BJD
British Journal of Dermatology
C L I N I C A L A N D LA B O R A T O R Y I N V E S T I G A T I O N S
Impaired function of CD19+CD24hiCD38hi regulatory B cells in patients with pemphigus H.-Q. Zhu,1,2 R.-C. Xu,1 Y.-Y. Chen,1 H.-J. Yuan,1 H. Cao,1 X.-Q. Zhao,1 J. Zheng,1 Y. Wang3 and M. Pan1 1
Department of Dermatology, Rui Jin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China Department of Dermatology, Rui Jin Hospital North, School of Medicine, Shanghai Jiao Tong University, Shanghai, China 3 Shanghai Institute of Immunology, Shanghai Jiao Tong University, Shanghai, China 2
Summary Correspondence Meng Pan. E-mail: [email protected]
Accepted for publication 9 June 2014
Funding sources This work was supported by grants from the National Natural Science Foundation of China (81171499, 81201230) and the Shanghai Science and Technology Commission (10JC1410600).
Conflicts of interest None declared. H.-Q.Z. and R.-C.X. contributed equally to this work. DOI 10.1111/bjd.13192
Background Pemphigus is an organ-specific autoimmune bullous disease. Objectives To determine the role of regulatory B cells (Bregs) in patients with pemphigus. Methods The frequency of the occurrence of CD19+CD24hiCD38hi Bregs was detected from 34 patients with pemphigus and 20 healthy controls. Interleukin (IL)-10 secretion was processed after stimulating B cells. Specific antidesmoglein antibody (Ab) titres and their subclasses were also measured. Ab response and cytokine production from peripheral blood mononuclear cells (PBMCs) with or without Bregs were analysed. Results The number of Bregs was significantly increased in patients with pemphigus compared with healthy controls (15 7% vs. 9 3%; P < 001) and the proportion of Bregs in the active groups (newly diagnosed and chronic active patients) was significantly higher than in remittent individuals (16 7% vs. 13 8%; P = 004). The IL-10-producing B cells were significantly increased upon stimulation both in patients and in healthy controls. However, the increase ratio of IL-10-producing B cells between short- and long-term stimulation was significantly lower in patients with pemphigus (10-fold vs. 26-fold increase in control group; P < 001). Strikingly, Bregs from the controls were able to suppress interferon (IFN)-c expression and T helper cell 1 (Th1) immune response (26% inhibition rate), while the suppressive function of Bregs from patients with pemphigus was significantly decreased (9% inhibition rate). There was no difference in Ab levels from PBMCs with or without Bregs after stimulation. Conclusions Bregs in patients with pemphigus are elevated but with defective regulatory function on Th1 cells.
What’s already known about this topic?
• •
Pemphigus is an organ-specific autoimmune bullous disease in which the pathogenic mechanism is complicated and not fully understood. Various regulatory cells and cytokines have been associated with pemphigus; however, regulatory B cells (Bregs) have not been well studied in the disease.
What does this study add?
• •
© 2014 British Association of Dermatologists
To the best of our knowledge, this is the first study to analyse the regulatory function of CD19+CD24hiCD38hi Bregs in pemphigus. CD19+CD24hiCD38hi Bregs in patients with pemphigus are elevated but with defective regulatory function on T helper 1 cells.
British Journal of Dermatology (2015) 172, pp101–110
101
102 Regulatory B cells in pemphigus, H.-Q. Zhu et al.
Pemphigus is a classical model of an organ-specific autoimmune disease, characterized by intraepidermal blistering of mucous membranes and skin.1–3 Passive transfer of the serum desmoglein (Dsg)–IgG fraction from patients with pemphigus to neonatal mice induces pemphigus-like lesions, suggesting an essential pathogenic role of anti-Dsg autoantibodies (autoAbs) in the development of the disease.4 Dsg-reactive T cells are believed to play an important role in the pathogenesis of pemphigus.5 Recently, we observed that CD4+ T cells from Dsg3-immunized mice provided a direct stimulation to unprimed B cells, suggesting that Dsg3-reactive T cells are responsible for pathogenic IgG production in patients with pemphigus.6 In addition to the effector T–B cell interaction, the potential imbalance of CD4+ regulatory T cells (Tregs) has also been implicated in pemphigus.7,8 Our previous study demonstrated that CD4+CD25hiFoxp3+ Tregs were significantly lower in patients with pemphigus.8 The marked reduction of Tregs may be involved in the loss of tolerance against Dsg in pemphigus. Activated B cells are generally considered to be pathogenic regulators in patients with pemphigus via secretion of antiDsg3 autoAbs. However, recent studies have described a new subset of B cells that is capable of downregulating immune responses in mice and humans: regulatory B cells (Bregs),9,10 a term coined by Mizoguchi and Bhan used to designate B cells with inhibitory properties.11 One of the mechanisms by which Bregs regulate immunological inflammation is through the production of interleukin-10 (IL-10).12 These IL-10-producing B cells are now termed ‘B10 cells’ or ‘Br1’.13 Recently, other Breg subsets, such as transforming growth factor (TGF)b-producing Br3 or Foxp3-expressing Bregs, have been also identified.14,15 There have been significant advances in understanding the role of Bregs in mouse models of autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematous (SLE) and experimental autoimmune encephalomyelitis.16–18 In addition, evidence is emerging that Bregs also play a critical role in human autoimmune diseases such as SLE and multiple sclerosis.19,20 However, the role of Bregs in the pathogenesis of pemphigus has not been elucidated. In this study, we examined the frequency and the function of Bregs in the peripheral blood of patients with pemphigus. The results suggest that Bregs in patients with pemphigus are elevated in peripheral blood and exhibit defective regulatory activities on T cells.
Materials and methods Patients Thirty-four patients with pemphigus and 20 healthy controls were enrolled in this study (Table S1). The diagnosis of pemphigus was confirmed by clinical presentation, histology and at least one positive serological test [immunofluorescence or Dsg enzyme-linked immunosorbent assay (ELISA)].21 Among them, nine patients were newly diagnosed and had not received treatment. The remaining patients, of whom eight British Journal of Dermatology (2015) 172, pp101–110
were in the chronic active stage (the expansion/persistence of existing blisters or erosions on mucosal surfaces and/or skin) and 17 were in the remittent stage (those who had not experienced new blisters/erosions for ≥ 6 months before the start of the study), had been treated with immunosuppressive therapy. The untreated (newly diagnosed) and the chronic active patients were termed the ‘active stage’ group.22 All patients with pemphigus and healthy controls gave written consent to participate in this study, which was approved by the local ethics committee. Desmoglein-specific antibody titres and their subclasses Abs against Dsg1/Dsg3 were measured by ELISA (Medical and Biological Laboratories Co., Nagoya, Japan), according to the manufacturer’s instructions. IgG1 and IgG4 subclass levels were measured as previously described.6 Flow cytometric determination of the regulatory B cell phenotype Peripheral blood mononuclear cells (PBMCs) were collected and cultured with ODN 2006 (10 lg mL1; InvivoGen, San Diego, CA, U.S.A.), lipopolysaccharide (LPS) (10 lg mL1; Sigma-Aldrich, St. Louis, MO, U.S.A.), CD40L (1 lg mL1; R&D Systems, Minneapolis, MN, U.S.A.), phorbol myristate acetate (PMA) (50 ng mL1; Sigma-Aldrich) and Ionomycin (1 lg mL1; Sigma-Aldrich) for the analysis of CD19+CD24hiCD38hi Bregs phenotype by flow cytometry (BD Biosciences, San Diego, CA, U.S.A.). Cells were stained with the following antihuman monoclonal Abs: fluorescein isothiocyanate-conjugated CD19, phycoerythrin (PE)–Cy55-conjugated CD24 and allophycocyanin-conjugated CD38 for surface staining. Cells were then fixed and permeabilized, and stained with PE-conjugated IL-10 or PE-conjugated mouse IgG1 isotype control adapted from the Cytofix/CytopermTM Plus Fixation/Permeabilization Kit (Becton Dickinson, Franklin Lakes, NJ, U.S.A.). Quantitative real-time polymerase chain reaction analysis In six healthy participants, fresh cell suspensions of CD19+CD24hiCD38hi Bregs and CD19+CD24intCD38int B cells were sorted individually from PBMCs and stored at 80 °C until use. Quantitative real-time polymerase chain reaction (qPCR) detection of IL-10, IL-6 and TGF-b was performed in these two cell populations. Total RNA was isolated using an RNeasyâ Kit (Qiagen, Hilden, Germany). Reverse transcription to complementary DNA was carried out by standard methods using reverse transcriptase (Roche Diagnostics, Meylan, France) and deoxyribonucleotide triphosphate (Roche Diagnostics). PCRs were conducted in a LightCycler instrument (Roche Diagnostics). The sequences of primers were as follows (listed 50 –30 ): glyceraldehyde 3-phosphate dehydrogenase [forward (F): GAAGGTGAAGGTCGGAGTC; reverse (R): © 2014 British Association of Dermatologists
Regulatory B cells in pemphigus, H.-Q. Zhu et al. 103
GAAGATGGTGATGGGATTTC]; human IL-6 (F: CAGGAGCC CAGCTATGAACT; R: GGAATCTTCTCCTGGGGGTA); human IL-10 (F: CTGAGAACCAAGACCCAGACATC; R: AAGGCATTCT TCACCTGCTCCAC); human TGF-b (F: CGTCTGCTGAGGCTCAAGTT; R: CAACTCCGGTGACATCAAAA) (Sangon Biotech, Shanghai, China). In vitro stimulation and flow cytometric analysis of interleukin-10-producing B cells PBMCs from patients with pemphigus and healthy controls were cultured with ODN 2006 (10 lg mL1; InvivoGen), LPS (10 lg mL1; Sigma-Aldrich) and CD40L (1 lg mL1; R&D Systems) for 5 or 48 h [PMA 50 ng mL1 (Sigma-Aldrich), Ionomycin 1 lg mL1 (Sigma-Aldrich) and Golgi StopTM (02 lL; BD Biosciences) for the last 5 h of culture] for analysis of the intracellular staining of IL-10 in order to evaluate the percentage of IL-10-producing B cells by flow cytometry.
(n = 6) were stimulated with plate-bound CD3 mAb/CD28 mAb (05 mg mL1) for 72 h, with PMA (Sigma-Aldrich) and Ionomycin (Sigma-Aldrich) for the last 5 h of culture. Meanwhile, the co-culture of sorted CD4+ T cells with autologous CD19+CD24hiCD38hi Bregs (2: 1) or CD4+ T cells alone from patients or healthy controls with the stimulus was also performed. The production of cytokines in CD4+ T cells was tested by flow cytometry. Statistical analysis Aggregate data are presented as mean SEM. For nonparametric data, the Mann–Whitney U-test was used to analyse for individual groups. All analyses were performed using GraphPad Prism (GraphPad Software Inc., La Jolla, CA, U.S.A.). A P-value < 005 was considered significant for all analyses.
