin secretion from the myometrium and CL, but they did not affect PG synthesis. However, it is possible that DDT and DDE can exert their effect on PG production indirectly via the stimulation of LIF synthesis in the myometrium.

M.H. Wrobel et al. / Environmental Research 132 (2014) 54–61

*

miometrium CL

2

1

3 PGFS/TBP (arbitrary unit)

COX-2/TBP (arbitrary unit)

3

2

1

0

0 Ctrl

DDT

DDE

HCH

3

Ctrl

DDT

DDE

HCH

Ctrl

DDT

DDE

HCH

3 PGIS/TBP (arbitrary unit)

PGES/TBP (arbitrary unit)

59

2

1

0

2

1

0 Ctrl

DDT

DDE

HCH

Fig. 5. Mean ( 7 SEM; n ¼4) mRNA expression of COX-2 (A), PGFS (B), PGES (C) and PGIS (D) in myometrial (white bars) and luteal cells (black bars) after incubation (24 h) with DDT, DDE and HCH (10 ng/ml). n(P o0.05).

LIF/TBP (arbitrary unit)

5

References

b

4 3

bc

2 1

ac a

0 Ctrl

DDT

DDE

HCH

Fig. 6. Mean ( 7 SEM; n ¼4) mRNA expression of LIF in myometrial cells after incubation (24 h) with DDT, DDE and HCH (10 ng/ml). Bars with different superscripts are significantly different (Po 0.05).

5. Conclusion Prostaglandins are involved in the mechanism of DDT, DDE and HCH adverse effect on myometrial contractions in cow.

Conflict of interest The authors declare that there are no conflicts of interest.

Acknowledgments We would like to thank Professor W.J. Silvia (University of Kentucky, Lexington, KY, USA) and Professor W.W. Thatcher (University of Florida, Gainesville, FL, USA) for the PGFM and PGE2 antisera, respectively. This study was supported by National Science Centre (N N311 082140) and by the Polish Academy of Sciences (ZFiTR/2011).

Ayotte, P., Giroux, S., Dewailly, E., Avila, M.H., Farias, P., Danis, R., Diaz, V.C., 2001. DDT spraying for malaria control and reproductive function in Mexican men. Epidemiology 12, 366–367. Bae, J., Golden, M.P., Loch-Caruso, R., 1999. Stimulation of pregnant rat uterine contraction by the polychlorinated biphenyl (PCB) mixture Aroclor 1242 may be mediated by arachidonic acid release throught activation of phospholipase A2 enzymes. J. Pharmacol. Exp. Ther. 2, 1112–1120. Bae, J., Mousa, M.A., Quensen III, J.F., Boyd, S.A., Loch-Caruso, R., 2001. Stimulation of contraction of pregnant rat uterus in vitro by non-dechlorinated and microbially dechlorinated mixtures of polychlorinated biphenyls. Environ. Health Perspect. 109, 275–282. Berkowitz, G.S., Lapinski, R.H., Wolff, M.S., 1996. The role of DDE and polychlorinated biphenyl levels in preterm birth. Arch. Environ. Contam. Toxicol. 30, 139–141. Burns, C.J., McIntosh, L.J., Mink, P.J., Jurek, A.M., Li, A.A., 2013. Pesticide exposure and neurodevelopmental outcomes: review of the epidemiologic and animal studies. J. Toxicol. Environ. Health 16, 127–283. Chiossi, G., Constantine, M.M., Bytautiene, E., Betancourt, A., Hankins, G.D.V., Saade, G. R., Longo, M., 2012. in vitro myometrial contractility profiles of diferent pharmacological agents used for induction of labor. Am. J. Perinatol. 29, 699–704. Cioroiu, M., Tarcau, D., Mocanu, R., Cucu-Man, S., Nechita, B., Luca, M., 2010. Organochlorine pesticides in colostrums in case of normal and preterm labor (Iasi, Romania). Sci. Total Environ. 408, 2639–2645. Coleman, R.A., Smith, W.L., Narumiya, S., 1994. International Union of Pharmacology classification of prostanoid receptors: properties, distribution, and structure of the receptors and their subtypes. Pharmacol. Rev. 46, 205–229. Criswell, K., Loch-Caruso, R., 1999. Lindane-induced inhibition of spontaneous contractions of pregnant rat uterus. Reprod. Toxicol. 13, 481–490. Dominguez-Lopez, P., Diaz-Cueto, L., Olivares, A., Ulloa-Aguirre, A., ArechavaletaVelasco, F., 2012. Differential effect of DDT, DDE, and DDD on COX-2 expression in the human trophoblast derived HTR-8/SVneo cells. J. Biochem. Mol. Toxicol. 26, 454–460. Farhang, L., Weintraub, J.M., Petreas, M., Eskenazi, B., Bhatia, R., 2005. Association of DDT and DDE with birth weight and length of gestation in the Child Health and Development Studies, 1959–1967. Am. J. Epidemiol. 162, 717–725. Fenster, L., Eskenazi, B., Anderson, M., Bradman, A., Harley, K., Hernandez, H., Hubbard, A., Barr, D.B., 2006. Association of in utero organochlorine pesticide exposure and fetal growth and length of gestation in an agricultural population. Environ. Health Perspect. 114, 597–602. Fields, M.J., Fields, P.A., 1996. Morphological characteristic of the bovine corpus luteum during the estrous cycle and pregnancy. Theriogenology 45, 1295–1325. Franczak, A., Kotwica, G., Kurowicka, B., Oponowicz, A., Woclawek-Potocka, I., Petroff, B.K., 2006. Expression of enzymes of cyclooxygenase pathway and secretion of prostaglandin E2 and F2alpha by porcine myometrium during luteolysis and early pregnancy. Theriogenology 15, 1049–1056.

