ARTICLE IN PRESS Research in Veterinary Science ■■ (2014) ■■–■■
Contents lists available at ScienceDirect
Research in Veterinary Science j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / r v s c
Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene Dongxu Liu a, Huijun Lu b, Kun Shi a, Fengyan Su a, Jianming Li a, Rui Du a,* a b
College of Chinese Medicine Material, Jilin Agricultural University, Changchun 130118, China Institute of Military Veterinary, Academy of Military Medical Sciences, Changchun 130122, China
A R T I C L E
I N F O
Article history: Received 21 January 2014 Accepted 3 July 2014 Keywords: BVDV Antigen site Recombinant BCG vaccine Immunogenicity
A B S T R A C T
To develop a vaccine to prevent diseases caused by Mycobacterium tuberculosis and bovine viral diarrhea virus (BVDV) simultaneously, recombinant Bacillus Calmette–Guerin (rBCG) vaccines expressing different regions of the BVDV E2 gene were constructed. Using DNASTAR 6.0 software, potential antigenic epitopes were predicted, and six regions were chosen to generate recombinant plasmids with the pMV361 vector (pMV361-E2-1, pMV361-E2-2, pMV361-E2-3, pMV361-E2-4, pMV361-E2-5 and pMV361E2-6, respectively). The recombinant plasmids were transformed into BCG, and protein expression was thermally induced at 45 °C. Mice were immunized with 5 × 106 CFU/200 μL of each rBCG strain. Compared with other groups, BVDV E2 specific antibody titers were higher in mice immunized with rBCGE2-6. Ratios and numbers of CD4+, CD8+ and IL-12 expressing spleen lymphocytes of the rBCG-E2-6 group also were higher than those of other groups. Thus, the rBCG-E2-6 vaccine showed the highest immunogenicity of all groups based on the humoral and cellular responses to vaccination. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Tuberculosis in cattle is a zoonotic disease caused by the Mycobacterium tuberculosis complex (Cosivi et al., 1995; de la Rua-Domenech, 2006; Grange, 2001). This disease, which causes significant mortality, can result in low production and constraints in international trade of animals. In the past few years, the cattle population has expanded rapidly worldwide, especially in China (Fuller et al., 2006). The Bacillus Calmette–Guerin vaccine (BCG) is a live, attenuated strain of Mycobacterium bovis used widely for tuberculosis prophylaxis (Dietrich et al., 2003). Because it is well established as being safe, immunogenic, inexpensive and amenable to genetic manipulation, BCG has, over the last decade, received considerable attention as a heterologous antigen delivery system. A wide range of bacterial, viral, parasite, allergen and immunomodulatory genes has been expressed in BCG (Ohara and Yamada, 2001) as recombinants to assess for vaccine or therapeutic potential. With advances in Mycobacterium molecular biology and gene engineering technology, recombinant BCG (rBCG) is now a widely used vector in the development of prophylaxis and therapy of many diseases (Bastos et al., 2009). Bovine viral diarrhea virus (BVDV), a pestivirus, is also an important pathogen in the cattle industry. BVDV associated disease involves the respiratory, enteric, reproductive, immune and endo-
* Corresponding author. Tel.: +86 431 84510946; fax: 86 431 89297888. E-mail address: [email protected] (R. Du).
crine systems (Baker, 1987, 1995; Bolin, 1995; Radostits and Littlejohns, 1988). Currently, various types of vaccines including live attenuated and inactivated vaccines are used to immunize animals against BVDV. However, these vaccines may cause a variety of adverse reactions. For example, the current generations of live attenuated vaccines are unsafe for use in pregnant and persistently infected cattle (Roeder and Harkness, 1986). As BVDV and TB are often coincident, a preventative vaccine targeting both causative viruses in a co-infected animal would be highly desirable, but such a vaccine has not been reported thus far. The E2 protein of BVDV is immunodominant and the target protein of choice in research strategies for new prophylactic vaccines against this virus. In fact, examination of the E2 gene expression and immunogenicity has been a key focus in the study of pestiviruses (Liang et al., 2006). This protein is composed of 374 or 375 amino acid (aa) residues and is located in the open reading frame from nucleotides 2077 to 3198. A previous study showed that the E2 protein contains 19 Cys residues and five conserved glycosylation sites in different BVDV strains. However, this protein has generally high variability, indicating that it contributes to the ability of BVDV to easily adapt to the host microenvironment and maintain a persistent infection. Thus, vaccines, especially live vectors, constructed with optimized E2 gene epitopes would provide a new exploratory direction in the effort to prevent BVDV. The objective of this study was to construct a vaccine to prevent both M. tuberculosis and BVDV diseases. Six antigenic sites based on the BVDV E2 gene were predicted, and corresponding recombinant plasmids were constructed in the pMV361 vector. The six
http://dx.doi.org/10.1016/j.rvsc.2014.07.004 0034-5288/© 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
2
E2 protein derived antigens were expressed in BCG, and their immunogenicities were evaluated in mice. 2. Materials and methods 2.1. Cells, viruses, animals and vector
Table 1 The primers of BVDV E2 gene. Primer
Sequence
Site
Length
primer F1 primer F2 primer D1 primer D2 primer D3
GCCGAATTCCTCCCA GCCTGTAAACCT GCCGAATTCGTGTGGTGTA AAGATGGAGAG GCGATCGATTTA GAAGGTACATGCCGTC GCGATCGATTTACAGCAGGGACTCAGCG GCGATCGATTTAACCTAAGGTCGTTTGTTCTGA
1–27 136–166 864–891 1008–1035 1090–1122
27 30 28 28 33
Madin-Darby bovine kidney (MDBK) cells were purchased from the China Institute of Veterinary Drug Control. The BVDV Changchun 184 strain was isolated and provided by Youmin Li (Academy of Military Medical Sciences, Changchun, China). The pMV361 vector and BCG was a gift from Xichen Zhang of Jilin University, Changchun, China. All restriction enzymes and the Expand High Fidelity Taq were purchased from TakaRa Biological Ltd (Japan). All cloned genes were confirmed by sequencing at Sangon Biological Engineering Technology & Services Co., Ltd (Shaghai, China). Pathogenfree BALB/c mice were obtained from the Laboratory Animal Research Center, Second Military Medical University (Shanghai, China). The animals were housed at the animal facility of Jilin Agricultural University. The animals were managed by using welfare animal practices.
of the peptide sequence. The forward primer introduced an EcoRI restriction site in the 5′ region, and the reverse primer introduced a ClaI restriction site in the 3′ region. Six E2 gene fragments encoding the optimal epitopes for expression were PCR amplified using the pMD-18T-E2 plasmid as template with the following primer pairs (fragment names are in brackets): primers F1 and D1 (E2-1), primers F1 and D2 (E2-2), primers F1 and D3 (E2-3), primers F2 and D1 (E24), primers F2 and D2 (E2-5), primers F2 and D3 (E2-6). The six purified PCR products were ligated with the pMD18-T vector and confirmed as described above.
2.2. Amplification of BVDV E2 gene
2.5. Construction of recombinant expression plasmids
BVDV was propagated in MDBK cells, and the viral RNA was extracted using an RNA PCR KIT (TakaRa) for cDNA preparation. Based on the analysis of the whole E2 gene sequence of the BVDV Changchun 184 strain, specific primers were designed using the Gene Tool software. The forward primer (primer F, 5′GCCGAATTCCTCCCAGCCTGTAAACCT-3′) contained the EcoRI restriction site, and the reverse primer (primer D, 5′-GCGATCGATTTA ACCTAAGGTCGTTTGTTCTGA-3′) contained the ClaI restriction site. The reaction was carried out using the following conditions: predenaturation at 94 °C for 2 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 62 °C for 30 s, synthesis at 72 °C for 80 s, and the final elongation step for 7 min at 72 °C.
The positive plasmids were double digested with EcoRI and ClaI, and the fragments were ligated overnight at 16 °C with the pMV361 plasmid (Fig. 1), which had been digested by the same enzymes. The ligated products were electrotransformed into BCG. The transformed BCGs were plated on 7H9 agar and cultured at 37 °C for 2 weeks (Song and Niederweis, 2007). After screening the transformants by PCR restriction enzyme digestion, the positive recombinant plasmids were designated as pMV361-E2, pMV361-E21, pMV361-E2-2, pMV361-E2-3, pMV361-E2-4, pMV361-E2-5 and pMV361-E2-6.