Results Total IgG/IgM levels after in vitro culture
Cytokine detection from CD4+ T cells after in vitro culture Cultures of Breg-depleted PBMCs or total PBMCs from patients newly diagnosed with pemphigus (n = 9) or healthy controls
U mL–1
(a)
300
*
200
*
100
Characterization of antidesmoglein 1/3 IgG antibody levels and their subclass distribution in patients with pemphigus To evaluate the specific anti-Dsg Ab levels and their subclasses, IgG Abs from the patients’ sera was tested. The specific Ab level in patients in the active stage (newly diagnosed and chronic active) was significantly higher than in patients in the remittent stage [Dsg1: 1090 597 U mL1 vs. 663 549 U mL1 (P = 004); Dsg3: 906 753 U mL1 vs. 198 263 U mL1 (P = 004)] (Fig. 1a). Furthermore, for anti-Dsg1 IgG-positive samples, the mean ratio of IgG4: IgG1 was 54-fold (P < 0001) higher in patients in the active stage than those in the remittent stage. This marked trend was also observed with anti-Dsg3 IgG Ab (Fig. 1b). These data show that the titres of autoAbs against Dsg correlate with disease activity. In addition, there seems to be a strong association between the increase of IgG4 anti-Dsg levels and the development of clinical activity.
(b)
6
IgG4/IgG1
PBMCs were collected from patients newly diagnosed with pemphigus (n = 5). CD19+CD24hiCD38hi Bregs were sorted from total PBMCs. For in vitro culture, PBMCs with or without Bregs (106 cells mL1) placed in 48-well U-bottom plates (250 lL per well; BD Biosciences) were stimulated with ODN 2006 (10 lg mL1; InvivoGen), LPS (10 lg mL1; SigmaAldrich) and CD40L (1 lg mL1; R&D Systems) for 7 days; the supernatant was then collected for Ab analysis. Total IgG/IgM levels in the supernatant were determined by ELISA (Southern Biotechnology Associates Inc., Birmingham, AL, U.S.A.) according to the manufacturer’s instructions, and IgG/IgM concentrations were calculated from the standard curves.
4
Remittent Active Remittent Active anti-Dsg1 anti-Dsg3
**
2
0
0
***
Remittent Active anti-Dsg1
Remittent Active anti-Dsg3
Fig 1. Characterization of IgG antidesmoglein (Dsg)1 and anti-Dsg3 antibodies (Abs) by enzyme-linked immunosorbent assay (ELISA) and their subclass distributions in patients with pemphigus. The pemphigus-specific Abs and their subclasses were evaluated in patients’ sera using a specific Dsg ELISA assay. (a) Scatter plots of IgG anti-Dsg1 and anti-Dsg3 in patients with active pemphigus (n = 17; newly diagnosed and chronic active) and the remittent group (n = 17). *P < 005. (b) Box plots represent the mean SEM of Dsg-specific IgG4/IgG1 in patients with pemphigus distributed according to disease activity. **P < 001, ***P < 0001. Statistical analyses performed using the Mann–Whitney U-test. © 2014 British Association of Dermatologists
British Journal of Dermatology (2015) 172, pp101–110
104 Regulatory B cells in pemphigus, H.-Q. Zhu et al.
CD19+CD24hiCD38hi regulatory B cells are increased in frequency in patients with pemphigus In this study, to confirm the phenotype of Bregs, a multicolour staining panel was used to identify Bregs among PBMCs via surface markers and intracellular IL-10 staining (Fig. 2a). As shown in Fig. 2(b), a significantly higher percentage of CD19+ CD24hiCD38hi Bregs produced IL-10 than CD19+CD24int CD38int B cells (16 4% vs. 5 1%; P < 001). To further validate the intracellular IL-10 flow cytometric analysis, CD19+CD24hiCD38hi Bregs and CD19+CD24intCD38int B cells were sorted from PBMCs and the mRNA levels of IL-10, IL-6 and TGF-b were determined. The results demonstrated that the mRNA expression level of IL-10 was significantly higher in the CD19+CD24hiCD38hi Bregs compared than in CD19+CD24intCD38int B cells (Fig. 2c). In contrast, mRNA expression levels of IL-6 and TGF-b were almost similar between these two populations. Taken together, these data indicate that CD19+CD24hiCD38hi Bregs comprise a major IL10-producing B cell population and may exhibit regulatory activity via the production of IL-10. Next, we examined the frequency of CD19+CD24hiCD38hi Bregs in patients with pemphigus. Surprisingly, there was higher percentage of circulating CD19+CD24hiCD38hi Bregs in PBMCs of patients with pemphigus compared with healthy individuals (15 7% vs. 9 3%; P < 001). Furthermore, CD19+CD24hiCD38hi Breg frequencies in both newly diagnosed (untreated) patients (17 8%) and the treated group (14 7%) were much higher than in the healthy controls (P < 001 and P < 001, respectively), although there were no statistical differences between these two groups (P = 012) (Fig. 2d). Breg frequency in the active group (newly diagnosed and chronic active patients) (16 7%) was significantly higher than in the remittent group (13 8%; P = 004). Both groups were higher than control individuals (P < 001 and P = 001, respectively) (Fig. 2e). These data indicate an elevated Breg frequency in patients with pemphigus compared with healthy controls, which relates to disease activity. The ability of CD19+ B cells to produce interleukin-10 is altered in patients with pemphigus To test whether the ability to produce IL-10 by these B cells is intact, PBMCs from patients or healthy individuals were cultured with B-cell stimuli, including ODN 2006 (InvivoGen), LPS (Sigma-Aldrich) and CD40L (R&D Systems). Intracellular staining of IL-10 was determined after stimulation (Fig. 3a). There was no significant difference in the percentage of B cells in PBMCs between the pemphigus group and healthy controls (Fig. 3b). The total frequency of IL-10-producing B cells in CD19+ B cells was significantly increased upon stimulation, both in the patient group [from 2 2% (5 h) to 4 1% (48 h); P < 001] and in healthy controls [from 2 1% (5 h) to 5 3% (48 h); P < 001] (Fig. 3c). Strikingly, there was a 26-fold increase in healthy groups compared with a British Journal of Dermatology (2015) 172, pp101–110
10-fold increase in patients after 48 h of stimulation. The fold increase of IL-10-producing B cells in patients with pemphigus was significantly lower than that of the control group (P < 001) (Fig. 3d). These data suggest that Bregs from patients with pemphigus have a lower capacity of producing IL-10 after long-term stimulation, indicating an impaired function despite these cells showing almost intact function during short-term stimulation. This may be related to the pathogenesis of pemphigus as it is a chronic blistering skin disease where constant stimulation may exist. Total immunoglobulin levels of B cells cultured with or without CD19+CD24hiCD38hi regulatory B cells are not altered To further identify the regulatory function of CD19+CD24hi CD38hi Bregs on Ab-producing B cells, we sorted the Breg population from patients with pemphigus. However, Bregs constitute a small population in PBMCs and, owing to the difficulty of obtaining sufficient numbers of CD19+CD24hiCD38hi Bregs from patients, we evaluated whether depletion of CD19+CD24hi CD38hi Bregs from PBMCs affected IgG/IgM production. After culturing with B-cell stimulus for 72 h, there was no significant difference in total IgG or IgM production from the supernatants of Breg-depleted PBMCs compared with total PBMCs from patients with pemphigus or healthy controls (Fig. 4a,b). These data suggest that there is no difference in IgG/IgM Ab production by PBMCs with or without Bregs, both in the patient and control groups. CD4+ T cell cytokine production from peripheral blood mononuclear cells is unable to be regulated by CD19+CD24hiCD38hi regulatory B cells isolated from patients with pemphigus We next investigated the regulation of Bregs on CD4+ T cells to see whether CD19+CD24hiCD38hi Bregs from patients with pemphigus could suppress CD4+ T cell cytokine production. We performed the experiments on PBMCs and sorted CD4+ T cells. We observed that CD19+CD24hiCD38hi Bregs from controls were able to suppress interferon (IFN)-c expression of healthy CD4+ T cells, which is consistent with previous reports.19 Sorted CD4+ T cells co-cultured with autologous CD19+CD24hiCD38hi Bregs from healthy controls led to a significant decrease in the percentage of CD4+ IFN-c+ T cells (co-culture vs. cultured alone: 8 1% vs. 13 2%; P = 004) (Fig. 5a); the inhibition rate was 26%. Surprisingly, from the patient group, CD19+CD24hiCD38hi Bregs did not significantly suppress the production of IFN-c by autologous CD4+ T cells (co-culture vs. cultured alone: 9 1% vs. 10 1%; P = 060); the inhibition rate was 9% – much lower than that of the control group (Fig. 5a). Meanwhile, total PBMCs, with or without CD19+CD24hiCD38hi Bregs, were cultured in vitro to detect the frequency of CD4+IFN-c+ T cells. A trend towards an increased frequency of CD4+IFN-c+ T cells was observed in Breg-depleted PBMCs compared with © 2014 British Association of Dermatologists
Regulatory B cells in pemphigus, H.-Q. Zhu et al. 105
(a)
(c)
(b)
(d)
(e)
Fig 2. Statistical analysis of CD19+CD24hiCD38hi regulatory B cells (Bregs) in patients with pemphigus and healthy controls. Peripheral blood mononuclear cells (PBMCs) isolated from healthy controls (n = 6) were stimulated with ODN 2006 (10 lg mL1; InvivoGen, San Diego, CA, USA), lipopolysaccharide (10 lg mL1; Sigma-Aldrich, St. Louis, MO, U.S.A.), CD40L (1 lg mL1; R&D Systems, Minneapolis, MN, U.S.A.), phorbol myristate acetate (50 ng mL1; Sigma-Aldrich), Ionomycin (1 lg mL1; Sigma-Aldrich) and Golgi StopTM (02 lL; BD Biosciences, San Diego, CA, U.S.A.) for 5 h and then stained with antihuman monoclonal antibodies [CD19, CD24, CD38 and interleukin (IL)-10] for analysis of the phenotype of CD19+CD24hiCD38hi Bregs by flow cytometry. (a) Representative comparative phenotype of IL-10 produced by different B-cell subsets from a healthy control. (b) Box plots of mean SEM percentage of IL-10 expression by CD19+CD24hiCD38hi Bregs and CD19+CD24intCD38int B cells. Compared with CD19+CD24intCD38int B cells, a significantly higher percentage of CD19+CD24hiCD38hi Bregs were IL-10-producing B cells. **P < 001. (c) In these six healthy participants, some CD19+CD24hiCD38hi Bregs and CD19+CD24intCD38int B cells were sorted from fresh PBMCs and used for quantitative real-time polymerase chain reaction detection of relative mRNA levels of IL-10, IL-6 and transforming growth factor (TGF)-b. The relative mRNA levels of cytokines in CD19+CD24intCD38int B cells were set to 1. Only the relative mean SEM level of IL-10 mRNA was significantly higher in the CD19+CD24hiCD38hi Bregs. *P < 005. (d, e) The results are shown as mean SEM percentage of CD19+CD24hiCD38hi Breg cells in all patients with pemphigus [n = 34; nine newly diagnosed patients who had not received any treatment and 25 treated patients (eight chronic active patients and 17 remittent patients)] and healthy controls (n = 20) enrolled in this study. ***P < 0001, **P < 001, *P < 01. SSC-A, side scatter. © 2014 British Association of Dermatologists
