Comparative Biochemistry and Physiology, Part C 172–173 (2015) 19–25

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

Impacts of oxidative stress on acetylcholinesterase transcription, and activity in embryos of zebrafish (Danio rerio) following Chlorpyrifos exposure Gabriela Rodríguez-Fuentes ⁎,a, Fernando J. Rubio-Escalante a, Elsa Noreña-Barroso a, Karla S. Escalante-Herrera b, Daniel Schlenk c a b c

Faculty of Chemistry, Universidad Nacional Autónoma de México, Sisal, Yucatan, Mexico Faculty of Sciences, Universidad Nacional Autónoma de México, Sisal, Yucatan, Mexico Department of Environmental Sciences, University of California Riverside, Riverside, United States

a r t i c l e

i n f o

Article history: Received 23 February 2015 Received in revised form 22 April 2015 Accepted 23 April 2015 Available online 30 April 2015 Keywords: Acetylcholinesterase Chlorpyrifos Oxidative stress Danio rerio

a b s t r a c t Organophosphate pesticides cause irreversible inhibition of AChE which leads to neuronal overstimulation and death. Thus, dogma indicates that the target of OP pesticides is AChE, but many authors postulate that these compounds also disturb cellular redox processes, and change the activities of antioxidant enzymes. Interestingly, it has also been reported that oxidative stress plays also a role in the regulation and activity of AChE. The aims of this study were to determine the effects of the antioxidant, vitamin C (VC), the oxidant, t-butyl hydroperoxide (tBOOH) and the organophosphate Chlorpyrifos (CPF), on AChE gene transcription and activity in zebrafish embryos after 72 h exposure. In addition, oxidative stress was evaluated by measuring antioxidant enzymes activities and transcription, and quantification of total glutathione. Apical effects on the development of zebrafish embryos were also measured. With the exception of AChE inhibition and enhanced gene expression, limited effects of CPF on oxidative stress and apical endpoints were found at this developmental stage. Addition of VC had little effect on oxidative stress or AChE, but increased pericardial area and heartbeat rate through an unknown mechanism. TBOOH diminished AChE gene expression and activity, and caused oxidative stress when administered alone. However, in combination with CPF, only reductions in AChE activity were observed with no significant changes in oxidative stress suggesting the adverse apical endpoints in the embryos may have been due to AChE inhibition by CPF rather than oxidative stress. These results give additional evidence to support the role of prooxidants in AChE activity and expression. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Two cholinesterases (ChE) are present in vertebrates, acetylcholinesterase (AChE, EC 3.1.1.7) and butyrylcholinesterase (BChE, EC 3.1.1.8). Unlike many fish, zebrafish (Danio rerio) have a single gene for AChE but the gene or activity of BChE is not present (Bertrand et al., 2001). These characteristics make zebrafish an ideal organism for the study of AChE regulation. Zebrafish is a species convenient and cost-effective to work with from a technical and methodological point of view, and it provides conceptual insights into many aspects of vertebrate biology, genetics, toxicology and disease (Segner, 2009). The early life-stage test using Abbreviations: AChE, acetylcholinesterase; CAT, catalase; CPF, chlorpiryfos; CPF-O, chlorpyrifos-oxon; GSH, glutathione; GPx, glutathione peroxidase; GR, glutathione reductase; OP, organophosphate pesticide; ROS, reactive oxygen species; SOD, superoxide dismutase; tBOOH, tert butyl hydroperoxide, TCP, 3,5,6 trichloro-2-pyridinol. ⁎ Corresponding author at: Unidad de Química Sisal, Facultad de Química, UNAM, Av. Colón # 503 F X 62 y Reforma Colonia Centro, 97000 Mérida, Yucatán, Mexico. Tel.: +52 988 931 1000x7105. E-mail address: [email protected] (G. Rodríguez-Fuentes).

http://dx.doi.org/10.1016/j.cbpc.2015.04.003 1532-0456/© 2015 Elsevier Inc. All rights reserved.

the zebrafish embryo currently is one of the most widely used tools in environmental toxicology, especially for investigating the toxicity and teratogenicity of chemicals that could significantly affect environmental health (Schulte and Nagel, 1994). ChE are inhibited by numerous pollutants that include organophosphate pesticides (OP), which are, among other pesticides the most toxic to vertebrates (Shadnia et al., 2005; Rahimi et al., 2006). OP causes the irreversible inhibition of AChE in the central and periferal nervous systems resulting in the accumulation of acetylcholine and excessive activation of muscarinic and nicotinic receptors, which may lead to death (Shih and McDonough, 1997). Thus, dogma indicates that the target of OP pesticides is AChE, but many authors postulate that these compounds also disturb cellular redox processes, and change the activities of antioxidant enzymes (Abdollahi et al., 2004; Possamai et al., 2007). OP metabolism produces reactive oxygen species (ROS) that are highly reactive molecules, which have one or more unpaired electrons (Altuntas et al., 2003). ROS cause lipid peroxidation resulting in the formation of highly reactive stable and unstable hydroperoxides of saturated and unsaturated lipids with eventual damage to DNA. Cells have mechanisms to