2.3. Cloning and identification of PCR products
The recombinant plasmids were transformed into BCG by electrotransformation with the following parameters: voltage 2.0 KV, capacitor 25 uF, resistor 1000 Ω. The transformed bacteria were plated on 7H9 agar containing 25 μg/ml of kanamycin. The positive colonies were designated as rBCG-E2-1, rBCG-E2-2, rBCG-E23, rBCG-E2-4, rBCG-E2-5 and rBCG-E2-6. Transformants were picked with a sterilized toothpick and transferred into 7H9 medium containing kanamycin at the concentration of 25 μg/ml and cultured at 37 °C with shaking (125 r/min). When the OD600 reached about 0.6–1.0, the bacteria were heated at 45 °C for 2 h and harvested by centrifugation at 5000 × g for 5 min. The bacterial pellets were suspended in lysis buffer (2–3 ml/g) and lysed by ultrasonication at 60 Hz 90 times for 5 s each time to release the proteins. After centrifugation, the supernatant was collected and boiled for 10 min with the same volume of 2 × SDS sample buffer and defined experimental groups: group A, rBCG-E2-1; group B, rBCG-E2-2; group C, rBCG-E2-3; group D, rBCG-E2-4; group E, rBCG-E2-5; group F, rBCG-E2-6, control groups: group G, rBCG-empty plasmid; group H, BCG; group I, BVDV inactivated vaccine; group J, sterile saline.
The purified PCR products were ligated with the pMD18-T vector at 16 °C for 4 h. The ligated products were transformed into Escherichia coli JM 109 and selected on Luria Bertani agar containing 100 mg/L PF ampicillin (amp). After culturing overnight at 37 °C, transformants were screened by PCR and restriction enzyme digestion. The positive colonies were sequenced by Sangon, and the correct recombinant clone was designated as pMD-18T-E2. 2.4. Cloning of BVDV E2 gene fragments encoding predicted antigenic epitopes Based on the E2 gene of the BVDV Changchun 184 strain, the secondary structure of the aa sequence was predicted using DNAStar 6.0. Moreover, to provide a basis for evaluating E2 gene expression in the rBCG, a comprehensive analysis was carried out using the Kyte–Doolittle hydrophilic program, the Emini protein surface possibility program, the Karplus–Sohulz flexible protein prediction program and the Jameson–Wolf antigenic index program. The Neural Network (NN) approach was used to predict the E2 protein signal peptide, and the Hidden Markov Model (HMM) of the Signal P3.0 Server software was used to analyze the deduced aa sequence of the amplified E2 gene. The protein transmembrance region also was predicted using the TMHMM Server v.2.0 software, and its homology was determined by multiple sequence alignment. These analyses provided a theoretical basis for the subsequent expression and packaging of the protein. Five specific primers for the E2 gene (Table 1) were designed based on the above analyses of the predicted secondary structure
2.6. Expression of recombinant protein in BCG
2.7. SDS-PAGE and Western blotting analyses of recombinant proteins The samples (post-induction samples or host bacteria alone) each were mixed with an equal volume of 2 × SDS sample buffer and resolved through a polyacrylamide gel (5% stacking and 12% resolving) using a standard SDS-PAGE protocol. After PAGE, the proteins were electrotransferred onto a nitrocellulose membrane and incubated with blocking buffer for 1 h at room temperature and then
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
3
Fig. 1. BCG integrative expression vector pMV361.
overnight at 4 °C without washing. Thereafter, the membrane was washed two times with PBST for 10 min each time, followed by incubation with the bovine anti-BVDV polyclonal antibody overnight at 4 °C. The membrane was then incubated for 1 h with horseradish peroxidase-conjugated goat anti-bovine IgG at room temperature after thorough washing. The membrane was washed as described above and then developed by chemiluminescence with DAB substrate.
2.8. Preparation of inactivated BVDV and recombinant BCG vaccine expressing E2 antigenic peptides Single positive clones of the BCG strain (containing pMV361E2-1, pMV361-E2-2, pMV361-E2-3, pMV361-E2-4, pMV361-E2-5 or pMV361-E2-6), BCG transformed with the empty pMV361 plasmid and non-transformed BCG were picked with a sterilized toothpick and transferred into 7H9 medium containing kanamycin at the concentration of 25 μg/ml, and cultured at 37 °C with shaking (125 r/ min). When the OD600 reached about 1.0, the bacteria were harvested by centrifugation at 4000 × g for 10 min. The bacterial pellets were diluted with sterile saline to 5 × 106 CFU/ml. For preparation of inactivated BVDV, the virus was propagated in MDBK cells and treated with formalin. The BVDV inactivated vaccine was diluted with sterile saline to a concentration equivalent to 100 TCID50 before use.
2.9. Animal immunization schedule One hundred and twenty BALB/c mice were randomly divided into ten groups and housed separately. Each group included the same number of male and female mice. The antigen was used for immunization in Table 2. The mice were each immunized three times on day 0, 14 and 28. Before the first immunization, blood was collected from the tail vein of all mice. Retro-orbital blood samples were collected from three mice of each group before the second and the third immunizations. Finally, retro-orbital samples were collected from all mice
Table 2 Immunization schedule for the different groups. Groups
Inoculation
Dose per mouse
Group A Group B Group C Group D Group E Group F Group G Group H Group I Group J
rBCG-E2-1 rBCG-E2-2 rBCG-E2-3 rBCG-E2-4 rBCG-E2-5 rBCG-E2-6 pMV361 BCG BVDV inactivated vaccine Sterile saline
5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 200 μL (contain 200 μg antigen) 200 μL
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
4
two weeks after the third immunization. All blood samples were centrifuged to obtain serum. The BVDV Changchun strains were purified as antigens to immunize mice. On day 10 after the third immunization, blood was collected from the mice for detection of serum BVDV antibody titers by ELISA. For analysis of serum BVDV antibody, the ELISA was carried out in a 96-well plate (Corning Costar, NY) that had been incubated with 100 μL/well of purified BVDV (10 mg/L) diluted 1:3200 in PBS (PH 7.4). The plates were incubated at 4 °C overnight and blocked with 1% bovine serum albumin (BSA) in PBS for 2 h at 37 °C. The wells were then washed with PBS containing 0.3% BSA and 0.05% Tween 20 (PBS-T) and incubated with the serum from the mice (1:800 diluted, 100 μL/well) for 2 h at 37 °C. After washing three times, the plates were incubated with the secondary antibody horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Sangon) diluted 1:2000 in PBS containing 0.2% BSA. After washing, the substrate containing 3,3′,5,5′-tetramethylbenzidine and H2O2 was added and the plates were incubated at 37 °C for 15 min, then H2SO4 was added to stop the reaction, and the absorbance was measured at 490 nm. 2.10. Immune lymphocyte proliferation experiments in mice Retro-orbital blood was collected, and the spleen was removed aseptically from mice in each group on day 14 after the third immunization. The spleen was ground in RPMI 1640 medium, and the cell suspension was added slowly to a centrifuge tube containing a lymphocyte separation reagent. After centrifugation, the white cell layer was collected, treated with red blood cell lysis buffer and washed before scintillation counting. Cells were suspended at a concentration of 5 × 106/ml in RPMI 1640 and added to flat-bottomed 96-well plates, each well 100 uL. Cells were stimulated for 4 h with concanavalin A (Con A) and 4 h with MTT. Finally, the stimulation index was calculated by measuring the absorbance with a microplate reader at 570 nm. 2.11. Flow cytometry analysis Mouse spleen cells were counted and resuspended in FACS medium after washing twice, followed by incubation with monoclonal fluorescently labeled anti-mouse antibodies CD4+-FITC, CD8+PE and IL-12-PE separately at 4 °C in the dark for 1 h. Thereafter, the samples were washed with FACS medium and then mixed with paraformaldehyde before analysis by flow cytometry. 3. Results 3.1. Cloning of E2 recombinant plasmid A 1125 bp fragment was amplified from BVDV cDNA using the primer pair F/D. The purified PCR products were ligated with the pMD18-T vector and transformed into E. coli JM 109. PCR of DNA extracted from a positive colony detected the presence of a 1,125 bp DNA fragment (Fig. 2). Sequencing analysis confirmed that the gene was consistent with the original E2 sequence, sharing 99.6% identity with that of the BVDV Changchun 184 strain in Genbank. 3.2. Prediction of secondary structure, antigenic epitopes, signal peptide and transmembrane region of the E2 protein The E2 protein was predicted by using DNAStar, and the single parameter analysis showed a high antigenic index with 17 epitope regions. By contrast, the Emini program predicted E2 surface antigenic peptides in 20 regions. While antigenic peptides forecasted by DNAMAN and the Jameson–Wolf program were different, the an-
Fig. 2. Electrophoregram of E2 gene PCR amplified from the pMV361-E2 recombinant plasmid: lane 1, negative control; lane 2, E2 PCR product; M, DL2000 marker.