British Journal of Dermatology (2015) 172, pp101–110
106 Regulatory B cells in pemphigus, H.-Q. Zhu et al.
(a)
(b)
(c)
(d)
Fig 3. The ability of CD19+ B cells to produce interleukin (IL)-10. Peripheral blood mononuclear cells (PBMCs) of healthy individuals (n = 15) or patients with pemphigus (n = 34) were stimulated in vitro for 5 or 48 h with ODN 2006 (10 lg mL1; InvivoGen, San Diego, CA, U.S.A.), lipopolysaccharide (10 lg mL1; Sigma-Aldrich, St. Louis, MO, U.S.A.) and CD40L (1 lg mL1; R&D Systems, Minneapolis, MN, U.S.A.), and with phorbol myristate acetate (50 ng mL1; Sigma-Aldrich), Ionomycin (1 lg mL1; Sigma-Aldrich) and Golgi StopTM (02 lL; BD Biosciences, San Diego, CA, U.S.A.) for the last 5 h of culture. CD19+IL-10+ B cells were measured by flow cytometry by intracellular cytokine staining. (a) Representative comparative phenotype of CD19+IL-10+ B cells from a control participant and a patient with pemphigus at 5 h and 48 h. (b) The mean SEM frequency of CD19+ B cells in PBMCs between the pemphigus group and healthy controls after culture for 5 h and 48 h. (c) Box plots of the percentages of IL-10-producing B cells in patients with pemphigus and healthy controls at different time points. CD19+IL-10+ B cells were significantly increased upon stimulation after culture for 48 h in both the patient group and in the healthy controls. **P < 001. (d) The fold increase of CD19+IL-10+ B cells in patients with pemphigus was significantly lower than in the control group after a lengthy culture. **P < 001. SSC, side scatter.
total PBMCs from healthy donors. However, this trend was not observed in the patient group (Fig. 5b). In addition, PBMC-derived CD19+CD24hiCD38hi cells had no role in modulating the expression of IL-4 by autologous CD4+ T cells either in patients or healthy controls (data not shown). We next asked whether there was any difference on antigen (Ag)specific T cells. It is important to detect Ag-specific effects on T cells; however, using the currently available methods, we found that the Dsg Ag had little, if any, effect on T-cell response. It might be related to the paucity of Ag-specific T cells, which are below the level of detection. Taken together, British Journal of Dermatology (2015) 172, pp101–110
these data suggest that Bregs in patients with pemphigus are unable to inhibit the production of IFN-c by CD4+ T cells. It might be a cell-intrinsic functional impairment of Bregs in the regulation of T cells, or a T cell-intrinsic defect specific to pemphigus-derived CD19+CD24hiCD38hi Bregs.
Discussion In this study, we demonstrated that circulating CD19+ CD24hiCD38hi Bregs in patients with pemphigus (both newly diagnosed and treated patients) were significantly higher than © 2014 British Association of Dermatologists
Regulatory B cells in pemphigus, H.-Q. Zhu et al. 107
IgM (ng mL–1)
IgG (ng mL–1)
200
100
0
PBMCs PBMCs without Bregs
(b) 80
(a) 300
Patients
60 40 20 0
Healthy controls
Patients
Healthy controls
Fig 4. Influence of CD19+CD24hiCD38hi regulatory B cells (Bregs) on IgG/IgM production. CD19+CD24hiCD38hi Bregs were depleted by flow cytometry sorting from peripheral blood mononuclear cells (PBMCs) of healthy donors (n = 5) and patients newly diagnosed with pemphigus but who had not received any treatment (n = 5). Whole PBMCs and PBMCs depleted of CD19+CD24hiCD38hi Bregs were then cultured with ODN 2006 (10 lg mL1; InvivoGen, San Diego, CA, U.S.A.), lipopolysaccharide (10 lg mL1; Sigma-Aldrich, St. Louis, MO, U.S.A.) and CD40L (1 lg mL1; R&D Systems, Minneapolis, MN, U.S.A.) for 7 days, and then IgM and IgG levels were determined in supernatants by enzyme-linked immunosorbent assay. (a, b) Box plots of the immunoglobulin level in PBMC supernatants or Breg-depleted PBMCs from patients and controls. There was no significant difference in the mean SEM level of IgG and IgM in supernatants of CD19+CD24hiCD38hi Breg-depleted PBMCs compared with whole PBMCs from healthy donors or patients with pemphigus.
CD4+T+Breg CD4+ IFN-γ + T cell (%)
CD4+T alone
Healthy control
(a)
20 15
Patient
IFN-γ CD4 Total PBMCs
5
Patients
40
Healthy controls
*
30 20 10 0
Patients
Healthy controls
PBMCs without Bregs
Healthy control
(b)
Inhibition rate of IFN-γ (%)
8·0%
*
10
0
8·6%
CD4+T alone CD4+T+Breg
Patient
CD4+ IFN-γ + T cell (%)
40
Total PBMCs PBMCs without Bregs
30
20
10
IFN-γ
0 Patients
CD4
in healthy individuals. Moreover, the percentage of CD19+CD24hiCD38hi Bregs in patients in the active stage of pemphigus was also significantly higher than patients in the © 2014 British Association of Dermatologists
Healthy controls
Fig 5. Cytokine production of CD4 + T cells in vitro with or without regulatory B cells (Bregs). Purified CD19+CD24hiCD38hi Bregs sorted from healthy donors (n = 6) or patients newly diagnosed with pemphigus before they received any treatment (n = 9) were cultured with autologously sorted CD4+ T cells (1: 2) with plate-bound CD3 monoclonal antibody (mAb)/CD28mAb (05 mg mL1) for 72 h, and with phorbol myristate acetate (Sigma-Aldrich) and Ionomycin (Sigma-Aldrich) for the last 5 h of culture. The remaining Breg-depleted peripheral blood mononuclear cells (PBMCs) and whole, nondepleted PBMCs were cultured separately in the same assay. The production of cytokines in CD4+ T cells was then tested by flow cytometry. (a) Representative phenotype for one patient or control showing the frequency of interferon (IFN)-c produced by CD4+ T cells. Box plots represent the mean SEM percentages of CD4+IFN-c+ T cells in different groups. Culture with autologous Bregs from healthy controls led to a significant decrease in the mean SEM percentages of CD4+IFN-c+ T cells compared with cultured alone. The inhibition rate of IFN-c+ in patients with pemphigus was much lower than that of the control group. *P < 005. (b) The results are shown as no difference in mean SEM percentage of CD4+IFN-c+ T cells between the remaining CD19+CD24hiCD38hi Breg-depleted PBMCs and whole PBMCs from patients with pemphigus or healthy controls.
remittent stage of the disease. The capability of B cells to produce IL-10 in patients with pemphigus was significantly impaired compared with that of healthy controls. The Bregs in British Journal of Dermatology (2015) 172, pp101–110