20

G. Rodríguez-Fuentes et al. / Comparative Biochemistry and Physiology, Part C 172–173 (2015) 19–25

counteract damage caused by ROS. Many compounds have antioxidant capacity and can be categorized in two systems. One of them is enzymatic consisting superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx) and glutathione reductase (GR). The other system is non-enzymatic and consists of a reduced form of glutathione and vitamins (C,E,beta-carotene) which directly inactivate ROS. Interestingly, it has also been reported that oxidative stress plays also a role in the regulation and activity of AChE. For example Schallreuter et al. (2004) identified activation/deactivation of human AChE by hydrogen peroxide; De Carvalho Corrêa et al., 2008 found that oxidative stress during hypertension changes AChE activity in vivo, and it has also been reported that ethanol, which produces ROS, alters genetic expression and activity of AChE (Rico et al., 2007). Considering that changes in antioxidant levels contribute to many diseases and developmental abnormalities, the importance of AChE in nervous system, and the extensive use of OPs, further research into the effect of OP on oxidative stress and how it interacts with AChE inhibition and regulation is necessary. The aims of this study were to determine the effects of Chlorpyrifos (CPF), the antioxidant vitamin C (VC), the pro-oxidant t-butyl hydroperoxide (tBOOH) and their co-exposures on AChE gene transcription and activity as well as their effects on oxidative stress and the development of zebrafish embryos. 2. Materials and methods This study was conducted in accordance with institutional guidelines for the protection of animal welfare. Adult wild-type zebrafish were obtained from Enmanuel fish farm (Hunucma, Yucatan). Organisms were separated by gender and acclimated for 1 month at the Unit of Chemistry of the National Autonomous University of Mexico in Sisal, Yucatan, using 40-L glass aquariums (density of 1 fish/liter) with constant aeration at 26 ± 2 °C, pH 8.0 ± 0.5, conductivity 600 ± 50 μS/cm. Fish were fed twice daily with commercial dry food, once per day with Artemia sp. nauplii and once with Daphnia pulex ad libitum. After acclimation period, mating was done in 10 L glass aquariums with a density of 5 fish per liter and a female to male ratio 2:1, water temperature was elevated to 28 ± 2 °C (Westerfield, 2000). Spawning was induced by the onset of light. Eggs were collected and rinsed with clean water before exposures. Fertilized eggs were used for exposures 2 h post fertilization. Zebrafish embryos were transferred to 6 well plates, 50 embryos per well and 3 replicates per concentration for each of the evaluated endpoints were used in all the exposures. Zebrafish embryos were exposed to 200 and 400 μg/L CPF; 200 and 400 μg/L VC and 200 and 400 μg/L tBOOH. Additional bioassays consisted in the co-exposure with 400 μg/L of CPF and either 200 or 400 μg/L VC or tBOOH. All bioassays included a negative control and a 0.01% ethanol control (if needed). After 72 h, larvae were placed in clean 1.5 mL microcentrifuge tubes and snap frozen in liquid nitrogen. Samples used for qRT-PCR were treated with 200 μL of RNA later® (Sigma, USA). Samples were kept at −80 °C for later analysis. Concentrations of CPF were verified by solid-phase microextraction and gas chromatography-mass spectrometry (SPME/GC-MS), based on the methods reported by Tomkins and Ilgner (2002). A sample aliquot of 10 mL was placed in a 20 mL-SPME vial (Supelco, USA) with a screw cap with a PTFE/silicone septum (Supelco, USA). Extraction of CPF was performed by direct immersion for 30 min at 55 °C with a 65 μm PDMS/DVB SPME fiber (Supelco, USA) and 700–900 rpm magnetic stirring. After the extraction, CPF was quantified using an Agilent Technologies 6850 Gas Chromatography System equipped with a 5975B mass detector and a Zebron ZB-5MSi capillary column (30 m long, 0.25 mm i.d. and 0.25 μm film thickness, Phenomenex, USA). The Inlet temperature was 250 °C and samples were injected in a splitless mode (1 min purge time) with 10 min of desorption time. The oven temperature program started at 50 °C for 1 min, ramp 1 was 10 °C/min until 180 °C, ramp 2 was 1.5 °C/min until 200 °C and held for 2 min,

and ramp 3 was 30 °C/min until 290 °C and held for 2.67 min; the carrier gas was helium. CPF was determined in selective ion monitoring (SIM) mode (target ions: 314, 316 m/z). The spectra generation frequency was 20 Hz, and the interface and ion source temperatures were 290 and 230 °C, respectively. The MS ionization mode was electron ionization (EI). Calibration solutions were used to quantify the CPF in the samples. The method detection limit was 10 ng/L. VC in exposure solutions was measured using Ascorbic Acid Assay Kit (MAK074, Sigma-Aldrich, USA) and VC concentration was determined by a coupled enzyme reaction, which results in a colorimetric (570 nm) product proportional to the ascorbic acid present in the sample. Analyses were made following the instructions indicated in the technical bulletin provided by the manufacturer. TBOOH in exposure solutions was measured using PeroxiDetect Kit (PD1; Sigma-Aldrich, USA) for the determination of aqueous peroxide solutions. Color formation was measured colorimetrically at 560 nm using a Lambda 25 UV/Vis spectrometer (Perkin Elmer, USA). AChE activity was measured using a modification of the method of Ellman et al. (1961) adapted to a microplate reader (Rodríguez-Fuentes et al., 2008). In summary, each well contained 10 μL of the enzyme supernatant and 180 μL of 5,5′-dithiobis(2 nitrobenzoic acid) (DTNB) 0.5 mM in 0.05 M Tris Buffer pH 7.4. The reaction started by addition of 10 μL of acetylthiocholine iodide. The rate of change in the absorbance at 405 nm was measured for 120 s. Activities of CAT, SOD and total glutathione concentration were determined colorimetrically using Cayman Chemical kits (Cayman Chemical, USA) following the manufacturer's instructions. CAT assay (Johansson and Borg, 1988) utilizes the peroxidatic function of the enzyme for determination of activity. The method is based on the reaction of the enzyme with methanol in the presence of an optimal concentration of H2O2. The formaldehyde produced is measured colorimetrically with 4-amino-3-hydrazini-5-mercapto-1,2,4 triazole (Purpald) as the chromogen. Purpald forms a compound with aldehydes which upon oxidation changes from colorless to a purple color. SOD assay utilizes a tetrazolium salt for detection of superoxide radicals generated by xanthine oxidase and hypoxanthine. Glutathione assay (Baker et al., 1990) utilizes an enzymatic recycling method, using GR. The sulfhydryl group of GSH reacts with Ellman's reagent and produces a yellow colored compound that is read at 405 nm. Concentrations of protein in samples were measured as described by Bradford (1976). All enzyme activities were normalized respect to its protein content. Quantification primers for AChE, CAT, and β-actin were designed from the reported GenBank sequences with accession numbers NM_ 131846.1, NM_130912 and BC165823.1, respectively, to obtain amplicons of 100–200 base pairs. SOD quantification primer sequences were taken from Gonzalez et al. (2006). Primer sequences are reported in Table 1. Before qPCR, all amplicons were purified and sequenced to verify primer specificity, and efficiency curves were also run to validate the method. Total RNA was extracted using Gene Elute® Mammalian Total RNA Mike Prep Kit (Sigma, USA). Total RNA concentration was determined by evaluating fluorescence with the Quant-it® RNA Assay Kit (Invitrogen, USA). Two hundred nanograms of total RNA was used for the synthesis of cDNA with the iScript® Kit (Biorad, USA); 1 μL of cDNA was used for qPCR Table 1 Primer sequences for qPCR for acetylcholinesterase (ACHE), catalase (CAT), superoxide dismutase (SOD), glutathione peroxidase (GPx) and β-actin (BAC) genes in zebrafish larvae. Gene