60

M.H. Wrobel et al. / Environmental Research 132 (2014) 54–61

Fromberg, A., Cleemann, M., Carlsen, L., 1999. Review on persistent organic pollutants in the environment of Greenland and Faroe Islands. Chemosphere 38, 3075–3093. Gerhard, I., Daniel, V., Link, S., Monga, B., Runnebaum, B., 1998. Chlorinated hydrocarbons in women with repeated miscarriages. Environ. Health Perspect. 106, 675–681. Glynn, A.W., Wernroth, L., Atuma, S., Linder, C.E., Aune, M., Nilsson, I., Darnerud, P. O., 2000. PCB and chlorinated pesticide concentrations in swine and bovine adipose tissue in Sweden 1991–1997: spatial and temporal trends. Sci. Total Environ. 10, 195–206. Goff, A.K., 2004. Steroid hormone modulation of prostaglandin secretion in the ruminant endometrium during the estrous cycle. Biol. Reprod. 71, 11–16. Gunasekaran, K., Sahu, S.S., Jambulingam, P., Das, P.K., 2005. DDT indoor residual spray, still an effective tool to control Anopheles fluviatilis-transmitted Plasmodium falciparum malaria in India. Trop. Med. Int. Health 10, 160–168. Hlongwana, K.W., Mavundza, E.J., Mohapi, E.P., Kruger, P., Urbach, J., Mukaratirwa, S., Maharaj, R., 2013. Vector-control personnel's knowledge, perceptions and practices towards insecticides used for indoor residual spraying in Limpopo Province, South Africa. Parasit. Vectors 6, 118. Horita, H., Kuroda, E., Hachisuga, T., Kashimura, M., Yamashita, U., 2007. Induction of prostaglandin E2 production by leukemia inhibitory factor promotes migration of first trimester extravillous trophoblast cell line, HTR-8/SVneo. Hum. Reprod. 22, 1801–1809. Ireland, J.J., Murphee, R., Coulson, P.B., 1980. Accuracy of predicting stages of bovine estrous cycle by gross appearance of the corpus luteum. J. Dairy Sci. 63, 155–160. Juberg, D.R., Loch-Caruso, R., 1992. Investigation of the role of estrogenic action and prostaglandin E2 in DDT-stimulated rat uterine contractions ex vivo. Toxicology 74, 161–172. Juberg, D.R., Stuenkel, E.L., Loch-Caruso, R., 1995. DDD chlorinated insecticide 1,1dichloro-2,2-bis(4-chlorophenyl)ethane (p,p0 -DDD) increases intracellular calcium in rat myometrial smooth muscle cells. Toxicol. Appl. Pharmacol. 135, 147–155. Juberg, D.R., Webb, R.C., Loch-Caruso, R., 1991. Characterization of o,p0 -DDT-stimulated contraction frequency in rat uterus in vitro. Fundam. Appl. Toxicol. 17, 543–549. Kamarianos, A., Karamanlis, X., Goulas, P., Theodosiadou, E., Smokovitis, A., 2003. The presence of environmental pollutants in follicular fluid of farm animals (cattle, sheep, goats and pigs). Reprod. Toxicol. 17, 185–195. Korrick, S.A., Chen, C., Damokosh, A.I., Ni, J., Liu, X., Cho, S., Altshul, L., Ryan, L., Xu, X., 2001. Association of DDT with spontaneous abortion: a case-control study. Ann. Epidemiol. 