108 Regulatory B cells in pemphigus, H.-Q. Zhu et al.
patients with pemphigus showed impaired function in downregulating IFN-c production by CD4+ T cells, although they did not directly regulate IgG/IgM production during in vitro assays. In contrast to murine Bregs, the surface markers of human Bregs remain controversial. Different B-cell subsets in circulation have been ascribed with a suppressive regulatory function that is dependent on IL-10, including CD19+CD24hiCD38hi Bregs, CD19+CD24hiCD27+ Bregs and CD25hiCD27hiCD86hi CD1dhi Bregs.19,23,24 Here, we confirmed a CD19+CD24hi CD38hi Breg phenotype and found that this B-cell subset is responsible for most of the IL-10 production by human B cells. Intracellular detection of IL-10 and mRNA expression of this cytokine suggest that CD19+CD24hiCD38hi Bregs are a major source of IL-10 production in the B-cell population. The important role of Bregs in patients with pemphigus is suggested by the finding that the frequency of Bregs was altered in these patients. Although no significant difference was found between the newly diagnosed group and the patients who had received treatment, the proportion of CD19+CD24hiCD38hi Bregs in patients with active pemphigus was significantly higher than in remittent individuals, which suggests that Bregs may regulate disease expression. So far, Bregs have not been well studied in pemphigus, except for in a recent study by Colliou et al.,25 which found that patients in complete remission after treatment with rituximab had significantly higher numbers of IL-10-secreting CD24hiCD38hi Bregs than patients with active lesions at baseline or those in incomplete remission. These seemingly contradictory results are perhaps owing to the fact that rituximab is a B cell-depleting Ab with the ability to reshape the B-cell repertoire during reconstitution. Our data reflected the intrinsic Breg frequency in patients with pemphigus, and are consistent with previous findings in other autoimmune diseases. Iwata et al. found that peripheral regulatory B10 cells frequencies were significantly higher in patients with autoimmune disease such as rheumatoid arthritis and SLE when compared with healthy controls.26 Previous studies have also shown a potential imbalance of Tregs in pemphigus.8,27,28 A significant reduction in the number of Tregs may be involved in the breaking of self-tolerance against Dsg in pemphigus. In contrast to decreased Tregs in patients with pemphigus, the number of Bregs in the peripheral blood of patients with pemphigus was significantly increased compared with healthy controls. As the capacity of human Bregs to produce IL-10 is central to their ability to regulate negatively inflammatory and autoimmune diseases, the increased number of Bregs perhaps suggests that these Bregs may be functionally defective in patients with pemphigus. It is also possible that the increase in the number of Bregs in active pemphigus might reflect the overstimulation of Bregs in a negative feedback loop, while after treatment with immunosuppressants and the improvement of symptoms, the number of Bregs declines, with a possible restoration of function. Therefore, immunosuppressants might, to a certain extent, influence the function of Bregs and needs to be further investigated. British Journal of Dermatology (2015) 172, pp101–110
We found that these IL-10-producing B cells in patients with pemphigus appear to be functionally mature because they can be identified based on cytoplasmic IL-10 expression after in vitro stimulation. The percentage of IL-10-producing B cells was significantly increased upon stimulation both in the patient and healthy groups. Strikingly, the increasing rate of IL-10-producing B cells in patients with pemphigus was significantly lower than in the control group, which suggests that B10 cells from patients with pemphigus likely have an intrinsic defect affecting IL-10 expression after long-term stimulation. B10 progenitor (B10pro) cells have also been functionally identified within the splenic B10 cell subpopulation in mice and in humans.26,29,30 We propose that CD19+CD24hiCD38hi Bregs consist of functionally immature transitional B cells, B10pro and B10 cells. The B10pro cell subpopulations may acquire the ability to function like B10 cells during a short in vitro stimulation. A profound impairment of IL-10 production by B cells from patients with pemphigus after culture stimulation for 48 h suggests that, unlike healthy controls, B10 cells from patients with pemphigus may be unable to express IL-10 production for long periods of time, which is essential for an effective T-cell suppression. Alternatively, the reservoir of B10pro cells may be significantly lower in patients with pemphigus compared with healthy donors. We further investigated the regulatory function of CD19+ CD24hiCD38hi Bregs. Interestingly, there was no direct impact on IgG/IgM-expressing B cells in patients with pemphigus or healthy controls. We next asked whether there was any difference in the production of Ag-reactive IgG. Unfortunately, we did not detect Dsg3-specific IgG Ab in the supernatant from in vitro culture. This might be owing to there being too few cells in the in vitro culture system, which leads to an Ab response that lies below the level of detection when overdiluted. In a future study, we will optimize the in vitro culture system or concentrate the supernatant to determine the possible impact on specific Dsg3 Ab production. However, suppressive activity of IL-10 from Bregs on CD4+ T cells might be mediated by direct contact.31 Indeed, we found that this B-cell subset, when isolated from patients, failed to suppress the production of IFN-c by autologous CD4+ T cells from patients with pemphigus. However, CD19+CD24hiCD38hi Bregs from healthy donors were capable of efficiently suppressing the IFN-c production of CD4+ T cells. In addition, our data suggest that depletion of CD19+CD24hiCD38hi Bregs from PBMCs of patients with pemphigus are unable to promote an increase in CD4+ T cell inflammatory cytokine production as it did in healthy controls. Alternatively, the low production of IFN-c in patients with pemphigus might be related to the inherent T helper (Th)1/ Th2 imbalance, which exhibits a relative downregulation of IFN-c because pemphigus is a Th2-dominant autoimmune skin disease. The lack of suppressive activity on cytokine-producing CD4+ T cells has also been found in patients with SLE.19 Pemphigus is suggested to be an autoimmune disorder associated with a Th2 response, and the downregulatory activity of Bregs © 2014 British Association of Dermatologists
Regulatory B cells in pemphigus, H.-Q. Zhu et al. 109
on CD4+IFN-c+ T cells in patients may reflect a type of worsening mechanism for Th2 polarization in pemphigus in a feedback pathway. Yoshizaki et al. showed that B10-cell maturation into functional IL-10-secreting regulatory cells required IL-21 and CD40-dependent cognate interactions with T cells.32 Taken together, Bregs in patients with pemphigus may be functionally unable to suppress effecter cell population. Nevertheless, the mechanisms, such as whether the B10 cells derived from patients with pemphigus exhibit a cell-intrinsic defect in response to T–B-cell interactions or IL-21 and expression of other related cytokines, should be further explored. In summary, we demonstrate that although the frequency of CD19+CD24hiCD38hi Bregs is significantly increased in patients with pemphigus compared with healthy controls, both in the active group and the remittent group. Unlike healthy B cells, these IL-10-producing B cells from patients with pemphigus displayed impaired IL-10 production when they were activated for a longer period of time. Bregs from patients with pemphigus did not directly regulate the humoral response, but lost their ability to significantly downregulate IFN-c production by CD4+ T cells. Our study further reveals the regulatory complexities of the immune system in patients with pemphigus and suggests that Breg-directed therapies may be able to reshape the disease course of autoimmune disorders such as pemphigus.
Acknowledgments We thank Zhicui Liu, Shanghai Institute of Immunology, School of Medicine, Shanghai Jiao Tong University, for her technical assistance. We thank Michael Jeffrey Cho and Xuming Mao for their editing of the manuscript.
References 1 Amagai M. Pemphigus: autoimmunity to epidermal cell adhesion molecules. Adv Dermatol 1996; 11:319–52. 2 Hertl M, Veldman C. Pemphigus – paradigm of autoantibody-mediated autoimmunity. Skin Pharmacol Appl Skin Physiol 2001; 14:408–18. 3 Stanley JR. Autoantibodies against adhesion molecules and structures in blistering skin diseases. J Exp Med 1995; 181:1–4. 4 Anhalt GJ, Labib RS, Voorhees JJ et al. Induction of pemphigus in neonatal mice by passive transfer of IgG from patients with the disease. N Engl J Med 1982; 306:1189–96. 5 Hertl M. Humoral and cellular autoimmunity in autoimmune bullous skin disorders. Int Arch Allergy Immunol 2000; 122:91–100. 6 Zhu H, Chen Y, Zhou Y et al. Cognate Th2-B cell interaction is essential for the autoantibody production in pemphigus vulgaris. J Clin Immunol 2012; 32:114–23. 7 Yokoyama T, Amagai M. Immune dysregulation of pemphigus in humans and mice. J Dermatol 2010; 37:205–13. 8 Xu R, Zhu H, Li W et al. The imbalance of Th17 and regulatory T cells in pemphigus patients. Eur J Dermatol 2013; 23:795–802. 9 Fujimoto M. Regulatory B cells in skin and connective tissue diseases. J Dermatol Sci 2010; 60:1–7. 10 Mauri C, Bosma A. Immune regulatory function of B cells. Annu Rev Immunol 2012; 30:221–41. 11 Mizoguchi A, Bhan AK. A case for regulatory B cells. J Immunol 2006; 176:705–10.
© 2014 British Association of Dermatologists
12 Fillatreau S, Sweenie CH, McGeachy MJ et al. B cells regulate autoimmunity by provision of IL-10. Nat Immunol 2002; 3:944–50. 13 Noh J, Lee JH, Noh G et al. Characterisation of allergen-specific responses of IL-10-producing regulatory B cells (Br 1) in cow milk allergy. Cell Immunol 2010; 264:143–9. 14 Lee JH, Noh J, Noh G et al. Allergen-specific transforming growth factor-beta-producing CD19+CD5+ regulatory B-cell (Br 3) responses in human late eczematous allergic reactions to cow’s milk. J Interferon Cytokine Res 2011; 31:441–9. 15 Noh J, Choi WS, Noh G et al. Presence of Foxp3-expressing CD19 (+)CD5(+) B cells in human peripheral blood mononuclear cells: human CD19(+)CD5(+)Foxp3(+) regulatory b cell (Breg). Immune Netw 2010; 10:247–9. 16 Matsushita T, Yanaba K, Bouaziz JD et al. Regulatory B cells inhibit EAE initiation in mice while other B cells promote disease progression. J Clin Invest 2008; 118:3420–30. 17 Mauri C, Gray D, Mushtaq N et al. Prevention of arthritis by interleukin 10-producing B cells. J Exp Med 2003; 197:489–501. 18 Watanabe R, Ishiura N, Nakashima H et al. Regulatory B cells (B10 cells) have a suppressive role in murine lupus: CD19 and B10 cell deficiency exacerbates systemic autoimmunity. J Immunol 2010; 184:4801–9. 19 Blair PA, Nore~ na LY, Flores-Borja F et al. CD19(+)CD24(hi)CD38 (hi) B cells exhibit regulatory capacity in healthy individuals but are functionally impaired in systemic lupus erythematosus patients. Immunity 2010; 32:129–40. 20 Knippenberg S, Peelen E, Smolders J et al. Reduction in IL-10 producing B cells (Breg) in multiple sclerosis is accompanied by a reduced naive/memory Breg ratio during a relapse but not in remission. J Neuroimmunol 2011; 239:80–6. 21 Kneisel A, Hertl M. Autoimmune bullous skin diseases. Part 2: diagnosis and therapy. J Dtsch Dermatol Ges 2011; 9:927–47. 22 Veldman C, Stauber A, Wassmuth R. Dichotomy of autoreactive Th1 and Th2 cell responses to desmoglein 3 in patients with pemphigus vulgaris (PV) and healthy carriers of PV-associated HLA class II alleles. J Immunol 2003; 170:635–42. 23 Zha B, Wang L, Liu X et al. Decrease in proportion of CD19+ CD24(hi) CD27+ B cells and impairment of their suppressive function in Graves’ disease. PLoS ONE 2012; 7:e49835. 24 Kessel A, Haj T, Peri R et al. Human CD19(+)CD25(high) B regulatory cells suppress proliferation of CD4(+) T cells and enhance Foxp3 and CTLA-4 expression in T-regulatory cells. Autoimmun Rev 2012; 11:670–7. 25 Colliou N, Picard D, Caillot F et al. Long-term remissions of severe pemphigus after rituximab therapy are associated with prolonged failure of desmoglein B cell response. Sci Transl Med 2013; 5:175ra130. 26 Iwata Y, Matsushita T, Horikawa M et al. Characterization of a rare IL-10-competent B-cell subset in humans that parallels mouse regulatory B10 cells. Blood 2011; 117:530–41. 27 Sugiyama H, Matsue H, Nagasaka A et al. CD4+CD25high regulatory T cells are markedly decreased in blood of patients with pemphigus vulgaris. Dermatology 2007; 214:210–20. 28 Veldman C, H€ ohne A, Dieckmann D. Type I regulatory T cells specific for desmoglein 3 are more frequently detected in healthy individuals than in patients with pemphigus vulgaris. J Immunol 2004; 172:6468–75. 29 DiLillo DJ, Matsushita T, Tedder TF. B10 cells and regulatory B cells balance immune responses during inflammation, autoimmunity, and cancer. Ann N Y Acad Sci 2010; 1183:38–57. 30 Yanaba K, Bouaziz JD, Matsushita T. The development and function of regulatory B cells expressing IL-10 (B10 cells) requires antigen receptor diversity and TLR signals. J Immunol 2009; 182:7459–72.
British Journal of Dermatology (2015) 172, pp101–110
110 Regulatory B cells in pemphigus, H.-Q. Zhu et al. 31 Bouaziz JD, Calbo S, Maho-Vaillant M. IL-10 produced by activated human B cells regulates CD4(+) T-cell activation in vitro. Eur J Immunol 2010; 40:2686–91. 32 Yoshizaki A, Miyagaki T, DiLillo DJ et al. Regulatory B cells control T-cell autoimmunity through IL-21-dependent cognate interactions. Nature 2012; 491:264–8.
British Journal of Dermatology (2015) 172, pp101–110
Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s website: Table S1. Summary data of included patients with pemphigus (n = 34).