AChE GPx SODCU/ZN CAT BAX

Forward

CAAGTTCTTCCCTGGAGCAG GAAATACGTCCGTCCTGGAA TGAGACACGTCGGAGACC CAGGAGCGTTTGGCTACTTC GTGCCATCTACGAGGCTTA

Reverse

TCCCTCATCCTGATTTACGC TCTCCCATAAGGGACACAGG TGCCGATCACTCCACAGG ATCTGATGACCCAGCCTCAC TCTCAGCTGTGGTGGTGAAG

Tm° F

R

63.9 °C 63.8 °C 62.8 °C 63.8 °C 63.8 °C

63.9 °C 63.9 °C 66.4 °C 64.2 °C 64.3 °C

G. Rodríguez-Fuentes et al. / Comparative Biochemistry and Physiology, Part C 172–173 (2015) 19–25

with iQ® SYBR Green Mix (Biorad, USA). The qPCR was carried out in an IQ5® thermocycler (Biorad, USA) with an initial denaturalization at 95 °C for 3 min, followed by 35 cycles of 30 s at 95 °C, 30 s at 55 °C and 30 s at 72 °C and finally, a melting curve from 95 °C to 50 °C Δ-0.5 °C/20 s. The relative expression of the RNA was calculated using the ΔΔCt method (Livak and Schmittgen, 2001). Since oxidative stress has been implicated in xenobiotic mediated developmental toxicity (Shi and Zhou, 2010), development of zebrafish embryos was evaluated following exposures. In this study, endpoints used for assessing developmental toxicity included embryo mortality, pericardial area and heartbeat frequency (visually determined as the average for five embryos, counted for 10 s under a temperature-controlled stage). Evaluations of these endpoints were based in guidelines given by OECD 212 (1998) and Fraysse et al. (2006). Brown–Forsythe test was used to verify homogeneity of variances. ANOVA followed by Tukey's post-hoc test was used to find differences between treatments. The level of significance was set at p ≤ 0.05; data analysis was performed using GraphPad Prism 6.0 (GraphPad Software Inc., USA).

exposures with tBOOH (Fig. 2e). ANOVA indicated that in the rest of the bioassays there were no statistically significant differences (Fig. 2b, c, d). CAT activities were not statistically different in treatments with CPF, VC or their co-exposure. CAT activity showed a statistically significant decrease in tBOOH exposure (Fig. 3c). There were no statistically differences between controls and treatments in CAT gene expression in all bioassays (p N 0.05). SOD activities and gene expression were unaltered with respect to control in all treatments for all the tested conditions (p N 0.05). GPx gene expression remained without significant differences respect to control in all treatments for all the tested conditions (p N 0.05). Total glutathione concentration presented a statistically significant increase at 200 μg/L CPF when compared to 400 μg/L CPF (Fig. 4a). A significant reduction was also found between the solvent control and the co-exposure of 400 μg/L CPF + 400 μg/L t-BOOH (Fig. 4e). Results of apical endpoints are presented in Table 2. A statistically significant increase in mortality was also observed at 400 μg/L tBOOH + CPF μg/L. A positive significant correlation between VC exposure concentrations and mortality percentage was also found (r2 = 0.9216, p = 0.04). Heartbeat frequency was significantly increased in tBOOH alone treatments. Co-exposures with VC and CPF had a significant effect on heartbeat frequency. Treatments with tBOOH alone and co-exposures with VC or tBOOH and CPF caused statistically significant increases in pericardial area with respect to controls.

3. Results Analysis of measured exposure concentrations indicated that during treatments concentrations for CPF were 205.87 ± 19.50 and 421.04 ± 21.37; for VC 195.36 ± 20.11 and 399.87 ± 30.73 μg/L; and for tBOOH 195.76 ± 23.87 and 382.48 ± 9.18 μg/L. Non detected concentrations of CPF, VC or tBOOH were found in controls. AChE activity in CPF treatments indicated a statistically significant reduction at 400 μg/L (Fig. 1a). Treatments with increasing concentrations of VC and TBOOH produced no statistical significant differences in AChE activity (Fig. 1b and c). Nevertheless, a trend toward reduction was observed with tBOOH treatment as a significant negative correlation (r = −0.70) was noted. The results of the VC or tBOOH co-exposures with CPF indicated a statistically significant reduction of AChE activities (Fig. 1d and e). Relative expression of AChE mRNA indicated a significant increase in the 200 μg/L CPF treatment with respect to control (Fig. 2a). Significant down-regulation was also found between 400 μg/L CPF and all its co-

Chlorpyrifos like other organophosphate pesticides causes the inhibition of ChE (Kwong, 2002). CPF can be metabolized by CYP to undergo dearylation, forming 3,5,6 trichloro-2-pyridinol (TCP) and diethylthiophosphate, or oxidative desulfuration forming cholorpyrifosoxon (CPF-O) (Tang et al., 2001). CPF-O exhibits an approximately three magnitude higher affinity toward the ChE active site than the parent compound (Amitai et al., 1998). CPF-O can also be metabolized by esterases to form TCP and diethylphosphate (Chanda et al., 1997; Pond et al., 1998). Recent studies showed that CPF metabolism produced elevated ROS that generated oxidative stress in different cell types (Verma et al., 2007; Mansour et al., 2009; Saulsbury et al., 2009). In the present study,

b)

c) 150

tr

4

n C

o

o C

V it a m in C µ g /L

d)

0

o

l

0 0

0

n

2

tr

0

o

l

0 0

n o C

C h lo r p y r ifo s µ g /L

t B O O H µ g /L

e) 150

150

a

a 100

b b

50

b

a

a

100

b

50

b

b

V it a m in C + C h lo r p y r if o s µ g /L

0 4

4

0 0 4

0

+

+

4 +

0 2

0

0

0 0

0 0

C S

o tr C

o

n

+ 0 0 4

0 0 2

l

0 4

4 +

4 + 0

0

0

0 0

C S

o tr n o C

0

0

l

0

A C h E n m o l/m in /m g

A C h E n m o l/m in /m g

50

0

4

0 2

tr

S

o

C

0

0

l

0

50

100

0

50

100

4

b

0

100

150

0

A C h E n m o l/m in /m g

a

A C h E n m o l/m in /m g

150

A C h E n m o l/m in /m g

4. Discussion

2

a)

21

t B O O H + C h lo r p y r if o s µ g /L

Fig. 1. AChE activity following treatment with different concentrations of Chlorpyrifos, Vitamin C and t-butyl hydroperoxide in zebrafish embryos. Graphs represent specific treatments: a) Chlorpyrifos, b) Vitamin C, c) t-butyl hydroperoxide, d) 400 μg/L Chlorpyrifos + Vitamin C, and e) 400 μg/L Chlorpyrifos + t-butyl hydroperoxide. Bars represent means ± SD. Different letters represent pairs that are significantly different at p = 0.05 (Tukey's post hoc test).