tigenic indexes were all high in the 41–43, 90–95, 193–196, 224– 229, 291–293 and 331–335 aa segments (Fig. 3). These segments may be associated with antigen clusters on the secondary structure. The aa sequence of the E2 gene was deduced by the NN method, and the 359 N-terminal residues were predicted to be the signal peptide sequence, with the cleavage site between aa 359–360 in a hydrophobic segment of the E2 protein (Fig. 4). Further analysis using the TMHMM Server v.2.0 software suggested that the E2 protein transmembrane helix region is located between aa 345–367. Characterization of the E2 protein also indicated that the transmembrane hydrophobic region of this protein may be affected by the removal of the C-terminus. Thus, three locations were selected as C-terminal ends for the various E2 recombinant antigen constructs: fulllength site 374, transmembrane region site 345 and C-terminal truncation site 297. In addition, some recombinant constructs were designed with deletion of the 45 aa low antigen index sequence of the N-terminus. Based on these five selected sites, five primers were designed: D1, D2, D3, F1and F2 (Fig. 5). 3.3. Construction of recombinant E2 epitope plasmids Using the pMD-18T-E2 plasmid as template, different E2 gene fragments were amplified by the six designed primer pairs and inserted into the pMV361 vector. The resulting recombinant plasmids were transformed into BCG. Analyses by PCR and double restriction enzyme digestion with EcoRI and ClaI of DNA from single transformed colonies showed that the expected DNA fragments were obtained (891, 1035, 1122, 755, 899 and 986 bp) (Fig. 6) 3.4. SDS-PAGE and Western blot analysis The six plasmids carrying different E2 fragments obtained above were transformed into BCG. Expression of the recombinant fusion
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
5
Fig. 3. Bioinformatic analysis of BVDV Changchun 184 E2 protein. The hydrophilicity profile, surface probability and antigenicity index along the length of the protein are shown.
protein from each strain, predicted with a molecular weight of 37.7 (rBCG-E2-1), 43.9 (rBCG-E2-2), 47.5 (rBCG-E2-3), 32.2 (rBCG-E24), 38.3 (rBCG-E2-5) or 41.9 (rBCG-E2-6) kDa, was induced at 45 °C. Samples from rBCG containing different E2 gene fragments were
separated by SDS–PAGE, and the expected bands of the recombinant proteins were observed by Coomassie Brilliant Blue staining (Fig. 7a), as well as Western blot analysis using BVDV anti-serum (Fig. 7b).
Fig. 4. Signal peptide prediction of BVDV Changchun 184 E2 protein (SignaLP-NN).
Fig. 5. Schematic diagram of primer sites corresponding to segments of the recombinant BVDV E2 protein.
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
6
a
b
Fig. 6. Confirmation of six E2 recombinant plasmids by restriction enzyme digestion. Shown are products of double enzyme digestion of the indicated plasmids and corresponding E2 gene fragment sizes: lane 1, pMV361-E2-1, 891 bp; lane 2, pMV361E2-2, 1035 bp; lane 3, pMV361-E2-3,1122 bp; lane 4, pMV361-E2-4, 755 bp; lane 5, pMV361-E2-5, 899 bp; lane 6, pMV361-E2-6, 986 bp; M1, DL15000 marker; M2, DL2000 marker.
3.5. Determination of BVDV specific serum antibody titers of immunized mice by ELISA Serum samples collected from mice immunized with the various rBCG strains as described in Materials and methods were analyzed for BVDV reactivity by ELISA. As shown by OD values of each group, BVDV serum antibody titers of immunized mice were low after the initial immunization but increased after the second inoculation (Table 3). BVDV serum antibodies of immunized mice was low after the initial immunization but increased with time and number of immunizations. On day 14 post-immunization, the BVDV antibody levels of group I was higher than those of other groups. On day 42, the BVDV antibody levels of groups A and B increased significantly, higher than those of groups G, H and J. Groups C, D, E and F also produced significant immune responses, with trending upward and plateauing by day 42, but always presenting higher than those of groups G, H and J. 3.6. Analysis the changes of CD4+, CD8+ and IL-12 expressing mouse spleen lymphocytes Spleens from immunized mice were resected in a sterile environment, and single-cell spleen lymphocyte suspensions were prepared. After labeling with monoclonal fluorescently labeled antimouse antibodies, changes in the numbers of CD4+, CD8+ and IL12 expressing spleen lymphocytes were analyzed by flow cytometry (Fig. 8). The results suggested that cellular immunogenicity induced by rBCG-E2-6 was greater than that of the other groups. 4. Discussion The BCG vaccine has been used worldwide with demonstrated immunogenicity and safety. As an intracellular parasitic bacterium, it can enter phagocytes, multiply in phagosomes of macrophages. The specific capacity of extracellular proteins to induce immune responses has made rBCG based vaccines attractive, as the foreign protein would be secreted from the bacterium. An optimal vector is a key factor in the development of rBCG vaccines. The first step to building an rBCG vaccine is constructing the E. coli-mycobacterial shuttle vector. Generally speaking, the development of BCG vectors has gone through three stages. In 1988, the
Fig. 7. E2 antigen expression by rBCG. (a) Analysis of rBCG by 12% SDS–PAGE. Lane 1, rBCG-E2-1; lane 2, rBCG-E2-2; lane 3, rBCG-E2-3; lane 4, rBCG-E2-4; lane 5, rBCGE2-5; lane 6, rBCG-E2-6; M, protein molecular mass standards; lane 7, empty vector. (b) Analysis by Western blotting using BVDV anti-serum. Lane 1, rBCG-E2-1; lane 2, rBCG-E2-2; lane 3, rBCG-E2-3; lane 4, rBCG-E2-4; lane 5, rBCG-E2-5; lane 6, rBCGE2-6; lane 7, empty vector.
DNA sequence of the mycobacterial plasmid pAL 5000 was first reported (Rauzier et al., 1988). Based on this sequence, the Mycobacterium origin of replication, oriM, was determined, and a recombinant plasmid was obtained by ligation of Mycobacterium phage DNA with an E. coli plasmid. This recombinant plasmid propogated in E. coli was transformed into Mycobacterium smegmatis to obtain a recombinant phage, which was the first generation E. colimycobacterial shuttle vector. This vector served not only as a plasmid for replicating in E. coli, but also as a phage for replicating in mycobacteria. However, due to excessive molecules, lack of antibiotic selection and instability in BCG, the first generation vector was not suitable for the introduction and expression of exogenous antigens in mycobacteria. In 1991, a second generation E. colimycobacterial shuttle vector, pMV261, was constructed (Stover et al., 1991), which provided multiple improvements over the first generation vector, including the Aph gene as a resistance selection marker, E. coli plasmid replicon ori, M. tuberculosis heat shock protein promoter, polyclonal restriction sites and transcriptional terminator. Thereafter, Stover et al. also constructed an integrated expression vector, pMV361. While the pMV261 replication in Mycobacterium depends on the DNA fragment of the Mycobacteriophage LS attachment site (attP) and the integrase-encoding gene (int), the pMV361 vector when transformed into BCG is integrated into the chromosomal attB site by site-specific integration. As representatives of the second generation of E. coli-mycobacterial shuttle vectors,
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS
J
group A, rBCG-E2-1; group B, rBCG-E2-2; group C, rBCG-E2-3; group D, rBCG-E2-4; group E, rBCG-E2-5; group F, rBCG-E2-6; group G, pMV36; group H, BCG; group I, BVDV inactivated vaccine; group J, sterile saline . The result of antibody analysis of immunized mice showed that after the initial immunization, serum antibodies of the immunized mice was lower, but with the increase in the number of immune and immune time prolonged, serum antibody levels showed an upward trend .On the fourteenth day after mice immunization, the BVDV antibody levels of group I was higher than other group. On the forty-second day, the BVDV antibody levels of group A and group B increased significantly and their levels were higher than the group G, group H and group J. Group C, group D, group E and Group F also produced significant immune response, its upward trend to flat at the fortysecond day, but their was always higher than Group G, group H and group J. Values are presented as the means ± S.D. based on three independent experiments. * Representatives difference compared with the saline group were significantly (p < 0.05). ** Representatives the more significant differences compared to the saline group (p < 0.01).