© 2014 British Association of Dermatologists
British Journal of Dermatology
C L I N I C A L A N D LA B O R A T O R Y I N V E S T I G A T I O N S
Impaired function of CD19+CD24hiCD38hi regulatory B cells in patients with pemphigus H.-Q. Zhu,1,2 R.-C. Xu,1 Y.-Y. Chen,1 H.-J. Yuan,1 H. Cao,1 X.-Q. Zhao,1 J. Zheng,1 Y. Wang3 and M. Pan1 1
Department of Dermatology, Rui Jin Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai, China Department of Dermatology, Rui Jin Hospital North, School of Medicine, Shanghai Jiao Tong University, Shanghai, China 3 Shanghai Institute of Immunology, Shanghai Jiao Tong University, Shanghai, China 2
Summary Correspondence Meng Pan. E-mail: [email protected]
Accepted for publication 9 June 2014
Funding sources This work was supported by grants from the National Natural Science Foundation of China (81171499, 81201230) and the Shanghai Science and Technology Commission (10JC1410600).
Conflicts of interest None declared. H.-Q.Z. and R.-C.X. contributed equally to this work. DOI 10.1111/bjd.13192
Background Pemphigus is an organ-specific autoimmune bullous disease. Objectives To determine the role of regulatory B cells (Bregs) in patients with pemphigus. Methods The frequency of the occurrence of CD19+CD24hiCD38hi Bregs was detected from 34 patients with pemphigus and 20 healthy controls. Interleukin (IL)-10 secretion was processed after stimulating B cells. Specific antidesmoglein antibody (Ab) titres and their subclasses were also measured. Ab response and cytokine production from peripheral blood mononuclear cells (PBMCs) with or without Bregs were analysed. Results The number of Bregs was significantly increased in patients with pemphigus compared with healthy controls (15 7% vs. 9 3%; P < 001) and the proportion of Bregs in the active groups (newly diagnosed and chronic active patients) was significantly higher than in remittent individuals (16 7% vs. 13 8%; P = 004). The IL-10-producing B cells were significantly increased upon stimulation both in patients and in healthy controls. However, the increase ratio of IL-10-producing B cells between short- and long-term stimulation was significantly lower in patients with pemphigus (10-fold vs. 26-fold increase in control group; P < 001). Strikingly, Bregs from the controls were able to suppress interferon (IFN)-c expression and T helper cell 1 (Th1) immune response (26% inhibition rate), while the suppressive function of Bregs from patients with pemphigus was significantly decreased (9% inhibition rate). There was no difference in Ab levels from PBMCs with or without Bregs after stimulation. Conclusions Bregs in patients with pemphigus are elevated but with defective regulatory function on Th1 cells.
What’s already known about this topic?
• •
Pemphigus is an organ-specific autoimmune bullous disease in which the pathogenic mechanism is complicated and not fully understood. Various regulatory cells and cytokines have been associated with pemphigus; however, regulatory B cells (Bregs) have not been well studied in the disease.
What does this study add?
• •
© 2014 British Association of Dermatologists
To the best of our knowledge, this is the first study to analyse the regulatory function of CD19+CD24hiCD38hi Bregs in pemphigus. CD19+CD24hiCD38hi Bregs in patients with pemphigus are elevated but with defective regulatory function on T helper 1 cells.
British Journal of Dermatology (2015) 172, pp101–110
101
102 Regulatory B cells in pemphigus, H.-Q. Zhu et al.
Pemphigus is a classical model of an organ-specific autoimmune disease, characterized by intraepidermal blistering of mucous membranes and skin.1–3 Passive transfer of the serum desmoglein (Dsg)–IgG fraction from patients with pemphigus to neonatal mice induces pemphigus-like lesions, suggesting an essential pathogenic role of anti-Dsg autoantibodies (autoAbs) in the development of the disease.4 Dsg-reactive T cells are believed to play an important role in the pathogenesis of pemphigus.5 Recently, we observed that CD4+ T cells from Dsg3-immunized mice provided a direct stimulation to unprimed B cells, suggesting that Dsg3-reactive T cells are responsible for pathogenic IgG production in patients with pemphigus.6 In addition to the effector T–B cell interaction, the potential imbalance of CD4+ regulatory T cells (Tregs) has also been implicated in pemphigus.7,8 Our previous study demonstrated that CD4+CD25hiFoxp3+ Tregs were significantly lower in patients with pemphigus.8 The marked reduction of Tregs may be involved in the loss of tolerance against Dsg in pemphigus. Activated B cells are generally considered to be pathogenic regulators in patients with pemphigus via secretion of antiDsg3 autoAbs. However, recent studies have described a new subset of B cells that is capable of downregulating immune responses in mice and humans: regulatory B cells (Bregs),9,10 a term coined by Mizoguchi and Bhan used to designate B cells with inhibitory properties.11 One of the mechanisms by which Bregs regulate immunological inflammation is through the production of interleukin-10 (IL-10).12 These IL-10-producing B cells are now termed ‘B10 cells’ or ‘Br1’.13 Recently, other Breg subsets, such as transforming growth factor (TGF)b-producing Br3 or Foxp3-expressing Bregs, have been also identified.14,15 There have been significant advances in understanding the role of Bregs in mouse models of autoimmune diseases such as rheumatoid arthritis, systemic lupus erythematous (SLE) and experimental autoimmune encephalomyelitis.16–18 In addition, evidence is emerging that Bregs also play a critical role in human autoimmune diseases such as SLE and multiple sclerosis.19,20 However, the role of Bregs in the pathogenesis of pemphigus has not been elucidated. In this study, we examined the frequency and the function of Bregs in the peripheral blood of patients with pemphigus. The results suggest that Bregs in patients with pemphigus are elevated in peripheral blood and exhibit defective regulatory activities on T cells.
Materials and methods Patients Thirty-four patients with pemphigus and 20 healthy controls were enrolled in this study (Table S1). The diagnosis of pemphigus was confirmed by clinical presentation, histology and at least one positive serological test [immunofluorescence or Dsg enzyme-linked immunosorbent assay (ELISA)].21 Among them, nine patients were newly diagnosed and had not received treatment. The remaining patients, of whom eight British Journal of Dermatology (2015) 172, pp101–110
were in the chronic active stage (the expansion/persistence of existing blisters or erosions on mucosal surfaces and/or skin) and 17 were in the remittent stage (those who had not experienced new blisters/erosions for ≥ 6 months before the start of the study), had been treated with immunosuppressive therapy. The untreated (newly diagnosed) and the chronic active patients were termed the ‘active stage’ group.22 All patients with pemphigus and healthy controls gave written consent to participate in this study, which was approved by the local ethics committee. Desmoglein-specific antibody titres and their subclasses Abs against Dsg1/Dsg3 were measured by ELISA (Medical and Biological Laboratories Co., Nagoya, Japan), according to the manufacturer’s instructions. IgG1 and IgG4 subclass levels were measured as previously described.6 Flow cytometric determination of the regulatory B cell phenotype Peripheral blood mononuclear cells (PBMCs) were collected and cultured with ODN 2006 (10 lg mL1; InvivoGen, San Diego, CA, U.S.A.), lipopolysaccharide (LPS) (10 lg mL1; Sigma-Aldrich, St. Louis, MO, U.S.A.), CD40L (1 lg mL1; R&D Systems, Minneapolis, MN, U.S.A.), phorbol myristate acetate (PMA) (50 ng mL1; Sigma-Aldrich) and Ionomycin (1 lg mL1; Sigma-Aldrich) for the analysis of CD19+CD24hiCD38hi Bregs phenotype by flow cytometry (BD Biosciences, San Diego, CA, U.S.A.). Cells were stained with the following antihuman monoclonal Abs: fluorescein isothiocyanate-conjugated CD19, phycoerythrin (PE)–Cy55-conjugated CD24 and allophycocyanin-conjugated CD38 for surface staining. Cells were then fixed and permeabilized, and stained with PE-conjugated IL-10 or PE-conjugated mouse IgG1 isotype control adapted from the Cytofix/CytopermTM Plus Fixation/Permeabilization Kit (Becton Dickinson, Franklin Lakes, NJ, U.S.A.). Quantitative real-time polymerase chain reaction analysis In six healthy participants, fresh cell suspensions of CD19+CD24hiCD38hi Bregs and CD19+CD24intCD38int B cells were sorted individually from PBMCs and stored at 80 °C until use. Quantitative real-time polymerase chain reaction (qPCR) detection of IL-10, IL-6 and TGF-b was performed in these two cell populations. Total RNA was isolated using an RNeasyâ Kit (Qiagen, Hilden, Germany). Reverse transcription to complementary DNA was carried out by standard methods using reverse transcriptase (Roche Diagnostics, Meylan, France) and deoxyribonucleotide triphosphate (Roche Diagnostics). PCRs were conducted in a LightCycler instrument (Roche Diagnostics). The sequences of primers were as follows (listed 50 –30 ): glyceraldehyde 3-phosphate dehydrogenase [forward (F): GAAGGTGAAGGTCGGAGTC; reverse (R): © 2014 British Association of Dermatologists
Regulatory B cells in pemphigus, H.-Q. Zhu et al. 103
GAAGATGGTGATGGGATTTC]; human IL-6 (F: CAGGAGCC CAGCTATGAACT; R: GGAATCTTCTCCTGGGGGTA); human IL-10 (F: CTGAGAACCAAGACCCAGACATC; R: AAGGCATTCT TCACCTGCTCCAC); human TGF-b (F: CGTCTGCTGAGGCTCAAGTT; R: CAACTCCGGTGACATCAAAA) (Sangon Biotech, Shanghai, China). In vitro stimulation and flow cytometric analysis of interleukin-10-producing B cells PBMCs from patients with pemphigus and healthy controls were cultured with ODN 2006 (10 lg mL1; InvivoGen), LPS (10 lg mL1; Sigma-Aldrich) and CD40L (1 lg mL1; R&D Systems) for 5 or 48 h [PMA 50 ng mL1 (Sigma-Aldrich), Ionomycin 1 lg mL1 (Sigma-Aldrich) and Golgi StopTM (02 lL; BD Biosciences) for the last 5 h of culture] for analysis of the intracellular staining of IL-10 in order to evaluate the percentage of IL-10-producing B cells by flow cytometry.
(n = 6) were stimulated with plate-bound CD3 mAb/CD28 mAb (05 mg mL1) for 72 h, with PMA (Sigma-Aldrich) and Ionomycin (Sigma-Aldrich) for the last 5 h of culture. Meanwhile, the co-culture of sorted CD4+ T cells with autologous CD19+CD24hiCD38hi Bregs (2: 1) or CD4+ T cells alone from patients or healthy controls with the stimulus was also performed. The production of cytokines in CD4+ T cells was tested by flow cytometry. Statistical analysis Aggregate data are presented as mean SEM. For nonparametric data, the Mann–Whitney U-test was used to analyse for individual groups. All analyses were performed using GraphPad Prism (GraphPad Software Inc., La Jolla, CA, U.S.A.). A P-value < 005 was considered significant for all analyses.