G. Rodríguez-Fuentes et al. / Comparative Biochemistry and Physiology, Part C 172–173 (2015) 19–25

0 .5

0

0

l o tr n

n

C

C

o

o

n o C

V it a m in C µ g /L

C h lo r p y r ifo s µ g /L

t B O O H µ g /L

e)

0 0 4

4

0

+

+

+

0

0

2

4

o C

+ 0 0 4

0 2

0

C S

o n

0 4

4 + 0

+ 0

tr

0

0 0

0 4

S

0

C

l o tr n o C

0

0 .0

l

0 .0

0 .5

0

0 .5

b

b

1 .0

0

1 .0

a 1 .5

4

1 .5

2 .0

0

R e la tiv e e x p r e s s io n A C h E

R e la tiv e e x p r e s s io n A C h E

2 .0

0

d)

0

0 .0

4

R e la tiv e e x p r e s s io n A C h E tr

0 4

1 .0

0

0 .0

0

0 0 2

tr

S

o

C

l

0

0 .5

1 .5

0

1

1 .0

2 .0

4

a

2

a

0

a 2

1 .5

0

3

l

4

o

R e la tiv e e x p r e s s io n A C h E

b

c) 2 .0

0

b) 5

R e la tiv e e x p r e s s io n A C h E

a)

2

22

t B O O H + C h lo r p y r if o s µ g /L

V it a m in C + C h lo r p y r if o s µ g /L

Fig. 2. AChE gene expression following treatment with different concentrations of chlorpyrifos, Vitamin C and t-butyl hydroperoxide in zebrafish embryos. Graphs represent specific treatments: a) Chlorpyrifos, b) Vitamin C, c) t-butyl hydroperoxide, d) 400 μg/L Chlorpyrifos + Vitamin C, and e) 400 μg/L Chlorpyrifos + t-butyl hydroperoxide. Bars represent means ± SD. Different letters represent pairs that are significantly different at p = 0.05 (Tukey's post hoc test).

we observed the expected inhibition of ChE activities at 400 μg/L, but it is important to notice that despite the fact that CPF concentrations are relatively high; the maximum percentage of inhibition was 55–60% from control when embryos were 72 hpf (Fig. 1a). This is in accordance with previous studies where 72 hpf embryos were exposed to similar

b

0

0

l o n o C

C 0

0

0

4

2

S

0

C

l o

t B O O H µ g /L

V ita m in C µ g /L

C

o

n

tr

2

2

n o

0

0

0 tr

0

o tr

b

2

4

C A T n m o l/m in /m g p r o t e in

0 l

2

2

4

0

4

4

a 6

0

6

6

8

4

8

8

0

10

c)

0

b) C A T n m o l/m in /m g p r o t e in

C A T n m o l/m in /m g p r o t e in

a)

concentrations of CPF and produced no or moderate (approximately 50%) inhibition (Yang et al., 2011; Yen et al., 2011). In contrast, adult or older (96–120 hpf) zebrafish had more than 70% AChE inhibition at similar or lower CPF exposure concentrations (Tilton et al., 2011; Yen et al., 2011). Expression of zebrafish AChE mRNA occurs in embryos after

C h lo r p y r ifo s µ g /L

e)

V it a m in C + C h lo r p y r if o s

µ g /L

0

0 0 0 4

0 0 2

+

+

4

4

0

0

0 0 4

tr n o C

+

o

l

0

0

+ 0 4

0

0 0 2

2

4

4 +

4 + 0

4

0

0

0 0

C S

o tr n o C

0

0

6

0

5

8

C

10

10

S

C A T n m o l/m in /m g p r o t e in

15

l

C A T n m o l/m in /m g p r o t e in

d)

t B O O H + C h lo r p y r if o s µ g /L

Fig. 3. CAT activity following treatments with different concentrations of chlorpyrifos, Vitamin C and t-butyl hydroperoxide in zebrafish embryos. Graphs represent specific treatments: a) Chlorpyrifos, b) Vitamin C, c) t-butyl hydroperoxide, d) 400 μg/L Chlorpyrifos + Vitamin C, and e) 400 μg/L Chlorpyrifos + t-butyl hydroperoxide. Bars represent means ± SD. Different letters represent pairs that are significantly different at p = 0.05 (Tukey's post hoc test).

G. Rodríguez-Fuentes et al. / Comparative Biochemistry and Physiology, Part C 172–173 (2015) 19–25

b)

4

0 .5

tr

0

l o

0

n

4

0

o C

C

o

C

n

o

4

n

2

0

0

l o tr

0 0

0 2

S

0

C

l o tr

1

0

0 .0

0

2

0

1

1 .0

3

4

a

1 .5

0

2

2 .0

0

3

G S H n m o l/m g p r o t e in

b

G S H n m o l/m g p r o t e in

2 .5

4

G S H n m o l/m g p r o t e in

c)

2

a)

23

d)

e) 3

G S H n m o l/m g p r o t e in

3

2

1

2

b 1

V it a m in C + C h lo r p y r if o s µ g /L

0 4

4 4

0

0

+

+

4 2

0

0

+ 0

o

0

0 0

0 0

C S

o tr n

+ 0 0 4

0 0 2

l

0 4

4 +

4 + 0

o C

0

0

0 0

C S

o tr n

0

0 l

0

a

C

G S H n m o l/m g p r o t e in

t B O O H µ g /L

V it a m in C µ g /L

C h lo r p y r ifo s µ g /L

t B O O H + C h lo r p y r if o s µ g /L

Fig. 4. Total glutathione following treatments with different concentrations of chlorpyrifos, Vitamin C and t-butyl hydroperoxide in zebrafish embryos. Graphs represent specific treatments: a) Chlorpyrifos, b) Vitamin C, c) t-butyl hydroperoxide, d) 400 μg/L Chlorpyrifos + Vitamin C, and e) 400 μg/L Chlorpyrifos + t-butyl hydroperoxide. Bars represent means ± SD. Different letters represent pairs that are significant different at p = 0.05 (Tukey's post hoc test).