11, 491–496. Kotwica, G., Kurowicka, B., Franczak, A., Grzegorzewski, W., Wrobel, M., Mlynarczuk, J., Kotwica, J., 2003. The concentrations of catecholamines and oxytocin receptors in the oviduct and its contractile activity in cows during the estrous cycle. Theriogenology 60, 953–964. Kotwica, J., Skarzynski, D., Miszkiel, G., Melin, P., Okuda, K., 1999. Oxytocin modulates the pulsatile secretion of prostaglandin F2alpha in initiated luteolysis in cattle. Res. Vet. Sci. 66, 1–5. Kroll, B., Kunz, S., Klein, T., Schwarz, L.R., 1999. Effect of lindane and phenobarbital on cyclooxygenase-2 expression and prostanoid synthesis by Kupffer cells. Carcinogenesis 20, 1411–1416. Kuiper, G.G.J.M., Lemmen, J.G., Carlsson, B., Corton, J.C., Safe, S.H., van der Saag, P.T., van der Burg, B., Gustafsson, J.A., 1998. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor. Endocrinology 139, 4252–4263. Li, J., Li, N., Ma, M., Gies, J.P., Wang, Z., 2008. in vitro profiling of the endocrine disrupting potency of organochlorine pesticides. Toxicol. Lett. 183, 65–71. Li, Y.F., Zhulidov, A.V., Robarts, R.D., Korotova, L.G., Zhulidov, D.A., Gurtovaya, T.Y., Ge, L.P., 2006. Dichlorodiphenyltrichloroethane usage in the former Soviet Union. Sci. Total Environ. 357, 138–145. Llop, S., Ballester, F., Vizcaino, E., Murcia, M., Lopez-Espinosa, M.J., Rebagliato, M., Vioque, J., Marco, A., Grimalt, J.O., 2010. Concentrations and determinants of organochlorine levels among pregnant women in Eastern Spain. Sci. Total Environ. 408, 5758–5767. Longnecker, M.P., Klebanoff, M.A., Dunson, D.B., Guo, X., Chen, Z., Zhou, H., Brock, J. W., 2005. Maternal serum level of the DDT metabolite DDE in relation to fetal loss in previous pregnancies. Environ. Res. 97, 127–133. Longnecker, M.P., Klebanoff, M.A., Zhou, H., Brock, J.W., 2001. Association between maternal serum concentration of the DDT metabolite DDE and preterm and small-for-gestational-age babies at birth. Lancet 358, 110–114. Meeker, J.D., Missmer, S.A., Altshul, L., Vitonis, A.F., Ryan, L., Cramer, D.W., Hauser, R., 2009. Serum and follicular fluid organochlorine concentrations among women undergoing assisted reproduction technologies. Environ. Health 14, 8–32. Meyer, H.H.D., Enzenhofer, G., Feck, H., 1989. Improvement of radioimmunoassays for prostaglandins in bovine blood plasma and their application to monitor reproductive functions. Theriogenology 31, 701–720. Mlynarczuk, J., Wrobel, M.H., Kotwica, J., 2010. Effect of environmental pollutants on oxytocin synthesis and secretion from corpus luteum and on contractions of uterus from pregnant cows. Toxicol. Appl. Pharmacol. 247, 243–249. Mustafa, M.D., Banerjee, B.D., Ahmed, R.S., Tripathi, A.K., Guleria, K., 2013. Geneenvironment interaction in preterm delivery with special reference to organochlorine pesticides. Mol. Hum. Reprod. 19, 35–42. Ngueleu, S.K., Grathwohl, P., Cirpka, O.A., 2013. Effect of natural particles on the transport of lindane in saturated porous media: laboratory experiments and model-based analysis. J. Contam. Hydrol. 149, 13–26. Nweke, O.C., Sanders III, W.H., 2009. Modern environmental health hazards: a public health issue of increasing significance in Africa. Environ. Health Perspect. 117, 863–870.