Results Total IgG/IgM levels after in vitro culture
Cytokine detection from CD4+ T cells after in vitro culture Cultures of Breg-depleted PBMCs or total PBMCs from patients newly diagnosed with pemphigus (n = 9) or healthy controls
U mL–1
(a)
300
*
200
*
100
Characterization of antidesmoglein 1/3 IgG antibody levels and their subclass distribution in patients with pemphigus To evaluate the specific anti-Dsg Ab levels and their subclasses, IgG Abs from the patients’ sera was tested. The specific Ab level in patients in the active stage (newly diagnosed and chronic active) was significantly higher than in patients in the remittent stage [Dsg1: 1090 597 U mL1 vs. 663 549 U mL1 (P = 004); Dsg3: 906 753 U mL1 vs. 198 263 U mL1 (P = 004)] (Fig. 1a). Furthermore, for anti-Dsg1 IgG-positive samples, the mean ratio of IgG4: IgG1 was 54-fold (P < 0001) higher in patients in the active stage than those in the remittent stage. This marked trend was also observed with anti-Dsg3 IgG Ab (Fig. 1b). These data show that the titres of autoAbs against Dsg correlate with disease activity. In addition, there seems to be a strong association between the increase of IgG4 anti-Dsg levels and the development of clinical activity.
(b)
6
IgG4/IgG1
PBMCs were collected from patients newly diagnosed with pemphigus (n = 5). CD19+CD24hiCD38hi Bregs were sorted from total PBMCs. For in vitro culture, PBMCs with or without Bregs (106 cells mL1) placed in 48-well U-bottom plates (250 lL per well; BD Biosciences) were stimulated with ODN 2006 (10 lg mL1; InvivoGen), LPS (10 lg mL1; SigmaAldrich) and CD40L (1 lg mL1; R&D Systems) for 7 days; the supernatant was then collected for Ab analysis. Total IgG/IgM levels in the supernatant were determined by ELISA (Southern Biotechnology Associates Inc., Birmingham, AL, U.S.A.) according to the manufacturer’s instructions, and IgG/IgM concentrations were calculated from the standard curves.
4
Remittent Active Remittent Active anti-Dsg1 anti-Dsg3
**
2
0
0
***
Remittent Active anti-Dsg1
Remittent Active anti-Dsg3
Fig 1. Characterization of IgG antidesmoglein (Dsg)1 and anti-Dsg3 antibodies (Abs) by enzyme-linked immunosorbent assay (ELISA) and their subclass distributions in patients with pemphigus. The pemphigus-specific Abs and their subclasses were evaluated in patients’ sera using a specific Dsg ELISA assay. (a) Scatter plots of IgG anti-Dsg1 and anti-Dsg3 in patients with active pemphigus (n = 17; newly diagnosed and chronic active) and the remittent group (n = 17). *P < 005. (b) Box plots represent the mean SEM of Dsg-specific IgG4/IgG1 in patients with pemphigus distributed according to disease activity. **P < 001, ***P < 0001. Statistical analyses performed using the Mann–Whitney U-test. © 2014 British Association of Dermatologists
British Journal of Dermatology (2015) 172, pp101–110
104 Regulatory B cells in pemphigus, H.-Q. Zhu et al.
CD19+CD24hiCD38hi regulatory B cells are increased in frequency in patients with pemphigus In this study, to confirm the phenotype of Bregs, a multicolour staining panel was used to identify Bregs among PBMCs via surface markers and intracellular IL-10 staining (Fig. 2a). As shown in Fig. 2(b), a significantly higher percentage of CD19+ CD24hiCD38hi Bregs produced IL-10 than CD19+CD24int CD38int B cells (16 4% vs. 5 1%; P < 001). To further validate the intracellular IL-10 flow cytometric analysis, CD19+CD24hiCD38hi Bregs and CD19+CD24intCD38int B cells were sorted from PBMCs and the mRNA levels of IL-10, IL-6 and TGF-b were determined. The results demonstrated that the mRNA expression level of IL-10 was significantly higher in the CD19+CD24hiCD38hi Bregs compared than in CD19+CD24intCD38int B cells (Fig. 2c). In contrast, mRNA expression levels of IL-6 and TGF-b were almost similar between these two populations. Taken together, these data indicate that CD19+CD24hiCD38hi Bregs comprise a major IL10-producing B cell population and may exhibit regulatory activity via the production of IL-10. Next, we examined the frequency of CD19+CD24hiCD38hi Bregs in patients with pemphigus. Surprisingly, there was higher percentage of circulating CD19+CD24hiCD38hi Bregs in PBMCs of patients with pemphigus compared with healthy individuals (15 7% vs. 9 3%; P < 001). Furthermore, CD19+CD24hiCD38hi Breg frequencies in both newly diagnosed (untreated) patients (17 8%) and the treated group (14 7%) were much higher than in the healthy controls (P < 001 and P < 001, respectively), although there were no statistical differences between these two groups (P = 012) (Fig. 2d). Breg frequency in the active group (newly diagnosed and chronic active patients) (16 7%) was significantly higher than in the remittent group (13 8%; P = 004). Both groups were higher than control individuals (P < 001 and P = 001, respectively) (Fig. 2e). These data indicate an elevated Breg frequency in patients with pemphigus compared with healthy controls, which relates to disease activity. The ability of CD19+ B cells to produce interleukin-10 is altered in patients with pemphigus To test whether the ability to produce IL-10 by these B cells is intact, PBMCs from patients or healthy individuals were cultured with B-cell stimuli, including ODN 2006 (InvivoGen), LPS (Sigma-Aldrich) and CD40L (R&D Systems). Intracellular staining of IL-10 was determined after stimulation (Fig. 3a). There was no significant difference in the percentage of B cells in PBMCs between the pemphigus group and healthy controls (Fig. 3b). The total frequency of IL-10-producing B cells in CD19+ B cells was significantly increased upon stimulation, both in the patient group [from 2 2% (5 h) to 4 1% (48 h); P < 001] and in healthy controls [from 2 1% (5 h) to 5 3% (48 h); P < 001] (Fig. 3c). Strikingly, there was a 26-fold increase in healthy groups compared with a British Journal of Dermatology (2015) 172, pp101–110
10-fold increase in patients after 48 h of stimulation. The fold increase of IL-10-producing B cells in patients with pemphigus was significantly lower than that of the control group (P < 001) (Fig. 3d). These data suggest that Bregs from patients with pemphigus have a lower capacity of producing IL-10 after long-term stimulation, indicating an impaired function despite these cells showing almost intact function during short-term stimulation. This may be related to the pathogenesis of pemphigus as it is a chronic blistering skin disease where constant stimulation may exist. Total immunoglobulin levels of B cells cultured with or without CD19+CD24hiCD38hi regulatory B cells are not altered To further identify the regulatory function of CD19+CD24hi CD38hi Bregs on Ab-producing B cells, we sorted the Breg population from patients with pemphigus. However, Bregs constitute a small population in PBMCs and, owing to the difficulty of obtaining sufficient numbers of CD19+CD24hiCD38hi Bregs from patients, we evaluated whether depletion of CD19+CD24hi CD38hi Bregs from PBMCs affected IgG/IgM production. After culturing with B-cell stimulus for 72 h, there was no significant difference in total IgG or IgM production from the supernatants of Breg-depleted PBMCs compared with total PBMCs from patients with pemphigus or healthy controls (Fig. 4a,b). These data suggest that there is no difference in IgG/IgM Ab production by PBMCs with or without Bregs, both in the patient and control groups. CD4+ T cell cytokine production from peripheral blood mononuclear cells is unable to be regulated by CD19+CD24hiCD38hi regulatory B cells isolated from patients with pemphigus We next investigated the regulation of Bregs on CD4+ T cells to see whether CD19+CD24hiCD38hi Bregs from patients with pemphigus could suppress CD4+ T cell cytokine production. We performed the experiments on PBMCs and sorted CD4+ T cells. We observed that CD19+CD24hiCD38hi Bregs from controls were able to suppress interferon (IFN)-c expression of healthy CD4+ T cells, which is consistent with previous reports.19 Sorted CD4+ T cells co-cultured with autologous CD19+CD24hiCD38hi Bregs from healthy controls led to a significant decrease in the percentage of CD4+ IFN-c+ T cells (co-culture vs. cultured alone: 8 1% vs. 13 2%; P = 004) (Fig. 5a); the inhibition rate was 26%. Surprisingly, from the patient group, CD19+CD24hiCD38hi Bregs did not significantly suppress the production of IFN-c by autologous CD4+ T cells (co-culture vs. cultured alone: 9 1% vs. 10 1%; P = 060); the inhibition rate was 9% – much lower than that of the control group (Fig. 5a). Meanwhile, total PBMCs, with or without CD19+CD24hiCD38hi Bregs, were cultured in vitro to detect the frequency of CD4+IFN-c+ T cells. A trend towards an increased frequency of CD4+IFN-c+ T cells was observed in Breg-depleted PBMCs compared with © 2014 British Association of Dermatologists
Regulatory B cells in pemphigus, H.-Q. Zhu et al. 105
(a)
(c)
(b)
(d)
(e)
Fig 2. Statistical analysis of CD19+CD24hiCD38hi regulatory B cells (Bregs) in patients with pemphigus and healthy controls. Peripheral blood mononuclear cells (PBMCs) isolated from healthy controls (n = 6) were stimulated with ODN 2006 (10 lg mL1; InvivoGen, San Diego, CA, USA), lipopolysaccharide (10 lg mL1; Sigma-Aldrich, St. Louis, MO, U.S.A.), CD40L (1 lg mL1; R&D Systems, Minneapolis, MN, U.S.A.), phorbol myristate acetate (50 ng mL1; Sigma-Aldrich), Ionomycin (1 lg mL1; Sigma-Aldrich) and Golgi StopTM (02 lL; BD Biosciences, San Diego, CA, U.S.A.) for 5 h and then stained with antihuman monoclonal antibodies [CD19, CD24, CD38 and interleukin (IL)-10] for analysis of the phenotype of CD19+CD24hiCD38hi Bregs by flow cytometry. (a) Representative comparative phenotype of IL-10 produced by different B-cell subsets from a healthy control. (b) Box plots of mean SEM percentage of IL-10 expression by CD19+CD24hiCD38hi Bregs and CD19+CD24intCD38int B cells. Compared with CD19+CD24intCD38int B cells, a significantly higher percentage of CD19+CD24hiCD38hi Bregs were IL-10-producing B cells. **P < 001. (c) In these six healthy participants, some CD19+CD24hiCD38hi Bregs and CD19+CD24intCD38int B cells were sorted from fresh PBMCs and used for quantitative real-time polymerase chain reaction detection of relative mRNA levels of IL-10, IL-6 and transforming growth factor (TGF)-b. The relative mRNA levels of cytokines in CD19+CD24intCD38int B cells were set to 1. Only the relative mean SEM level of IL-10 mRNA was significantly higher in the CD19+CD24hiCD38hi Bregs. *P < 005. (d, e) The results are shown as mean SEM percentage of CD19+CD24hiCD38hi Breg cells in all patients with pemphigus [n = 34; nine newly diagnosed patients who had not received any treatment and 25 treated patients (eight chronic active patients and 17 remittent patients)] and healthy controls (n = 20) enrolled in this study. ***P < 0001, **P < 001, *P < 01. SSC-A, side scatter. © 2014 British Association of Dermatologists