12 hpf (Bertrand et al., 2001). Yen et al. (2011) observed an 800% increase in AChE catalytic activity from 24 hpf to 72 hpf. These data indicate developmental differences in AChE expression and catalytic activity which may allow younger animals to be more resistant to OPs than older animals. Zebrafish embryos have a chorion that is present approximately the first 48 hpf (Kimmel et al., 1995) and several studies have demonstrated a protective role of the chorion for pollutant toxicity (Helmstetter and Alden, 1995; Kais et al., 2013; Negro et al., 2014). This implies that CPF uptake may be reduced until hatching occurs. In addition, since CPF requires metabolic activation to the oxon, zebrafish biotransformation pathways may not be fully activated at 72 h. Previous studies Table 2 Effects of Chlorpyrifos, Vitamin C and t-butyl hydroperoxide on zebrafish embryo mortality, heart rate and pericardial area. Assays represent: 1) Chlorpyrifos (CPF), 2) Vitamin C (VC), 3) t-butyl hydroperoxide (tBOOH), 4) Vitamin C + 400 μg/L Chlorpyrifos +, and 5) t-butyl hydroperoxide +400 μg/L Chlorpyrifos. Bars represent means ± SD. Different letters represent pairs that are significantly different at p = 0.05 (Tukey's post hoc test). Assay

Treatment

Mortality (%)

Heartbeat (beats/10 s)

Pericardial area (mm2)

1

Control Solvent control 200 CPF 400 CPF Control 200 VC 400 VC Control 200 tBOOH 400 tBOOH Control Solvent control 400 CPF 200 VC + 400 CPF 400 VC + 400 CPF Control Solvent control 400 CPF 200tBOOH + 400 CPF 400 tBOOH + 400 CPF

2.17 ± 1.20 3.33 ± 0.29 4.17 ± 1.44 1.75 ± 1.10 1.75 ± 0.87 1.92 ± 0.76 2.67 ± 0.14 3.5 ± 0.50 3.5 ± 0.75 4.9 ± 1.74 1.75 ± 1.15 3.33 ± 0.28 1.75 ± 1.09 1.75 ± 1.25 1.083 ± 0.94 1.75 ± 0.90a 3.33 ± 0.28a 1.75 ± 1.09a 5.00 ± 2.41a 5.66 ± 0.76b

21.75 ± 1.75 23.67 ± 3.22 22.21 ± 2.36 23.04 ± 1.99 23.88 ± 1.96 25.92 ± 2.75 24.58 ± 3.33 21.96 ± 1.87a 25.88 ± 1.90b 25.71 ± 1.78b 23.88 ± 1.96a 23.79 ± 3.08a 23.04 ± 1.99a 25.29 ± 2.69b 25.83 ± 2.16b 23.88 ± 1.96 23.79 ± 3.08 23.04 ± 1.99 24.21 ± 3.036 23.67 ± 2.036

0.029 ± 0.007 0.034 ± 0.014 0.033 ± 0.008 0.029 ± 0.005 0.034 ± 0.006 0.040 ± 0.009 0.042 ± 0.019 0.032 ± 0.007a 0.056 ± 0.014b 0.049 ± 0.009b 0.033 ± 0.006a 0.034 ± 0.014 0.029 ± 0.005a 0.039 ± 0.011b 0.039 ± 0.013b 0.033 ± 0.006a 0.034 ± 0.014a 0.029 ± 0.005a 0.051 ± 0.014b 0.047 ± 0.008b

2

3

4

5

demonstrated that at 350 μg/L CPF, there were no detected concentrations of CPF-O, suggesting that at early developmental stages, zebrafish may either preferentially detoxify CPF via hydrolysis or oxidative cleavage and/or lack the metabolic enzyme needed to activate CPF through desulfuration (Yang et al., 2011). These factors may also help explain the diminished oxidative stress and lack of adverse apical endpoints during CPF exposure. CPF may also induce changes in antioxidant enzyme activities in several organisms at different developmental stages (Özkan et al., 2012; Ling and Zhang, 2013; Akande et al., 2014). Consequently, species sensitivity and developmental stage may significantly influence the mode of action of CPF. Additional studies with higher CPF concentrations at more susceptible developmental life stages may provide more evidence regarding the role of oxidative stress as a mode of action. Addition of VC did not alter AChE activity or gene expression by CPF. Neuroprotective effects of VC were previously observed through an increase of ChE activity in organisms exposed to anti-AChE chemicals (Bano and Bhatt, 2010; Delwing-de Lima et al., 2010). Similarly, VC was protective against CPF induced oxidative stress in tilapia (Özkan et al., 2012). Since CPF did not produce oxidative stress in the exposed embryos, antioxidant protection was likely not needed, and thus no effect was noted on oxidative stress upon co-exposure with CPF. Despite the fact that there were no alterations in oxidative stress indicators during VC exposures, there were some deleterious effects when the apical endpoints were evaluated during co-exposures with CPF. For example, heartbeat rate and pericardial area increased in VC + CPF treated organisms. Many compounds have been reported to produce pericardial sac edema in zebrafish (Ali et al., 2014), edema is produced by the accumulation of pellucid fluid. Antioxidants are a class of substances that are thought to be beneficial, VC is an essential nutrient and participates as a key active substance in different biochemical functions associated with immune function (i.e. bactericidal, antiviral activities) (Sureda et al., 2006). Among these roles, several are related to preventing or helping curing inflammatory conditions provoked by, or leading to an excessive production of ROS and reactive nitrogen species (Amatore et al., 2008). However, under some circumstances, VC and its ascorbate derivatives have been shown to behave as prooxidants (Pepperell et al.,