0.0432 ± 0.0156 0.4768 ± 0.0010** 0.5674 ± 0.0051** 0.6752 ± 0.0033**
I H
0.0485 ± 0.0161 0.0684 ± 0.0018** 0.0829 ± 0.0029** 0.1047 ± 0.0030** 0.0451 ± 0.0272 0.1268 ± 0.0023** 0.1247 ± 0.0044** 0.0897 ± 0.0032*
G F
0.0468 ± 0.0135 0.3745 ± 0.0039** 0.6438 ± 0.0047** 0.7102 ± 0.0115** 0.0471 ± 0.0131 0.2875 ± 0.0056** 0.4467 ± 0.0012** 0.5653 ± 0.0221*
E D
0.0473 ± 0.0121 0.3890 ± 0.0153* 0.5643 ± 0.0068** 0.7689 ± 0.0098** 0.0458 ± 0.0193 0.3106 ± 0.0102** 0.4932 ± 0.0117** 0.7208 ± 0.0108** 0.0431 ± 0.0132 0.4389 ± 0.0212* 0.5525 ± 0.0130** 0.8354 ± 0.0158** 0.0467 ± 0.0382 0.4571 ± 0.0312* 0.5378 ± 0.0515* 0.8567 ± 0.0370*
C B A
0 14 28 42
OD Day
Table 3 BDV Antibody responses in mouse after immunization (OD490).
0.0432 ± 0.0457 0.0476 ± 0.0017 0.0465 ± 0.0018 0.0479 ± 0.0013
D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
7
pMV261 and pMV361 are suitable for introduction of exogenous genes and expression in M. tuberculosis. Using these shuttle vectors, exogenous genes of multiple pathogens, including bacteria, viruses and parasites, can be expressed under control of the HSP60 and HSP70 promoters (Winter et al., 1991). Prior to the current experiments, E2 was inserted into the E. colimycobacterial shuttle expression vectors pMV361 and pMV261 to compare the immunogenicity of the resulting recombinant shuttle plasmids pMV361-E2 and pMV261-E2. These plasmids were electrotransformed into BCG to generate E2 expressing rBCG vaccines. After thermal induction, the expressed product of the E2 gene in the recombinant BCG vaccines were detected as 44 kDa proteins by SDS-PAGE and Western blot, which was consistent with the expected size of the BVDV E2 protein. Humoral and cellular immune responses in rabbits immunized with the pMV261 and pMV361 rBCG vaccines were evaluated using indirect ELISA and the T-lymphocyte transformation test, respectively. Both groups of rabbits immunized with either of the two recombinant BCG vaccines effectively generated humoral and cellular immune responses. However, the pMV361 rBCG vaccine was superior to the pMV261 rBCG vaccine in generating humoral immunity. Therefore, the pMV361 expression vector was chosen for the current experiments. As an immunodominant protein, E2 is considered the best target protein for research in new BVDV preventative vaccines. In a previous study, an E2 gene vaccine was developed and used with two traditional BVDV inactivated vaccines to inoculate pregnant ewes, which were then challenged with homologous viral strains (Christianne, 1999). The results suggested that the combined vaccines were effective in preventing infection by multiple homologous BVDV strains, and the protection rate reached 100%. A DNA vaccine expressing the E2 gene was shown to induce strong Th1-type immune responses in mice (Nobiron, 2003). Furthermore, a recombinant virus vaccine expressing E2 with the vesicular stomatitis virus signal peptide was produced successfully in BHK-21 cells (Grigera et al., 2000). In this study, three recombinant plasmids pMV361-E2-1, pMV361-E2-2 and pMV361-E2-3 were constructed to evaluate how the hydrophobic transmembrane region of the E2 protein would be affected by the removal of the C-terminus. In addition, the low antigen index at 1–45 aa of the E2 protein was removed in the N-terminus in the construction of the other three recombinant plasmids pMV361-E2-4, pMV361-E2-5 and pMV361-E2-6. The single parameter bioinformatic analysis predicted a consistently high antigenic index in the aa segments of 2–8, 11–20, 32–43, 48–53, 59–64, 72–100, 102–117, 132–135, 143–148, 155–219, 224–247, 253–261, 268–274, 284–295, 301–314, 320–324 and 331–340, especially in the range between aa 143–314, which appeared to have consecutively higher scores. The epitope index was relatively high in the aa segments of 1–345, 1–374, 45–297 and 45–345. Therefore, six recombinant plasmids containing these segments were constructed with the expectation of finding previously unreported conformational epitopes which could alter the nature of the antigen and corresponding regions affected by the protein conformation. The spatial conformations of the expressed protein must be conducive to the exposure of the major antigenic cluster in order for it to be accessed by the specific antibodies. In this study, rBCG expressing predicted antigenic regions of the E2 protein were constructed. As the first report of a bivalent vaccine targeting M. tuberculosis and BVDV diseases, the results obtained here laid the foundation for a strategy to simultaneously defend against these frequently co-morbid infections in animals. Giving mice boosters with the rBCG expressing different E2 gene fragments after the optimized initial immunization could generate a strong antibody response. However, antibody titers of all rBCG groups were lower than that of the BVDV inactivated vaccine group, suggesting that the inactivated virus produced a more rapid immune
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS 8
D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
Fig. 8. CD4+, CD8+ and IL-12 expressing spleen lymphocytes from immunized mice. Group A, rBCG-E2-1; group B, rBCG-E2-2; group C, rBCG-E2-3; group D, rBCG-E2-4; group E, rBCG-E2-5; group F, rBCG-E2-6; group G, pMV361; group H, BCG; group I, BVDV inactivated vaccine; group J, sterile saline. The result of the CD4+ and IL-12 showed that the mice immunized with the rBCG-E2-6 group were significantly different from the BCG group and BVDV inactivated vaccine group. The result of the CD8+ showed that the mice immunized with the rBCG-E2-6 group were not significantly different from the BVDV inactivated vaccine group, but significantly different from the BCG group. On average, the change of CD4+, CD8+ and IL-12 expressing spleen lymphocytes of the rBCG-E2-6 group were greater than those of other test groups. Values are presented as the means ± S.D. based on three independent experiments.