British Journal of Dermatology (2015) 172, pp101–110
106 Regulatory B cells in pemphigus, H.-Q. Zhu et al.
(a)
(b)
(c)
(d)
Fig 3. The ability of CD19+ B cells to produce interleukin (IL)-10. Peripheral blood mononuclear cells (PBMCs) of healthy individuals (n = 15) or patients with pemphigus (n = 34) were stimulated in vitro for 5 or 48 h with ODN 2006 (10 lg mL1; InvivoGen, San Diego, CA, U.S.A.), lipopolysaccharide (10 lg mL1; Sigma-Aldrich, St. Louis, MO, U.S.A.) and CD40L (1 lg mL1; R&D Systems, Minneapolis, MN, U.S.A.), and with phorbol myristate acetate (50 ng mL1; Sigma-Aldrich), Ionomycin (1 lg mL1; Sigma-Aldrich) and Golgi StopTM (02 lL; BD Biosciences, San Diego, CA, U.S.A.) for the last 5 h of culture. CD19+IL-10+ B cells were measured by flow cytometry by intracellular cytokine staining. (a) Representative comparative phenotype of CD19+IL-10+ B cells from a control participant and a patient with pemphigus at 5 h and 48 h. (b) The mean SEM frequency of CD19+ B cells in PBMCs between the pemphigus group and healthy controls after culture for 5 h and 48 h. (c) Box plots of the percentages of IL-10-producing B cells in patients with pemphigus and healthy controls at different time points. CD19+IL-10+ B cells were significantly increased upon stimulation after culture for 48 h in both the patient group and in the healthy controls. **P < 001. (d) The fold increase of CD19+IL-10+ B cells in patients with pemphigus was significantly lower than in the control group after a lengthy culture. **P < 001. SSC, side scatter.
total PBMCs from healthy donors. However, this trend was not observed in the patient group (Fig. 5b). In addition, PBMC-derived CD19+CD24hiCD38hi cells had no role in modulating the expression of IL-4 by autologous CD4+ T cells either in patients or healthy controls (data not shown). We next asked whether there was any difference on antigen (Ag)specific T cells. It is important to detect Ag-specific effects on T cells; however, using the currently available methods, we found that the Dsg Ag had little, if any, effect on T-cell response. It might be related to the paucity of Ag-specific T cells, which are below the level of detection. Taken together, British Journal of Dermatology (2015) 172, pp101–110
these data suggest that Bregs in patients with pemphigus are unable to inhibit the production of IFN-c by CD4+ T cells. It might be a cell-intrinsic functional impairment of Bregs in the regulation of T cells, or a T cell-intrinsic defect specific to pemphigus-derived CD19+CD24hiCD38hi Bregs.
Discussion In this study, we demonstrated that circulating CD19+ CD24hiCD38hi Bregs in patients with pemphigus (both newly diagnosed and treated patients) were significantly higher than © 2014 British Association of Dermatologists
Regulatory B cells in pemphigus, H.-Q. Zhu et al. 107
IgM (ng mL–1)
IgG (ng mL–1)
200
100
0
PBMCs PBMCs without Bregs
(b) 80
(a) 300
Patients
60 40 20 0
Healthy controls
Patients
Healthy controls
Fig 4. Influence of CD19+CD24hiCD38hi regulatory B cells (Bregs) on IgG/IgM production. CD19+CD24hiCD38hi Bregs were depleted by flow cytometry sorting from peripheral blood mononuclear cells (PBMCs) of healthy donors (n = 5) and patients newly diagnosed with pemphigus but who had not received any treatment (n = 5). Whole PBMCs and PBMCs depleted of CD19+CD24hiCD38hi Bregs were then cultured with ODN 2006 (10 lg mL1; InvivoGen, San Diego, CA, U.S.A.), lipopolysaccharide (10 lg mL1; Sigma-Aldrich, St. Louis, MO, U.S.A.) and CD40L (1 lg mL1; R&D Systems, Minneapolis, MN, U.S.A.) for 7 days, and then IgM and IgG levels were determined in supernatants by enzyme-linked immunosorbent assay. (a, b) Box plots of the immunoglobulin level in PBMC supernatants or Breg-depleted PBMCs from patients and controls. There was no significant difference in the mean SEM level of IgG and IgM in supernatants of CD19+CD24hiCD38hi Breg-depleted PBMCs compared with whole PBMCs from healthy donors or patients with pemphigus.
CD4+T+Breg CD4+ IFN-γ + T cell (%)
CD4+T alone
Healthy control
(a)
20 15
Patient
IFN-γ CD4 Total PBMCs
5
Patients
40
Healthy controls
*
30 20 10 0
Patients
Healthy controls
PBMCs without Bregs
Healthy control
(b)
Inhibition rate of IFN-γ (%)
8·0%
*
10
0
8·6%
CD4+T alone CD4+T+Breg
Patient
CD4+ IFN-γ + T cell (%)
40
Total PBMCs PBMCs without Bregs
30
20
10
IFN-γ
0 Patients
CD4
in healthy individuals. Moreover, the percentage of CD19+CD24hiCD38hi Bregs in patients in the active stage of pemphigus was also significantly higher than patients in the © 2014 British Association of Dermatologists
Healthy controls
Fig 5. Cytokine production of CD4 + T cells in vitro with or without regulatory B cells (Bregs). Purified CD19+CD24hiCD38hi Bregs sorted from healthy donors (n = 6) or patients newly diagnosed with pemphigus before they received any treatment (n = 9) were cultured with autologously sorted CD4+ T cells (1: 2) with plate-bound CD3 monoclonal antibody (mAb)/CD28mAb (05 mg mL1) for 72 h, and with phorbol myristate acetate (Sigma-Aldrich) and Ionomycin (Sigma-Aldrich) for the last 5 h of culture. The remaining Breg-depleted peripheral blood mononuclear cells (PBMCs) and whole, nondepleted PBMCs were cultured separately in the same assay. The production of cytokines in CD4+ T cells was then tested by flow cytometry. (a) Representative phenotype for one patient or control showing the frequency of interferon (IFN)-c produced by CD4+ T cells. Box plots represent the mean SEM percentages of CD4+IFN-c+ T cells in different groups. Culture with autologous Bregs from healthy controls led to a significant decrease in the mean SEM percentages of CD4+IFN-c+ T cells compared with cultured alone. The inhibition rate of IFN-c+ in patients with pemphigus was much lower than that of the control group. *P < 005. (b) The results are shown as no difference in mean SEM percentage of CD4+IFN-c+ T cells between the remaining CD19+CD24hiCD38hi Breg-depleted PBMCs and whole PBMCs from patients with pemphigus or healthy controls.
remittent stage of the disease. The capability of B cells to produce IL-10 in patients with pemphigus was significantly impaired compared with that of healthy controls. The Bregs in British Journal of Dermatology (2015) 172, pp101–110