24

G. Rodríguez-Fuentes et al. / Comparative Biochemistry and Physiology, Part C 172–173 (2015) 19–25

2003; Amatore et al., 2008). It has been reported that ascorbate kills cells in vitro by acting as a prooxidant through generation of hydrogen peroxide (Ma et al., 2014). But it should be pointed out that there are significant unknowns in the mechanism of action for high ascorbate concentration acting as a prooxidants. The problem is the lack of identification of specific mechanisms by which high levels of VC lead to formation of ascorbate radicals and in turn produce H2O2 in vitro and in extracellular fluid (Mendelsohn and Larrick, 2014). Intracellular levels of ascorbate are tightly controlled by transporters, so the generation of free radicals takes place outside the cells (Mendelsohn and Larrick, 2014). In addition to its possible prooxidant role, VC could be acting as an AChE inhibitor, since incubation of AChE with VC and cupric ions under aerobic conditions resulted in an irreversible loss of enzyme activity caused by redox reactions (Kanazawa et al., 1995). Pericardial sac edema has been reported during exposure to pesticides (Pamanji et al., in press), this condition has been linked to the failure of osmoregulatory system associated with pesticide accumulation (Cook et al., 2005), and this effect could be enhanced by the presence of high concentrations of VC. Exposure to different tBOOH levels had no significant different AChE activities with respect to control; although a significant negative correlation between tBOOH concentration and AChE activity was found. AChE gene expression was also unaltered when tBOOH was administered alone, but when combined with CPF a significant reduction in expression relative to CPF alone was observed. Previous results have reported the role of prooxidants in regulating AChE activity and gene expression. For example an in vitro study showed that low concentrations of H2O2 activate human recombinant AChE, whereas high concentrations inhibited the enzyme (Schallreuter et al., 2004). H2O2 was also reported to modify erythrocyte membrane structure and activity of AChE (Molochkina et al., 2005). Activation/deactivation of skin AChE by H2O2 was found to be a reversible oxidation process (Schallreuter and Elwary, 2007). TBOOH, is a potent pro-oxidant and demonstrated oxidative stress in the current study by reducing CAT activity, and reducing GSH concentrations. However, when tBOOH was co-exposed with CPF significant differences were only observed in total GSH concentration. Anti-oxidant functions of the embryos may have significant stage-specific roles as GSH concentrations have been shown to vary tremendously throughout fish development (Wu and Zhou, 2012). It has been previously reported that organophosphate pesticides caused a decrease in the levels of GSH (Ojha and Srivastava, 2012). Diminished GSH in embryos during tBOOH and CPF co-exposures was related to an increase in mortality and pericardial area indicating a combined deleterious effect. In accordance to this, it has been reported that the addition of H2O2 potentiated organophosphate toxicosis in chickens reducing the LD50 of dichlorvos and diazinon, and reducing ChE activity, suggesting a toxic interaction between OPs and H2O2 (Al-Baggou et al., 2011). This effect may be attributed to the prooxidant, which modulated ChE activity (Schallreuter et al., 2004; Molochkina et al., 2005). In the current study, combined exposure with tBOOH likewise reduced AChE expression and activity. Thus, based on the data from this specific life stage, it would appear that AChE inhibition may be the primary mode of action for CPF toxicity as opposed to oxidative stress. The limited effect on antioxidant genes found in the present work may be because the organisms do not present oxidative stress at the time samples were taken, indicating that either their antioxidant systems are able to deal with ROS production, or there is limited ROS production. It is important to consider that there might exist a time and concentration dependency, it has been previously reported that those variables may have an effect in the expression of antioxidant enzymes genes (Woo et al., 2009; Li et al., 2013; Jiang et al., 2014). In summary, limited effects of CPF on oxidative stress and apical endpoints were found in zebrafish embryos at this developmental stage. Addition of VC had little effect on oxidative stress or AChE, but increased pericardial area and heartbeat rate through an unknown mechanism. TBOOH diminished AChE gene expression and activity, and caused

oxidative stress when administered alone. However, in combination with CPF, only reductions in AChE were observed with no significant changes in oxidative stress suggesting the adverse apical endpoints in the embryos may have been due to AChE inhibition by CPF rather than oxidative stress. Acknowledgments Authors may want to acknowledge UC Mexus–CONACyT collaborative grant CN11-527 for the financial support to this study. We would like to acknowledge Ulises de Jesús Mendoza-Euán, Juan J. Sandoval-Gió, Francisco Olvera-Escalante and Anita Arroyo-Silva for all they valuable effort during embryo tests and the maintenance of zebrafish cultures. References Abdollahi, M., Ranjbar, A., Shadnia, S., Nikfar, S., Rezaie, A., 2004. Pesticides and oxidative stress: a review. Med. Sci. Monit. 10 (6), RA141–RA147. Al-Baggou, B.K., Naser, A.S., Mohammad, F.K., 2011. Hydrogen peroxide potentiates organophosphate toxicosis in chicks. Hum. Vet. Med. 3 (2), 142–149. Ali, S., Aalders, J., Richardson, M.K., 2014. Teratological effects of a panel of sixty watersoluble toxicants on zebrafish development. Zebrafish 11 (2), 129–141. Altuntas, I., Delibas, N., Doguc, D.K., Ozmen, S., Gultekin, F., 2003. Role of reactive oxygen species in organophosphate insecticide phosalone toxicity in erythrocytes in vitro. Toxicol. in Vitro 17 (2), 153–157. Akande, M.G., Aliu, Y.O., Ambali, S.F., Ayo, J.O., 2014. Taurine mitigates cognitive impairment induced by chronic co-exposure of male wistar rats to chlorpyrifos and lead acetate. Environ. Toxicol. Pharmacol. 37 (1), 315–325. Amatore, C., Arbault, S., Ferreira, D.C.M., Tapsoba, I., Verchier, Y., 2008. Vitamin C stimulates or attenuates reactive oxygen and nitrogen species (ROS, RNS) production depending on cell state: quantitative amperometric measurements of oxidative bursts at PLB-985 and RAW 264.7 cells at the single cell level. J. Electroanal. Chem. 615 (1), 34–44. Amitai, G., Moorad, D., Adani, R., Doctor, B.P., 1998. Inhibition of acetylcholinesterase and butyrylcholinesterase by chlorpyrifos-oxon. Biochem. Pharmacol. 56 (3), 293–299. Baker, M.A., Cerniglia, G.J., Zaman, A., 1990. Microtiter plate assay for the measurement of glutathione and glutathione disulfide in large numbers of biological samples. Anal. Biochem. 190 (2), 360–365. Bano, M., Bhatt, D.K., 2010. Ameliorative effect of a combination of vitamin E, vitamin C, α- lipoic acid and stilbene resveratrol on lindane induced toxicity in mice olfactory lobe and cerebrum. Indian J. Exp. Biol. 48 (2), 150–158. Bertrand, C., Chatonnet, A., Takke, C., Yan, Y., Postlethwait, J., Toutant, J.P., Cousin, X., 2001. Zebrafish acetylcholinesterase is encoded by a single gene localized on linkage group 7. Gene structure and polymorphism; molecular forms and expression pattern during development. J. Biol. Chem. 276 (1), 464–474. Bradford, M., 1976. A rapid and sensitive method for the quantification of microgram protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Chanda, S.M., Mortensen, S.R., Moser, V.C., Padilla, S., 1997. Tissue-specific effects of chlorpyrifos on carboxylesterase and cholinesterase activity in adult rats: an in vitro and in vivo comparison. Fundam. Appl. Toxicol. 38 (2), 148–157. Cook, L.W., Paradise, C.J., Lom, B., 2005. The pesticide malathion reduces survival and growth in developing zebrafish. Environ. Toxicol. Chem. 24 (7), 1745–1750. De Carvalho Corrêa, M., Maldonado, P., Saydelles da Rosa, C., Lunkes, G., Sausen-Lunkes, D., Rodrigues Kaizer, R., Ahmed, M., Morsh, V.M., Pereira, M.E., Schetinger, M.R., 2008. Oxidative stress and erythrocyte acetylcholinesterase (AChE) in hypertensive and ischemic patients of both acute and chronic stages. Biomed. Pharmacother. 62 (5), 317–324. Delwing-de Lima, D., Wollinger, L.F., Casagrande, A.C.M., Delwing, F., da Cruz, J.G.P., Wyse, A.T.S., Delwing-Dal Magro, D., 2010. Guanidino compounds inhibit acetylcholinesterase and butyrylcholinesterase activities: effect neuroprotector of vitamins E plus C. Int. J. Dev. Neurosci. 28 (6), 465–473. Ellman, G.L., Courtney, K.D., Andres, V., Featherstone, R.M., 1961. A new and rapid cholorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7, 88–95. Fraysse, B., Mons, R., Garric, J., 2006. Development of a zebrafish 4-day embryo-larval bioassay to assess toxicity of chemicals. Ecotoxicol. Environ. Saf. 63 (2), 253–267. Gonzalez, P., Baudrimont, M., Boudou, A., Bourdineaud, J.-., 2006. Comparative effects of direct cadmium contamination on gene expression in gills, liver, skeletal muscles and brain of the zebrafish (Danio rerio). Biometals 19 (3), 225–235. Helmstetter, M.F., Alden III, R.W., 1995. Passive trans-chorionic transport of toxicants in topically treated Japanese medaka (Oryzias latipes) eggs. Aquat. Toxicol. 32 (1), 1–13. Jiang, Q., Zhang, W., Tan, H., Pan, D., Yang, Y., Ren, Q., Yang, J., 2014. Analysis of gene expression changes, caused by exposure to nitrite, in metabolic and antioxidant enzymes in the red claw crayfish, Cherax quadricarinatus. Ecotoxicol. Environ. Saf. 104, 423–428. Johansson, L.H., Borg, L.A.H., 1988. A spectrophotometric method for determination of catalase activity in small tissue samples. Anal. Biochem. 174 (1), 331–336. Kais, B., Schneider, K.E., Keiter, S., Henn, K., Ackermann, C., Braunbeck, T., 2013. DMSO modifies the permeability of the zebrafish (Danio rerio) chorion—implications for the fish embryo test (FET). Aquat. Toxicol. 140–141, 229–238.