Okuda, K., Miyamoto, A., Sauerwein, H., Schweigert, F.J., 1992. Evidence of oxytocin receptors in cultured bovine luteal cells. Biol. Reprod. 46, 1001–1006. Pathak, R., Suke, S.G., Ahmed, T., Ahmed, R.S., Tripathi, A.K., Guleria, K., Sharma, C.S., Makhijani, S.D., Banerjee, B.D., 2010. Organochlorine pesticide residue levels and oxidative stress in preterm delivery cases. Hum. Exp. Toxicol. 29, 351–358. Pazou, Y.A.E., Azehoun, J.P., Aleodjrodo, P.E., van Straalen, N.M., van Hattum, B., van Gestel, C.A., 2013. Health risks associated with pesticide residues in sediments, fish, and plants from the Ouémé Valley in the Republic of Bénin. Arch. Environ. Contam. Toxicol. 65, 260–265. Pöhland, R., Tiemann, U., 2003. Forskolin-induced cyclic AMP signaling in single adherent bovine oviductal cells: effect of dichlorodiphenyltrichloroethane (DDT) and tris(4-chlorophenyl)methanol (TCPM). Toxicol. in vitro 17, 375–383. Polishuk, Z.W., Wassermann, D., Wasserman, M., Cucos, S., Ron, M., 1977. Organochlorine compounds in mother and fetus during labor. Environ. Res. 13, 278–284. Reinhart, K.C., Dubey, R.K., Keller, P.J., Lauper, U., Rosselli, M., 1999. Xeno-estrogens and phyto-estrogens induce the synthesis of leukaemia inhibitory factor by human and bovine oviduct cells. Mol. Hum. Reprod. 5, 899–907. Reinhart, K.C., Dubey, R.K., Mummery, C.L., van Rooijen, M., Keller, P.J., Rosselli, M., 1998. Synthesis and regulation of leukaemia bovine oviduct cells by hormones. Mol. Hum. Reprod. 4, 301–308. Rekawiecki, R., Kowalik, M.K., Kotwica, J., 2013. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium. Acta Vet. Hung. 61, 505–516. Rekawiecki, R., Rutkowska, J., Kotwica, J., 2012. Identification of optimal housekeeping genes for examination of gene expression in bovine corpus luteum. Reprod. Biol. 12, 362–367. Rogan, W.J., Chen, A., 2005. Health risks and benefits of bis(4-chlophenyl)-1,1,1trichloroethane (DDT). Lancet 366, 763–773. Ruttner, Z., Ivanics, T., Slaaf, D.W., Reneman, R.S., Toth, A., Liqeti, L., 2002. in vivo monitoring of intracellular free calcium changes during uterine activation by prostaglandin f(2alpha) and oxytocin. J. Soc. Gynecol. Investig. 9, 294–298. Saxena, M.C., Siddiqui, M.K., Bhargava, A.K., Seth, T.D., Krishnamurti, C.R., Kutty, D., 1980. Role of chlorinated hydrocarbon pesticides in abortions and premature labour. Toxicology 17, 323–331. Senior, J., Marshall, K., Sangha, R., Clayton, J.K., 1993. in vitro characterization of prostanoid receptors on human myometrium at term pregnancy. Br. J. Pharmacol. 108, 501–506. Skarzynski, D.J., Bogacki, M., Kotwica, J., 1997. Changes in ovarian oxytocin secretion as an indicator of corpus luteum response to prostaglandin F2a treatment in cattle. Theriogenology 48, 733–742. Skarzynski, D.J., Bogacki, M., Kotwica, J., 1999. Involvement of ovarian steroids in basal and oxytocin-stimulated prostaglandin (PG) F2α secretion by the bovine endometrium in vitro. Theriogenology 52, 385–597. Slonina, D., Kowalik, M.K., Subocz, M., Kotwica, J., 2009. The effect of ovarian steroids on oxytocin-stimulated secretion and synthesis of prostaglandins in bovine myometrial cells. Prostaglandins Other Lipid Mediat. 90, 69–75. Takabatake, K., Fujiwara, H., Goto, Y., Nakayama, T., Higuchi, T., Fujita, J., Maeda, M., Mori, T., 1997. Splenocytes in early pregnancy promote embryo implantation by regulating endometrial differentiation in mice. Hum. Reprod. 