response. Fourteen days after the second immunization, the BVDV specific antibody level induced by rBCG was increased but not obviously elevated. The serum antibody levels of groups A and B, which were immunized with the E2 protein lacking the transmembrane region were significantly higher than those of the other groups at 42 days post-inoculation. The BVDV antibody levels of group D were also higher, which potentially could be attributed to the antigen epitopes of the shorter E2 aa sequence expressed in BCG being more easily exposed. On day 42, protective effects of the vaccine in the A, B, D groups were slightly higher than that of the BVDV inactivated vaccine group. Apparently, the poor immunogenicity of the inactivated vaccine could not provide long-lasting protection. As an intracellular parasitic bacteria, rBCG can live long-term in vivo and sustain expression of exogenous genes, reflecting its advantages as a live vector and immunoadjuvant. The initial immune response to exogenous proteins generates low levels of serum antibodies. However, the latency to a secondary immune response is generally shortened, producing a significantly increased antigen specific antibody titer that can be maintained over a period of time, the extent of which depends on the specific antigen and inoculation protocol. Vaccination in young mice generally yields better immune effects than in adult mice, perhaps because young mice can be more easily produce interferonγ. Optimizing the immunization dose of rBCG is one of the key factors to achieving effective immune protection. Low-dose vaccination of newborn animals has been found to produce better immunogenicity than with high-dose vaccination. In addition, the protective effect of low-dose immunization is maintained for a long time, while the immune protection afforded by high-dose immunization in young animals is relatively weak. The reason for this difference is unclear, and it may be attributed to age-related immune tolerance in the animals. In this study, rBCG immunized mice were shown to produce BVDV specific humoral and cellular immune responses, indicating the feasibility of this vaccine approach. In future studies, a comprehensive and in-depth analysis of the immune effects of E2-expressing rBCG is warranted, particularly in cattle, sheep, deer, camels and pigs which are all susceptible to infection by BVDV. As the immunized mice in this study were only monitored for a relatively short time after inoculation, long-term protection will need to be evaluated in subsequent studies. Inoculation doses for cows and other animals are different from that for mice, and different rBCG effective immune dose would have variable impacts on the production of antibody responses. Furthermore, inoculation methods via nasal inhalation, eye droppings, intramuscular injection or subcutaneous injection,
as well as different inoculation schedules may affect cellular and humoral immunity levels. Finally, comparisons of the protective immune effects produced by rBCG-E2 and conventional BVDV vaccines (e.g., BVDV oil seepage and attenuated) on virus challenge also should be assessed further. Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (No. 30671572) References Baker, J.C., 1987. Bovine viral diarrhea virus: a review. Journal of the American Veterinary Medical Association 190, 1449–1458. Baker, J.C., 1995. The clinical manifestations of bovine viral diarrhea infection. The Veterinary Clinics of North America 11, 425–445. Bastos, R.G., Borsuk, S., Seixas, F.K., Dellagostin, O.A., 2009. Recombinant Mycobacterium bovis BCG. Vaccine doi:10.1016/j.Vaccine.2009.08.044. Bolin, S.R., 1995. Control of bovine viral diarrhea infection by use of vaccination. The Veterinary Clinics of North America 11, 616–625. Christianne, J.M., 1999. An experimental multivalent bovine virus diarrhea virus E2 subunit vaccine and two experimental conventionally inactivated vaccines induce partial fetal protection in sheep. Vaccine 17, 1983–1991. Cosivi, O., Meslin, F.X., Daborn, C.J., Grange, J.M., 1995. Epidemiology of Mycobacterium bovis infection in animals and humans, with particular reference to Africa. Revue Scientifique et Technique (International Office of Epizootics) 14, 733– 746. de la Rua-Domenech, R., 2006. Human Mycobacterium bovis infection in the United Kingdom: incidence, risks, control measures and review of the zoonotic aspects of bovine tuberculosis. Tuberculosis (Edinburgh, Scotland) 86, 77–109. Dietrich, G., Viret, J.F., Hess, J., 2003. Mycobacterium bovis BCG-based vaccines against tuberculosis: novel developments. Vaccine 21, 667–670. Fuller, F., Huang, J., Ma, H., Rozelle, S., 2006. Got milk? The rapid rise of China’s dairy sector and its future prospects. Food Policy 31, 201–205. Grange, J.M., 2001. Mycobacterium bovis infection in human beings. Tuberculosis 81, 71–77. Grigera, P.R., Marzocca, M.P., Capozzo, A.V., Buonocore, L., Donis, R.O., Rose, J.K. 2000. Presence of bovine viral diarrhea virus (MDV)E2 glycoprotein in VSV recombinant particles and induction of neutralizing MDV antibodies in mice. Virus Research 69, 3–15. Liang, R., van den Hurk, J.V., Babiuk, L.A., van Drunen Littel-van den Hurk, S., 2006. Priming with DNA encoding E2 and boosting with E2 protein formulated with CpG oligodeoxynucleotides induces strong immune responses and protection from Bovine viral diarrhea virus in cattle. The Journal of General Virology 87, 2971–2982. Nobiron, I., 2003. DNA vaccination against bovine viral diarrhoea virus induces humoral and cellular responses in cattle with evidence for protection against viral challenge. Vaccine 21, 2082–2092. Ohara, N., Yamada, T., 2001. Recombinant BCG vaccines. Vaccine 19, 4089–4098. Radostits, O.M., Littlejohns, I.R., 1988. New concepts in the pathogensis, diagnosis and control of diseases caused by the bovine viral diarrhea virus. The Canadian Veterinary Journal 29, 513–528.
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
Rauzier, J., Moniz-Pereira, J., Gicquel-Sanzey, B., 1988. Complete nucleotide sequence of pAL5000, a plasmid from Mycobacterium fortuitum. Gene 3071 (2), 315–321. Roeder, P.L., Harkness, J.W., 1986. BVD virus infection: prospects for control. The Veterinary Record 119 (6), 143–147. Song, H., Niederweis, M., 2007. Functional expression of the Flp recombinase in Mycobacterium bovis BCG. Gene 399, 112–119.
9
Stover, C.K., dela Cruz, V.F., Fuerst, T.R., Burlein, J.E., Benson, L.A., Bennett, L.T., et al., 1991. New use of BCG for recombinant vaccines. Nature 351, 456–460. Winter, N., Lagranderie, M., Rauzier, J., Timm, J., Leclerc, C., Guy, B., et al., 1991. Expression of heterologous genes in Mycobacterium bovis BCG: induction of a cellular response against HIV-1 Nef protein. Gene 109, 47– 54.
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
Contents lists available at ScienceDirect
Research in Veterinary Science j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / r v s c
Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene Dongxu Liu a, Huijun Lu b, Kun Shi a, Fengyan Su a, Jianming Li a, Rui Du a,* a b
College of Chinese Medicine Material, Jilin Agricultural University, Changchun 130118, China Institute of Military Veterinary, Academy of Military Medical Sciences, Changchun 130122, China
A R T I C L E
I N F O
Article history: Received 21 January 2014 Accepted 3 July 2014 Keywords: BVDV Antigen site Recombinant BCG vaccine Immunogenicity
A B S T R A C T
To develop a vaccine to prevent diseases caused by Mycobacterium tuberculosis and bovine viral diarrhea virus (BVDV) simultaneously, recombinant Bacillus Calmette–Guerin (rBCG) vaccines expressing different regions of the BVDV E2 gene were constructed. Using DNASTAR 6.0 software, potential antigenic epitopes were predicted, and six regions were chosen to generate recombinant plasmids with the pMV361 vector (pMV361-E2-1, pMV361-E2-2, pMV361-E2-3, pMV361-E2-4, pMV361-E2-5 and pMV361E2-6, respectively). The recombinant plasmids were transformed into BCG, and protein expression was thermally induced at 45 °C. Mice were immunized with 5 × 106 CFU/200 μL of each rBCG strain. Compared with other groups, BVDV E2 specific antibody titers were higher in mice immunized with rBCGE2-6. Ratios and numbers of CD4+, CD8+ and IL-12 expressing spleen lymphocytes of the rBCG-E2-6 group also were higher than those of other groups. Thus, the rBCG-E2-6 vaccine showed the highest immunogenicity of all groups based on the humoral and cellular responses to vaccination. © 2014 Elsevier Ltd. All rights reserved.
1. Introduction Tuberculosis in cattle is a zoonotic disease caused by the Mycobacterium tuberculosis complex (Cosivi et al., 1995; de la Rua-Domenech, 2006; Grange, 2001). This disease, which causes significant mortality, can result in low production and constraints in international trade of animals. In the past few years, the cattle population has expanded rapidly worldwide, especially in China (Fuller et al., 2006). The Bacillus Calmette–Guerin vaccine (BCG) is a live, attenuated strain of Mycobacterium bovis used widely for tuberculosis prophylaxis (Dietrich et al., 2003). Because it is well established as being safe, immunogenic, inexpensive and amenable to genetic manipulation, BCG has, over the last decade, received considerable attention as a heterologous antigen delivery system. A wide range of bacterial, viral, parasite, allergen and immunomodulatory genes has been expressed in BCG (Ohara and Yamada, 2001) as recombinants to assess for vaccine or therapeutic potential. With advances in Mycobacterium molecular biology and gene engineering technology, recombinant BCG (rBCG) is now a widely used vector in the development of prophylaxis and therapy of many diseases (Bastos et al., 2009). Bovine viral diarrhea virus (BVDV), a pestivirus, is also an important pathogen in the cattle industry. BVDV associated disease involves the respiratory, enteric, reproductive, immune and endo-
* Corresponding author. Tel.: +86 431 84510946; fax: 86 431 89297888. E-mail address: [email protected] (R. Du).
crine systems (Baker, 1987, 1995; Bolin, 1995; Radostits and Littlejohns, 1988). Currently, various types of vaccines including live attenuated and inactivated vaccines are used to immunize animals against BVDV. However, these vaccines may cause a variety of adverse reactions. For example, the current generations of live attenuated vaccines are unsafe for use in pregnant and persistently infected cattle (Roeder and Harkness, 1986). As BVDV and TB are often coincident, a preventative vaccine targeting both causative viruses in a co-infected animal would be highly desirable, but such a vaccine has not been reported thus far. The E2 protein of BVDV is immunodominant and the target protein of choice in research strategies for new prophylactic vaccines against this virus. In fact, examination of the E2 gene expression and immunogenicity has been a key focus in the study of pestiviruses (Liang et al., 2006). This protein is composed of 374 or 375 amino acid (aa) residues and is located in the open reading frame from nucleotides 2077 to 3198. A previous study showed that the E2 protein contains 19 Cys residues and five conserved glycosylation sites in different BVDV strains. However, this protein has generally high variability, indicating that it contributes to the ability of BVDV to easily adapt to the host microenvironment and maintain a persistent infection. Thus, vaccines, especially live vectors, constructed with optimized E2 gene epitopes would provide a new exploratory direction in the effort to prevent BVDV. The objective of this study was to construct a vaccine to prevent both M. tuberculosis and BVDV diseases. Six antigenic sites based on the BVDV E2 gene were predicted, and corresponding recombinant plasmids were constructed in the pMV361 vector. The six
http://dx.doi.org/10.1016/j.rvsc.2014.07.004 0034-5288/© 2014 Elsevier Ltd. All rights reserved.