G. Rodríguez-Fuentes et al. / Comparative Biochemistry and Physiology, Part C 172–173 (2015) 19–25 Kanazawa, H., Fujimoto, S., Ohara, A., 1995. Inactivation of cholinesterase by ascorbic acid in the presence of cupric ions: a possible mechanism for the inactivation of an enzyme by the metal-catalyzed oxidation system. Biol. Pharm. Bull. 18 (9), 1179–1183. Kimmel, C.B., Ballard, W.W., Kimmel, S.R., Ullmann, B., Schilling, T.F., 1995. Stages of embryonic development of the zebrafish. Dev. Dyn. 203 (3), 253–310. Kwong, T.C., 2002. Organophosphate pesticides: biochemistry and clinical toxicology. Ther. Drug Monit. 24 (1), 144–149. Li, M., Zheng, Y., Liang, H., Zou, L., Sun, J., Zhang, Y., Qin, F., Liu, S., Wang, Z., 2013. Molecular cloning and characterization of Cat, gpx1 and Cu/Zn-Sod genes in pengze crucian carp (Carassius auratus Var. Pengze) and antioxidant enzyme modulation induced by hexavalent chromium in juveniles. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 57, 310–321. Ling, S., Zhang, H., 2013. Influences of chlorpyrifos on antioxidant enzyme activities of Nilaparvata lugens. Ecotoxicol. Environ. Saf. 98, 187–190. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Ma, Y., Chapman, J., Levine, M., Polireddy, K., Drisko, J., Chen, Q., 2014. Cancer: high-dose parenteral ascorbate enhanced chemosensitivity of ovarian cancer and reduced toxicity of chemotherapy. Sci. Transl. Med. 6 (222), 222ra18. Mansour, S.A., Mossa, A.-.H., Heikal, T.M., 2009. Effects of methomyl on lipid peroxidation and antioxidant enzymes in rat erythrocytes. Toxicol. Ind. Health 25 (8), 557–563. Mendelsohn, A.R., Larrick, J.W., 2014. Paradoxical effects of antioxidants on cancer. Rejuvenation Res. 217 (3), 306–311. Molochkina, E.M., Zorina, O.M., Fatkullina, L.D., Goloschapov, A.N., Burlakova, E.B., 2005. H2O2 modifies membrane structure and activity of acetylcholinesterase. Chem. Biol. Interact. 157–158, 401–404. Negro, C.L., Senkman, L.E., Marino, F., Lorenzatti, E., Collins, P., 2014. Effects of chlorpyrifos and endosulfan on different life stages of the freshwater burrowing crab Zilchiopsis collastinensis P.: protective role of chorion. Bull. Environ. Contam. Toxicol. 92 (6), 625–630. Ojha, A., Srivastava, N., 2012. Redox imbalance in rat tissues exposed with organophosphate pesticides and therapeutic potential of antioxidant vitamins. Ecotoxicol. Environ. Saf. 75, 230–241. OECD, 1998. Test No. 212: Fish, Short-term Toxicity Test on Embryo and Sac-Fry Stages. OECD Guidelines for the Testing of Chemicals, Section 2. OECD Publishing. Özkan, F., Gündüz, S.G., Berköz, M., Hunt, A.Ö., Yalin, S., 2012. The protective role of ascorbic acid (vitamin C) against chlorpyrifos-induced oxidative stress in Oreochromis niloticus. Fish Physiol. Biochem. 38 (3), 635–643. Pamanji, R., Bethu, M.S., Yashwanth, B., Leelavathi, S., Venkateswara Rao, J., 2015. Developmental toxic effects of monocrotophos, an organophosphorous pesticide, on zebrafish (Danio rerio) embryos. Environ. Sci. Pollut. Res. http://dx.doi.org/10. 1007/s11356-015-4120-8 (in press). Pepperell, J.R., Porterfield, D.M., Keefe, D.L., Behrman, H.R., Smith, P.J.S., 2003. Control of ascorbic acid efflux in rat luteal cells: role of intracellular calcium and oxygen radicals. Am. J. Physiol. Cell Physiol. 285, C642–C651 (3 54-3). Pond, A.L., Chambers, H.W., Coyne, C.P., Chambers, J.E., 1998. Purification of two rat hepatic proteins with A-esterase activity toward chlorpyrifos-oxon and paraoxon. J. Pharmacol. Exp. Ther. 286 (3), 1404–1411. Possamai, F.P., Fortunato, J.J., Feier, G., Agostinho, F.R., Quevedo, J., Wilhelm Filho, D., Dal-Pizzol, F., 2007. Oxidative stress after acute and sub-chronic malathion intoxication in wistar rats. Environ. Toxicol. Pharmacol. 23 (2), 198–204. Rahimi, R., Nikfar, S., Abdollahi, M., 2006. Increased morbidity and mortality in acute human organophosphate-poisoned patients treated by oximes: a meta-analysis of clinical trials. Hum. Exp. Toxicol. 25 (3), 157–162.