12, 2102–2107. Taylor, P.R., Stelma, J.M., Lawrence, C.E., 1989. The relation of polychlorinated biphenyl to birth weight and gestational age in the offspring of occupationally exposed mothers. Am. J. Epidemiol. 129, 395–406. Toft, G., Hagmar, L., Giwercman, A., Bonde, J.P., 2004. Epidemiological evidence on reproductive effects of persistent organochlorines in humans. Reprod. Toxicol. 19, 5–26. Torres-Arreola, L., Berkowitz, G., Torres-Sanchez, L., Lopez-Cervantes, M., Cebrian, M.E., Uribe, M., Lopez-Carrillo, L., 2003. Preterm birth in relation to maternal organochlorine serum levels. Ann. Epidemiol. 13, 158–162. Tsai, M.L., Webb, R.C., Loch-Caruso, R., 1996. Congener-specific effects of PCBs on contractions of pregnant rat uteri. Reprod. Toxicol. 10, 21–28. Tsai, W.T., 2010. Current status and regulatory aspects of pesticides considered to be persistent organic pollutants (POPs) in Taiwan. Int. J. Environ. Res. Public Health 7, 3615–3627. Turusov, V., Rakitsky, V., Tomatis, L., 2002. Dichlorodiphenyltrichloroethane (DDT): ubiquity, persistence, and risks. Environ. Health Perspect. 110, 125–128. Venners, S.A., Korrick, S., Xu, X., Chen, C., Guang, W., Huang, A., Altshul, L., Perry, M., Fu, L., Wang, X., 2005. Preconception serum DDT and pregnancy loss: a prospective study using a biomarker of pregnancy. Am. J. Epidemiol. 162, 709–716. Voss, A.K., Fortune, J.E., 1993. Estradiol-17β has biphasic effect on oxytocin secretion by bovine granulosa cells. Biol. Reprod. 48, 1404–1409. Wang, C.T., Loch-Caruso, R., 2002. Phospholipase-mediated inhibition of spontaneous oscillatory uterine contractions by lindane in vitro. Toxicol. Appl. Pharmacol. 182, 136–147. Wood, S.L., Jarrell, J.J., Swaby, C., Chan, S., 2007. Endocrine disruptors and spontaneous premature labor: a case control study. Environ. Health 15, 6–35. Wray, S., Jones, K., Kupittayanant, S., Li, Y., Matthew, A., Monir-Bishty, E., Noble, K., Pierce, S.J., Quenby, S., Shmygol, A.V., 2003. Calcium signaling and uterine contractility. J. Soc. Gynecol. Investig. 10, 252–263. Wrobel, M., Kaminski, K., Kotwica, J., 2005. in vitro effects of polychlorinated biphenyls (PCBs) on the contractility of bovine myometrium from the periovulatory stage of the estrous cycle. Reprod. Biol. 5, 303–319. Wrobel, M., Kotwica, J., 2005. Effect of polychlorinated biphenyls (PCBs) on basal and OT-stimulated calcium concentrations in myometrial cells in cows. Reprod. Biol. 5, 321–330. Wrobel, M., Mlynarczuk, J., Kotwica, J., 2009. The adverse effect of dichlorodiphenyltrichloroethane (DDT) and its metabolite (DDE) on the secretion of

M.H. Wrobel et al. / Environmental Research 132 (2014) 54–61

prostaglandins and oxytocin in bovine cultured ovarian and endometrial cells. Reprod. Toxicol. 27, 72–78. Wrobel, M.H., Mlynarczuk, J., Kotwica, J., 2012. The effect of DDT and its metabolite (DDE) on prostaglandin secretion from epithelial cells and on contractions of the smooth muscle of the bovine oviduct in vitro. Toxicol. Appl. Pharmacol. 259, 152–159.

61

Wrobel, M.H., Rekawiecki, R., Kotwica, J., 2009. Involvement of prostaglandin F2α in the adverse effect of PCB 77 on the force of contractions of bovine myometrium. Toxicology 262, 224–229. Zhao, S., Fernald, R., 2005. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J. Comput. Biol. 12, 1045–1062.