108 Regulatory B cells in pemphigus, H.-Q. Zhu et al.
patients with pemphigus showed impaired function in downregulating IFN-c production by CD4+ T cells, although they did not directly regulate IgG/IgM production during in vitro assays. In contrast to murine Bregs, the surface markers of human Bregs remain controversial. Different B-cell subsets in circulation have been ascribed with a suppressive regulatory function that is dependent on IL-10, including CD19+CD24hiCD38hi Bregs, CD19+CD24hiCD27+ Bregs and CD25hiCD27hiCD86hi CD1dhi Bregs.19,23,24 Here, we confirmed a CD19+CD24hi CD38hi Breg phenotype and found that this B-cell subset is responsible for most of the IL-10 production by human B cells. Intracellular detection of IL-10 and mRNA expression of this cytokine suggest that CD19+CD24hiCD38hi Bregs are a major source of IL-10 production in the B-cell population. The important role of Bregs in patients with pemphigus is suggested by the finding that the frequency of Bregs was altered in these patients. Although no significant difference was found between the newly diagnosed group and the patients who had received treatment, the proportion of CD19+CD24hiCD38hi Bregs in patients with active pemphigus was significantly higher than in remittent individuals, which suggests that Bregs may regulate disease expression. So far, Bregs have not been well studied in pemphigus, except for in a recent study by Colliou et al.,25 which found that patients in complete remission after treatment with rituximab had significantly higher numbers of IL-10-secreting CD24hiCD38hi Bregs than patients with active lesions at baseline or those in incomplete remission. These seemingly contradictory results are perhaps owing to the fact that rituximab is a B cell-depleting Ab with the ability to reshape the B-cell repertoire during reconstitution. Our data reflected the intrinsic Breg frequency in patients with pemphigus, and are consistent with previous findings in other autoimmune diseases. Iwata et al. found that peripheral regulatory B10 cells frequencies were significantly higher in patients with autoimmune disease such as rheumatoid arthritis and SLE when compared with healthy controls.26 Previous studies have also shown a potential imbalance of Tregs in pemphigus.8,27,28 A significant reduction in the number of Tregs may be involved in the breaking of self-tolerance against Dsg in pemphigus. In contrast to decreased Tregs in patients with pemphigus, the number of Bregs in the peripheral blood of patients with pemphigus was significantly increased compared with healthy controls. As the capacity of human Bregs to produce IL-10 is central to their ability to regulate negatively inflammatory and autoimmune diseases, the increased number of Bregs perhaps suggests that these Bregs may be functionally defective in patients with pemphigus. It is also possible that the increase in the number of Bregs in active pemphigus might reflect the overstimulation of Bregs in a negative feedback loop, while after treatment with immunosuppressants and the improvement of symptoms, the number of Bregs declines, with a possible restoration of function. Therefore, immunosuppressants might, to a certain extent, influence the function of Bregs and needs to be further investigated. British Journal of Dermatology (2015) 172, pp101–110
We found that these IL-10-producing B cells in patients with pemphigus appear to be functionally mature because they can be identified based on cytoplasmic IL-10 expression after in vitro stimulation. The percentage of IL-10-producing B cells was significantly increased upon stimulation both in the patient and healthy groups. Strikingly, the increasing rate of IL-10-producing B cells in patients with pemphigus was significantly lower than in the control group, which suggests that B10 cells from patients with pemphigus likely have an intrinsic defect affecting IL-10 expression after long-term stimulation. B10 progenitor (B10pro) cells have also been functionally identified within the splenic B10 cell subpopulation in mice and in humans.26,29,30 We propose that CD19+CD24hiCD38hi Bregs consist of functionally immature transitional B cells, B10pro and B10 cells. The B10pro cell subpopulations may acquire the ability to function like B10 cells during a short in vitro stimulation. A profound impairment of IL-10 production by B cells from patients with pemphigus after culture stimulation for 48 h suggests that, unlike healthy controls, B10 cells from patients with pemphigus may be unable to express IL-10 production for long periods of time, which is essential for an effective T-cell suppression. Alternatively, the reservoir of B10pro cells may be significantly lower in patients with pemphigus compared with healthy donors. We further investigated the regulatory function of CD19+ CD24hiCD38hi Bregs. Interestingly, there was no direct impact on IgG/IgM-expressing B cells in patients with pemphigus or healthy controls. We next asked whether there was any difference in the production of Ag-reactive IgG. Unfortunately, we did not detect Dsg3-specific IgG Ab in the supernatant from in vitro culture. This might be owing to there being too few cells in the in vitro culture system, which leads to an Ab response that lies below the level of detection when overdiluted. In a future study, we will optimize the in vitro culture system or concentrate the supernatant to determine the possible impact on specific Dsg3 Ab production. However, suppressive activity of IL-10 from Bregs on CD4+ T cells might be mediated by direct contact.31 Indeed, we found that this B-cell subset, when isolated from patients, failed to suppress the production of IFN-c by autologous CD4+ T cells from patients with pemphigus. However, CD19+CD24hiCD38hi Bregs from healthy donors were capable of efficiently suppressing the IFN-c production of CD4+ T cells. In addition, our data suggest that depletion of CD19+CD24hiCD38hi Bregs from PBMCs of patients with pemphigus are unable to promote an increase in CD4+ T cell inflammatory cytokine production as it did in healthy controls. Alternatively, the low production of IFN-c in patients with pemphigus might be related to the inherent T helper (Th)1/ Th2 imbalance, which exhibits a relative downregulation of IFN-c because pemphigus is a Th2-dominant autoimmune skin disease. The lack of suppressive activity on cytokine-producing CD4+ T cells has also been found in patients with SLE.19 Pemphigus is suggested to be an autoimmune disorder associated with a Th2 response, and the downregulatory activity of Bregs © 2014 British Association of Dermatologists
Regulatory B cells in pemphigus, H.-Q. Zhu et al. 109
on CD4+IFN-c+ T cells in patients may reflect a type of worsening mechanism for Th2 polarization in pemphigus in a feedback pathway. Yoshizaki et al. showed that B10-cell maturation into functional IL-10-secreting regulatory cells required IL-21 and CD40-dependent cognate interactions with T cells.32 Taken together, Bregs in patients with pemphigus may be functionally unable to suppress effecter cell population. Nevertheless, the mechanisms, such as whether the B10 cells derived from patients with pemphigus exhibit a cell-intrinsic defect in response to T–B-cell interactions or IL-21 and expression of other related cytokines, should be further explored. In summary, we demonstrate that although the frequency of CD19+CD24hiCD38hi Bregs is significantly increased in patients with pemphigus compared with healthy controls, both in the active group and the remittent group. Unlike healthy B cells, these IL-10-producing B cells from patients with pemphigus displayed impaired IL-10 production when they were activated for a longer period of time. Bregs from patients with pemphigus did not directly regulate the humoral response, but lost their ability to significantly downregulate IFN-c production by CD4+ T cells. Our study further reveals the regulatory complexities of the immune system in patients with pemphigus and suggests that Breg-directed therapies may be able to reshape the disease course of autoimmune disorders such as pemphigus.
Acknowledgments We thank Zhicui Liu, Shanghai Institute of Immunology, School of Medicine, Shanghai Jiao Tong University, for her technical assistance. We thank Michael Jeffrey Cho and Xuming Mao for their editing of the manuscript.
References 1 Amagai M. Pemphigus: autoimmunity to epidermal cell adhesion molecules. Adv Dermatol 1996; 11:319–52. 2 Hertl M, Veldman C. Pemphigus – paradigm of autoantibody-mediated autoimmunity. Skin Pharmacol Appl Skin Physiol 2001; 14:408–18. 3 Stanley JR. Autoantibodies against adhesion molecules and structures in blistering skin diseases. J Exp Med 1995; 181:1–4. 4 Anhalt GJ, Labib RS, Voorhees JJ et al. Induction of pemphigus in neonatal mice by passive transfer of IgG from patients with the disease. N Engl J Med 1982; 306:1189–96. 5 Hertl M. Humoral and cellular autoimmunity in autoimmune bullous skin disorders. Int Arch Allergy Immunol 2000; 122:91–100. 6 Zhu H, Chen Y, Zhou Y et al. Cognate Th2-B cell interaction is essential for the autoantibody production in pemphigus vulgaris. J Clin Immunol 2012; 32:114–23. 7 Yokoyama T, Amagai M. Immune dysregulation of pemphigus in humans and mice. J Dermatol 2010; 37:205–13. 8 Xu R, Zhu H, Li W et al. The imbalance of Th17 and regulatory T cells in pemphigus patients. Eur J Dermatol 2013; 23:795–802. 9 Fujimoto M. Regulatory B cells in skin and connective tissue diseases. J Dermatol Sci 2010; 60:1–7. 10 Mauri C, Bosma A. Immune regulatory function of B cells. Annu Rev Immunol 2012; 30:221–41. 11 Mizoguchi A, Bhan AK. A case for regulatory B cells. J Immunol 2006; 176:705–10.
© 2014 British Association of Dermatologists
12 Fillatreau S, Sweenie CH, McGeachy MJ et al. B cells regulate autoimmunity by provision of IL-10. Nat Immunol 2002; 3:944–50. 13 Noh J, Lee JH, Noh G et al. Characterisation of allergen-specific responses of IL-10-producing regulatory B cells (Br 1) in cow milk allergy. Cell Immunol 2010; 264:143–9. 14 Lee JH, Noh J, Noh G et al. Allergen-specific transforming growth factor-beta-producing CD19+CD5+ regulatory B-cell (Br 3) responses in human late eczematous allergic reactions to cow’s milk. J Interferon Cytokine Res 2011; 31:441–9. 15 Noh J, Choi WS, Noh G et al. Presence of Foxp3-expressing CD19 (+)CD5(+) B cells in human peripheral blood mononuclear cells: human CD19(+)CD5(+)Foxp3(+) regulatory b cell (Breg). Immune Netw 2010; 10:247–9. 16 Matsushita T, Yanaba K, Bouaziz JD et al. Regulatory B cells inhibit EAE initiation in mice while other B cells promote disease progression. J Clin Invest 2008; 118:3420–30. 17 Mauri C, Gray D, Mushtaq N et al. Prevention of arthritis by interleukin 10-producing B cells. J Exp Med 2003; 197:489–501. 18 Watanabe R, Ishiura N, Nakashima H et al. Regulatory B cells (B10 cells) have a suppressive role in murine lupus: CD19 and B10 cell deficiency exacerbates systemic autoimmunity. J Immunol 2010; 184:4801–9. 19 Blair PA, Nore~ na LY, Flores-Borja F et al. CD19(+)CD24(hi)CD38 (hi) B cells exhibit regulatory capacity in healthy individuals but are functionally impaired in systemic lupus erythematosus patients. Immunity 2010; 32:129–40. 20 Knippenberg S, Peelen E, Smolders J et al. Reduction in IL-10 producing B cells (Breg) in multiple sclerosis is accompanied by a reduced naive/memory Breg ratio during a relapse but not in remission. J Neuroimmunol 2011; 239:80–6. 21 Kneisel A, Hertl M. Autoimmune bullous skin diseases. Part 2: diagnosis and therapy. J Dtsch Dermatol Ges 2011; 9:927–47. 22 Veldman C, Stauber A, Wassmuth R. Dichotomy of autoreactive Th1 and Th2 cell responses to desmoglein 3 in patients with pemphigus vulgaris (PV) and healthy carriers of PV-associated HLA class II alleles. J Immunol 2003; 170:635–42. 23 Zha B, Wang L, Liu X et al. Decrease in proportion of CD19+ CD24(hi) CD27+ B cells and impairment of their suppressive function in Graves’ disease. PLoS ONE 2012; 7:e49835. 24 Kessel A, Haj T, Peri R et al. Human CD19(+)CD25(high) B regulatory cells suppress proliferation of CD4(+) T cells and enhance Foxp3 and CTLA-4 expression in T-regulatory cells. Autoimmun Rev 2012; 11:670–7. 25 Colliou N, Picard D, Caillot F et al. Long-term remissions of severe pemphigus after rituximab therapy are associated with prolonged failure of desmoglein B cell response. Sci Transl Med 2013; 5:175ra130. 26 Iwata Y, Matsushita T, Horikawa M et al. Characterization of a rare IL-10-competent B-cell subset in humans that parallels mouse regulatory B10 cells. Blood 2011; 117:530–41. 27 Sugiyama H, Matsue H, Nagasaka A et al. CD4+CD25high regulatory T cells are markedly decreased in blood of patients with pemphigus vulgaris. Dermatology 2007; 214:210–20. 28 Veldman C, H€ ohne A, Dieckmann D. Type I regulatory T cells specific for desmoglein 3 are more frequently detected in healthy individuals than in patients with pemphigus vulgaris. J Immunol 2004; 172:6468–75. 29 DiLillo DJ, Matsushita T, Tedder TF. B10 cells and regulatory B cells balance immune responses during inflammation, autoimmunity, and cancer. Ann N Y Acad Sci 2010; 1183:38–57. 30 Yanaba K, Bouaziz JD, Matsushita T. The development and function of regulatory B cells expressing IL-10 (B10 cells) requires antigen receptor diversity and TLR signals. J Immunol 2009; 182:7459–72.
British Journal of Dermatology (2015) 172, pp101–110
110 Regulatory B cells in pemphigus, H.-Q. Zhu et al. 31 Bouaziz JD, Calbo S, Maho-Vaillant M. IL-10 produced by activated human B cells regulates CD4(+) T-cell activation in vitro. Eur J Immunol 2010; 40:2686–91. 32 Yoshizaki A, Miyagaki T, DiLillo DJ et al. Regulatory B cells control T-cell autoimmunity through IL-21-dependent cognate interactions. Nature 2012; 491:264–8.
British Journal of Dermatology (2015) 172, pp101–110
Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s website: Table S1. Summary data of included patients with pemphigus (n = 34).
© 2014 British Association of Dermatologists