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
2
E2 protein derived antigens were expressed in BCG, and their immunogenicities were evaluated in mice. 2. Materials and methods 2.1. Cells, viruses, animals and vector
Table 1 The primers of BVDV E2 gene. Primer
Sequence
Site
Length
primer F1 primer F2 primer D1 primer D2 primer D3
GCCGAATTCCTCCCA GCCTGTAAACCT GCCGAATTCGTGTGGTGTA AAGATGGAGAG GCGATCGATTTA GAAGGTACATGCCGTC GCGATCGATTTACAGCAGGGACTCAGCG GCGATCGATTTAACCTAAGGTCGTTTGTTCTGA
1–27 136–166 864–891 1008–1035 1090–1122
27 30 28 28 33
Madin-Darby bovine kidney (MDBK) cells were purchased from the China Institute of Veterinary Drug Control. The BVDV Changchun 184 strain was isolated and provided by Youmin Li (Academy of Military Medical Sciences, Changchun, China). The pMV361 vector and BCG was a gift from Xichen Zhang of Jilin University, Changchun, China. All restriction enzymes and the Expand High Fidelity Taq were purchased from TakaRa Biological Ltd (Japan). All cloned genes were confirmed by sequencing at Sangon Biological Engineering Technology & Services Co., Ltd (Shaghai, China). Pathogenfree BALB/c mice were obtained from the Laboratory Animal Research Center, Second Military Medical University (Shanghai, China). The animals were housed at the animal facility of Jilin Agricultural University. The animals were managed by using welfare animal practices.
of the peptide sequence. The forward primer introduced an EcoRI restriction site in the 5′ region, and the reverse primer introduced a ClaI restriction site in the 3′ region. Six E2 gene fragments encoding the optimal epitopes for expression were PCR amplified using the pMD-18T-E2 plasmid as template with the following primer pairs (fragment names are in brackets): primers F1 and D1 (E2-1), primers F1 and D2 (E2-2), primers F1 and D3 (E2-3), primers F2 and D1 (E24), primers F2 and D2 (E2-5), primers F2 and D3 (E2-6). The six purified PCR products were ligated with the pMD18-T vector and confirmed as described above.
2.2. Amplification of BVDV E2 gene
2.5. Construction of recombinant expression plasmids
BVDV was propagated in MDBK cells, and the viral RNA was extracted using an RNA PCR KIT (TakaRa) for cDNA preparation. Based on the analysis of the whole E2 gene sequence of the BVDV Changchun 184 strain, specific primers were designed using the Gene Tool software. The forward primer (primer F, 5′GCCGAATTCCTCCCAGCCTGTAAACCT-3′) contained the EcoRI restriction site, and the reverse primer (primer D, 5′-GCGATCGATTTA ACCTAAGGTCGTTTGTTCTGA-3′) contained the ClaI restriction site. The reaction was carried out using the following conditions: predenaturation at 94 °C for 2 min, followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 62 °C for 30 s, synthesis at 72 °C for 80 s, and the final elongation step for 7 min at 72 °C.
The positive plasmids were double digested with EcoRI and ClaI, and the fragments were ligated overnight at 16 °C with the pMV361 plasmid (Fig. 1), which had been digested by the same enzymes. The ligated products were electrotransformed into BCG. The transformed BCGs were plated on 7H9 agar and cultured at 37 °C for 2 weeks (Song and Niederweis, 2007). After screening the transformants by PCR restriction enzyme digestion, the positive recombinant plasmids were designated as pMV361-E2, pMV361-E21, pMV361-E2-2, pMV361-E2-3, pMV361-E2-4, pMV361-E2-5 and pMV361-E2-6.
2.3. Cloning and identification of PCR products
The recombinant plasmids were transformed into BCG by electrotransformation with the following parameters: voltage 2.0 KV, capacitor 25 uF, resistor 1000 Ω. The transformed bacteria were plated on 7H9 agar containing 25 μg/ml of kanamycin. The positive colonies were designated as rBCG-E2-1, rBCG-E2-2, rBCG-E23, rBCG-E2-4, rBCG-E2-5 and rBCG-E2-6. Transformants were picked with a sterilized toothpick and transferred into 7H9 medium containing kanamycin at the concentration of 25 μg/ml and cultured at 37 °C with shaking (125 r/min). When the OD600 reached about 0.6–1.0, the bacteria were heated at 45 °C for 2 h and harvested by centrifugation at 5000 × g for 5 min. The bacterial pellets were suspended in lysis buffer (2–3 ml/g) and lysed by ultrasonication at 60 Hz 90 times for 5 s each time to release the proteins. After centrifugation, the supernatant was collected and boiled for 10 min with the same volume of 2 × SDS sample buffer and defined experimental groups: group A, rBCG-E2-1; group B, rBCG-E2-2; group C, rBCG-E2-3; group D, rBCG-E2-4; group E, rBCG-E2-5; group F, rBCG-E2-6, control groups: group G, rBCG-empty plasmid; group H, BCG; group I, BVDV inactivated vaccine; group J, sterile saline.
The purified PCR products were ligated with the pMD18-T vector at 16 °C for 4 h. The ligated products were transformed into Escherichia coli JM 109 and selected on Luria Bertani agar containing 100 mg/L PF ampicillin (amp). After culturing overnight at 37 °C, transformants were screened by PCR and restriction enzyme digestion. The positive colonies were sequenced by Sangon, and the correct recombinant clone was designated as pMD-18T-E2. 2.4. Cloning of BVDV E2 gene fragments encoding predicted antigenic epitopes Based on the E2 gene of the BVDV Changchun 184 strain, the secondary structure of the aa sequence was predicted using DNAStar 6.0. Moreover, to provide a basis for evaluating E2 gene expression in the rBCG, a comprehensive analysis was carried out using the Kyte–Doolittle hydrophilic program, the Emini protein surface possibility program, the Karplus–Sohulz flexible protein prediction program and the Jameson–Wolf antigenic index program. The Neural Network (NN) approach was used to predict the E2 protein signal peptide, and the Hidden Markov Model (HMM) of the Signal P3.0 Server software was used to analyze the deduced aa sequence of the amplified E2 gene. The protein transmembrance region also was predicted using the TMHMM Server v.2.0 software, and its homology was determined by multiple sequence alignment. These analyses provided a theoretical basis for the subsequent expression and packaging of the protein. Five specific primers for the E2 gene (Table 1) were designed based on the above analyses of the predicted secondary structure
2.6. Expression of recombinant protein in BCG
2.7. SDS-PAGE and Western blotting analyses of recombinant proteins The samples (post-induction samples or host bacteria alone) each were mixed with an equal volume of 2 × SDS sample buffer and resolved through a polyacrylamide gel (5% stacking and 12% resolving) using a standard SDS-PAGE protocol. After PAGE, the proteins were electrotransferred onto a nitrocellulose membrane and incubated with blocking buffer for 1 h at room temperature and then
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
3
Fig. 1. BCG integrative expression vector pMV361.
overnight at 4 °C without washing. Thereafter, the membrane was washed two times with PBST for 10 min each time, followed by incubation with the bovine anti-BVDV polyclonal antibody overnight at 4 °C. The membrane was then incubated for 1 h with horseradish peroxidase-conjugated goat anti-bovine IgG at room temperature after thorough washing. The membrane was washed as described above and then developed by chemiluminescence with DAB substrate.
2.8. Preparation of inactivated BVDV and recombinant BCG vaccine expressing E2 antigenic peptides Single positive clones of the BCG strain (containing pMV361E2-1, pMV361-E2-2, pMV361-E2-3, pMV361-E2-4, pMV361-E2-5 or pMV361-E2-6), BCG transformed with the empty pMV361 plasmid and non-transformed BCG were picked with a sterilized toothpick and transferred into 7H9 medium containing kanamycin at the concentration of 25 μg/ml, and cultured at 37 °C with shaking (125 r/ min). When the OD600 reached about 1.0, the bacteria were harvested by centrifugation at 4000 × g for 10 min. The bacterial pellets were diluted with sterile saline to 5 × 106 CFU/ml. For preparation of inactivated BVDV, the virus was propagated in MDBK cells and treated with formalin. The BVDV inactivated vaccine was diluted with sterile saline to a concentration equivalent to 100 TCID50 before use.