25

Rico, E.P., Rosemberg, D.B., Dias, R.D., Bogo, M.R., Bonan, C.D., 2007. Ethanol alters acetylcholinesterase activity and gene expression in zebrafish brain. Toxicol. Lett. 174 (1-3), 25–30. Rodríguez-Fuentes, G., Armstrong, J., Schlenk, D., 2008. Characterization of muscle cholinesterases from two demersal flatfish collected near a municipal wastewater outfall in Southern California. Ecotoxicol. Environ. Saf. 69 (3), 466–471. Saulsbury, M.D., Heyliger, S.O., Wang, K., Johnson, D.J., 2009. Chlorpyrifos induces oxidative stress in oligodendrocyte progenitor cells. Toxicology 259 (1-2), 1–9. Schallreuter, K.U., Elwary, S., 2007. Hydrogen peroxide regulates the cholinergic signal in a concentration dependent manner. Life Sci. 80 (24-25), 2221–2226. Schallreuter, K.U., Elwary, S.M.A., Gibbons, N.C.J., Rokos, H., Wood, J.M., 2004. Activation/deactivation of acetylcholinesterase by H2O2: More evidence for oxidative stress in vitiligo. Biochem. Biophys. Res. Commun. 315 (2), 502–508. Schulte, C., Nagel, R., 1994. Testing acute toxicity in the embryo of zebrafish, brachydanio rerio, as an alternative to the acute fish test: preliminary results. ATLA (Altern. Lab. Anim.) 22 (1), 12–19 (Internet). Segner, H., 2009. Zebrafish (Danio rerio) as a model organism for investigating endocrine disruption. Comp. Biochem. Physiol. C 149 (2), 187–195. Shi, X., Zhou, B., 2010. The role of Nrf2 and MAPK pathways in PFOS-induced oxidative stress in zebrafish embryos. Toxicol. Sci. 115 (2), 391–400. Shih, T.M., McDonough Jr., J.H., 1997. Neurochemical mechanisms in soman-induced seizures. J. Appl. Toxicol. 17 (4), 255–264. Shadnia, S., Azizi, E., Hosseini, R., Khoei, S., Fouladdel, S., Pajoumand, A., Jalali, N., Abdollahi, M., 2005. Evaluation of oxidative stress and genotoxicity in organophosphorus insecticide formulators. Hum. Exp. Toxicol. 24 (9), 439–445. Sureda, A., Batle, J.M., Tauler, P., Ferrer, M.D., Tur, J.A., Pons, A., 2006. Vitamin C supplementation influences the antioxidant response and nitric oxide handling of erythrocytes and lymphocytes to diving apnea. Eur. J. Clin. Nutr. 60 (7), 838–846. Tang, J., Cao, Y., Rose, R.L., Brimfield, A.A., Dai, D., Goldstein, J.A., Hodgson, E., 2001. Metabolism of chlorpyrifos by human cytochrome p450 isoforms and human, mouse, and rat liver microsomes. Drug Metab. Dispos. 29 (9), 1201–1204. Tilton, F.A., Bammler, T.K., Gallagher, E.P., 2011. Swimming impairment and acetylcholinesterase inhibition in zebrafish exposed to copper or chlorpyrifos separately, or as mixtures. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 153 (1), 9–16. Tomkins, B.A., Ilgner, R.H., 2002. Determination of atrazine and four organophosphorus pesticides in ground water using solid phase microextraction (SPME) followed by gas chromatography with selected-ion monitoring. J. Chromatogr. A 972, 183–194. Verma, R.S., Mehta, A., Srivastava, N., 2007. In vivo chlorpyrifos induced oxidative stress: attenuation by antioxidant vitamins. Pestic. Biochem. Physiol. 88 (2), 191–196. Westerfield, M., 2000. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Danio Rerio). University of Oregon Press, Eugene, OR, USA. Woo, S., Yum, S., Kim, D., Park, H., 2009. Transcripts level responses in a marine medaka (Oryzias javanicus) exposed to organophosphorus pesticide. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 149, 427–432. Wu, Y., Zhou, Q., 2012. Dose and time-related changes in aerobic metabolism, chorionic disruption and oxidative stress in embryonic medaka (Oryzias latipes): underlying mechanisms for silver nanoparticle developmental toxicity. Aquat. Toxicol. 124–125, 238–246. Yang, D., Lauridsen, H., Buels, K., Chi, L.H., La Du, J., Bruun, D.A., Tanguay, R.L., Lein, P.J., 2011. Chlorpyrifos-oxon disrupts zebrafish axonal growth and motor behavior. Toxicol. Sci. 121 (1), 146–159. Yen, J., Donerly, S., Levin, E.D., Linney, E.A., 2011. Differential acetylcholinesterase inhibition of chlorpyrifos, diazinon and parathion in larval zebrafish. Neurotoxicol. Teratol. 33 (6), 735–741.