2.9. Animal immunization schedule One hundred and twenty BALB/c mice were randomly divided into ten groups and housed separately. Each group included the same number of male and female mice. The antigen was used for immunization in Table 2. The mice were each immunized three times on day 0, 14 and 28. Before the first immunization, blood was collected from the tail vein of all mice. Retro-orbital blood samples were collected from three mice of each group before the second and the third immunizations. Finally, retro-orbital samples were collected from all mice
Table 2 Immunization schedule for the different groups. Groups
Inoculation
Dose per mouse
Group A Group B Group C Group D Group E Group F Group G Group H Group I Group J
rBCG-E2-1 rBCG-E2-2 rBCG-E2-3 rBCG-E2-4 rBCG-E2-5 rBCG-E2-6 pMV361 BCG BVDV inactivated vaccine Sterile saline
5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 5 × 106CFU/200 μL 200 μL (contain 200 μg antigen) 200 μL
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
4
two weeks after the third immunization. All blood samples were centrifuged to obtain serum. The BVDV Changchun strains were purified as antigens to immunize mice. On day 10 after the third immunization, blood was collected from the mice for detection of serum BVDV antibody titers by ELISA. For analysis of serum BVDV antibody, the ELISA was carried out in a 96-well plate (Corning Costar, NY) that had been incubated with 100 μL/well of purified BVDV (10 mg/L) diluted 1:3200 in PBS (PH 7.4). The plates were incubated at 4 °C overnight and blocked with 1% bovine serum albumin (BSA) in PBS for 2 h at 37 °C. The wells were then washed with PBS containing 0.3% BSA and 0.05% Tween 20 (PBS-T) and incubated with the serum from the mice (1:800 diluted, 100 μL/well) for 2 h at 37 °C. After washing three times, the plates were incubated with the secondary antibody horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Sangon) diluted 1:2000 in PBS containing 0.2% BSA. After washing, the substrate containing 3,3′,5,5′-tetramethylbenzidine and H2O2 was added and the plates were incubated at 37 °C for 15 min, then H2SO4 was added to stop the reaction, and the absorbance was measured at 490 nm. 2.10. Immune lymphocyte proliferation experiments in mice Retro-orbital blood was collected, and the spleen was removed aseptically from mice in each group on day 14 after the third immunization. The spleen was ground in RPMI 1640 medium, and the cell suspension was added slowly to a centrifuge tube containing a lymphocyte separation reagent. After centrifugation, the white cell layer was collected, treated with red blood cell lysis buffer and washed before scintillation counting. Cells were suspended at a concentration of 5 × 106/ml in RPMI 1640 and added to flat-bottomed 96-well plates, each well 100 uL. Cells were stimulated for 4 h with concanavalin A (Con A) and 4 h with MTT. Finally, the stimulation index was calculated by measuring the absorbance with a microplate reader at 570 nm. 2.11. Flow cytometry analysis Mouse spleen cells were counted and resuspended in FACS medium after washing twice, followed by incubation with monoclonal fluorescently labeled anti-mouse antibodies CD4+-FITC, CD8+PE and IL-12-PE separately at 4 °C in the dark for 1 h. Thereafter, the samples were washed with FACS medium and then mixed with paraformaldehyde before analysis by flow cytometry. 3. Results 3.1. Cloning of E2 recombinant plasmid A 1125 bp fragment was amplified from BVDV cDNA using the primer pair F/D. The purified PCR products were ligated with the pMD18-T vector and transformed into E. coli JM 109. PCR of DNA extracted from a positive colony detected the presence of a 1,125 bp DNA fragment (Fig. 2). Sequencing analysis confirmed that the gene was consistent with the original E2 sequence, sharing 99.6% identity with that of the BVDV Changchun 184 strain in Genbank. 3.2. Prediction of secondary structure, antigenic epitopes, signal peptide and transmembrane region of the E2 protein The E2 protein was predicted by using DNAStar, and the single parameter analysis showed a high antigenic index with 17 epitope regions. By contrast, the Emini program predicted E2 surface antigenic peptides in 20 regions. While antigenic peptides forecasted by DNAMAN and the Jameson–Wolf program were different, the an-
Fig. 2. Electrophoregram of E2 gene PCR amplified from the pMV361-E2 recombinant plasmid: lane 1, negative control; lane 2, E2 PCR product; M, DL2000 marker.
tigenic indexes were all high in the 41–43, 90–95, 193–196, 224– 229, 291–293 and 331–335 aa segments (Fig. 3). These segments may be associated with antigen clusters on the secondary structure. The aa sequence of the E2 gene was deduced by the NN method, and the 359 N-terminal residues were predicted to be the signal peptide sequence, with the cleavage site between aa 359–360 in a hydrophobic segment of the E2 protein (Fig. 4). Further analysis using the TMHMM Server v.2.0 software suggested that the E2 protein transmembrane helix region is located between aa 345–367. Characterization of the E2 protein also indicated that the transmembrane hydrophobic region of this protein may be affected by the removal of the C-terminus. Thus, three locations were selected as C-terminal ends for the various E2 recombinant antigen constructs: fulllength site 374, transmembrane region site 345 and C-terminal truncation site 297. In addition, some recombinant constructs were designed with deletion of the 45 aa low antigen index sequence of the N-terminus. Based on these five selected sites, five primers were designed: D1, D2, D3, F1and F2 (Fig. 5). 3.3. Construction of recombinant E2 epitope plasmids Using the pMD-18T-E2 plasmid as template, different E2 gene fragments were amplified by the six designed primer pairs and inserted into the pMV361 vector. The resulting recombinant plasmids were transformed into BCG. Analyses by PCR and double restriction enzyme digestion with EcoRI and ClaI of DNA from single transformed colonies showed that the expected DNA fragments were obtained (891, 1035, 1122, 755, 899 and 986 bp) (Fig. 6) 3.4. SDS-PAGE and Western blot analysis The six plasmids carrying different E2 fragments obtained above were transformed into BCG. Expression of the recombinant fusion
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
5
Fig. 3. Bioinformatic analysis of BVDV Changchun 184 E2 protein. The hydrophilicity profile, surface probability and antigenicity index along the length of the protein are shown.
protein from each strain, predicted with a molecular weight of 37.7 (rBCG-E2-1), 43.9 (rBCG-E2-2), 47.5 (rBCG-E2-3), 32.2 (rBCG-E24), 38.3 (rBCG-E2-5) or 41.9 (rBCG-E2-6) kDa, was induced at 45 °C. Samples from rBCG containing different E2 gene fragments were
separated by SDS–PAGE, and the expected bands of the recombinant proteins were observed by Coomassie Brilliant Blue staining (Fig. 7a), as well as Western blot analysis using BVDV anti-serum (Fig. 7b).
Fig. 4. Signal peptide prediction of BVDV Changchun 184 E2 protein (SignaLP-NN).
Fig. 5. Schematic diagram of primer sites corresponding to segments of the recombinant BVDV E2 protein.
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
6
a
b
Fig. 6. Confirmation of six E2 recombinant plasmids by restriction enzyme digestion. Shown are products of double enzyme digestion of the indicated plasmids and corresponding E2 gene fragment sizes: lane 1, pMV361-E2-1, 891 bp; lane 2, pMV361E2-2, 1035 bp; lane 3, pMV361-E2-3,1122 bp; lane 4, pMV361-E2-4, 755 bp; lane 5, pMV361-E2-5, 899 bp; lane 6, pMV361-E2-6, 986 bp; M1, DL15000 marker; M2, DL2000 marker.
3.5. Determination of BVDV specific serum antibody titers of immunized mice by ELISA Serum samples collected from mice immunized with the various rBCG strains as described in Materials and methods were analyzed for BVDV reactivity by ELISA. As shown by OD values of each group, BVDV serum antibody titers of immunized mice were low after the initial immunization but increased after the second inoculation (Table 3). BVDV serum antibodies of immunized mice was low after the initial immunization but increased with time and number of immunizations. On day 14 post-immunization, the BVDV antibody levels of group I was higher than those of other groups. On day 42, the BVDV antibody levels of groups A and B increased significantly, higher than those of groups G, H and J. Groups C, D, E and F also produced significant immune responses, with trending upward and plateauing by day 42, but always presenting higher than those of groups G, H and J. 3.6. Analysis the changes of CD4+, CD8+ and IL-12 expressing mouse spleen lymphocytes Spleens from immunized mice were resected in a sterile environment, and single-cell spleen lymphocyte suspensions were prepared. After labeling with monoclonal fluorescently labeled antimouse antibodies, changes in the numbers of CD4+, CD8+ and IL12 expressing spleen lymphocytes were analyzed by flow cytometry (Fig. 8). The results suggested that cellular immunogenicity induced by rBCG-E2-6 was greater than that of the other groups. 4. Discussion The BCG vaccine has been used worldwide with demonstrated immunogenicity and safety. As an intracellular parasitic bacterium, it can enter phagocytes, multiply in phagosomes of macrophages. The specific capacity of extracellular proteins to induce immune responses has made rBCG based vaccines attractive, as the foreign protein would be secreted from the bacterium. An optimal vector is a key factor in the development of rBCG vaccines. The first step to building an rBCG vaccine is constructing the E. coli-mycobacterial shuttle vector. Generally speaking, the development of BCG vectors has gone through three stages. In 1988, the
Fig. 7. E2 antigen expression by rBCG. (a) Analysis of rBCG by 12% SDS–PAGE. Lane 1, rBCG-E2-1; lane 2, rBCG-E2-2; lane 3, rBCG-E2-3; lane 4, rBCG-E2-4; lane 5, rBCGE2-5; lane 6, rBCG-E2-6; M, protein molecular mass standards; lane 7, empty vector. (b) Analysis by Western blotting using BVDV anti-serum. Lane 1, rBCG-E2-1; lane 2, rBCG-E2-2; lane 3, rBCG-E2-3; lane 4, rBCG-E2-4; lane 5, rBCG-E2-5; lane 6, rBCGE2-6; lane 7, empty vector.
DNA sequence of the mycobacterial plasmid pAL 5000 was first reported (Rauzier et al., 1988). Based on this sequence, the Mycobacterium origin of replication, oriM, was determined, and a recombinant plasmid was obtained by ligation of Mycobacterium phage DNA with an E. coli plasmid. This recombinant plasmid propogated in E. coli was transformed into Mycobacterium smegmatis to obtain a recombinant phage, which was the first generation E. colimycobacterial shuttle vector. This vector served not only as a plasmid for replicating in E. coli, but also as a phage for replicating in mycobacteria. However, due to excessive molecules, lack of antibiotic selection and instability in BCG, the first generation vector was not suitable for the introduction and expression of exogenous antigens in mycobacteria. In 1991, a second generation E. colimycobacterial shuttle vector, pMV261, was constructed (Stover et al., 1991), which provided multiple improvements over the first generation vector, including the Aph gene as a resistance selection marker, E. coli plasmid replicon ori, M. tuberculosis heat shock protein promoter, polyclonal restriction sites and transcriptional terminator. Thereafter, Stover et al. also constructed an integrated expression vector, pMV361. While the pMV261 replication in Mycobacterium depends on the DNA fragment of the Mycobacteriophage LS attachment site (attP) and the integrase-encoding gene (int), the pMV361 vector when transformed into BCG is integrated into the chromosomal attB site by site-specific integration. As representatives of the second generation of E. coli-mycobacterial shuttle vectors,
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS
J
group A, rBCG-E2-1; group B, rBCG-E2-2; group C, rBCG-E2-3; group D, rBCG-E2-4; group E, rBCG-E2-5; group F, rBCG-E2-6; group G, pMV36; group H, BCG; group I, BVDV inactivated vaccine; group J, sterile saline . The result of antibody analysis of immunized mice showed that after the initial immunization, serum antibodies of the immunized mice was lower, but with the increase in the number of immune and immune time prolonged, serum antibody levels showed an upward trend .On the fourteenth day after mice immunization, the BVDV antibody levels of group I was higher than other group. On the forty-second day, the BVDV antibody levels of group A and group B increased significantly and their levels were higher than the group G, group H and group J. Group C, group D, group E and Group F also produced significant immune response, its upward trend to flat at the fortysecond day, but their was always higher than Group G, group H and group J. Values are presented as the means ± S.D. based on three independent experiments. * Representatives difference compared with the saline group were significantly (p < 0.05). ** Representatives the more significant differences compared to the saline group (p < 0.01).
0.0432 ± 0.0156 0.4768 ± 0.0010** 0.5674 ± 0.0051** 0.6752 ± 0.0033**
I H
0.0485 ± 0.0161 0.0684 ± 0.0018** 0.0829 ± 0.0029** 0.1047 ± 0.0030** 0.0451 ± 0.0272 0.1268 ± 0.0023** 0.1247 ± 0.0044** 0.0897 ± 0.0032*
G F
0.0468 ± 0.0135 0.3745 ± 0.0039** 0.6438 ± 0.0047** 0.7102 ± 0.0115** 0.0471 ± 0.0131 0.2875 ± 0.0056** 0.4467 ± 0.0012** 0.5653 ± 0.0221*
E D
0.0473 ± 0.0121 0.3890 ± 0.0153* 0.5643 ± 0.0068** 0.7689 ± 0.0098** 0.0458 ± 0.0193 0.3106 ± 0.0102** 0.4932 ± 0.0117** 0.7208 ± 0.0108** 0.0431 ± 0.0132 0.4389 ± 0.0212* 0.5525 ± 0.0130** 0.8354 ± 0.0158** 0.0467 ± 0.0382 0.4571 ± 0.0312* 0.5378 ± 0.0515* 0.8567 ± 0.0370*
C B A
0 14 28 42
OD Day
Table 3 BDV Antibody responses in mouse after immunization (OD490).
0.0432 ± 0.0457 0.0476 ± 0.0017 0.0465 ± 0.0018 0.0479 ± 0.0013
D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
7
pMV261 and pMV361 are suitable for introduction of exogenous genes and expression in M. tuberculosis. Using these shuttle vectors, exogenous genes of multiple pathogens, including bacteria, viruses and parasites, can be expressed under control of the HSP60 and HSP70 promoters (Winter et al., 1991). Prior to the current experiments, E2 was inserted into the E. colimycobacterial shuttle expression vectors pMV361 and pMV261 to compare the immunogenicity of the resulting recombinant shuttle plasmids pMV361-E2 and pMV261-E2. These plasmids were electrotransformed into BCG to generate E2 expressing rBCG vaccines. After thermal induction, the expressed product of the E2 gene in the recombinant BCG vaccines were detected as 44 kDa proteins by SDS-PAGE and Western blot, which was consistent with the expected size of the BVDV E2 protein. Humoral and cellular immune responses in rabbits immunized with the pMV261 and pMV361 rBCG vaccines were evaluated using indirect ELISA and the T-lymphocyte transformation test, respectively. Both groups of rabbits immunized with either of the two recombinant BCG vaccines effectively generated humoral and cellular immune responses. However, the pMV361 rBCG vaccine was superior to the pMV261 rBCG vaccine in generating humoral immunity. Therefore, the pMV361 expression vector was chosen for the current experiments. As an immunodominant protein, E2 is considered the best target protein for research in new BVDV preventative vaccines. In a previous study, an E2 gene vaccine was developed and used with two traditional BVDV inactivated vaccines to inoculate pregnant ewes, which were then challenged with homologous viral strains (Christianne, 1999). The results suggested that the combined vaccines were effective in preventing infection by multiple homologous BVDV strains, and the protection rate reached 100%. A DNA vaccine expressing the E2 gene was shown to induce strong Th1-type immune responses in mice (Nobiron, 2003). Furthermore, a recombinant virus vaccine expressing E2 with the vesicular stomatitis virus signal peptide was produced successfully in BHK-21 cells (Grigera et al., 2000). In this study, three recombinant plasmids pMV361-E2-1, pMV361-E2-2 and pMV361-E2-3 were constructed to evaluate how the hydrophobic transmembrane region of the E2 protein would be affected by the removal of the C-terminus. In addition, the low antigen index at 1–45 aa of the E2 protein was removed in the N-terminus in the construction of the other three recombinant plasmids pMV361-E2-4, pMV361-E2-5 and pMV361-E2-6. The single parameter bioinformatic analysis predicted a consistently high antigenic index in the aa segments of 2–8, 11–20, 32–43, 48–53, 59–64, 72–100, 102–117, 132–135, 143–148, 155–219, 224–247, 253–261, 268–274, 284–295, 301–314, 320–324 and 331–340, especially in the range between aa 143–314, which appeared to have consecutively higher scores. The epitope index was relatively high in the aa segments of 1–345, 1–374, 45–297 and 45–345. Therefore, six recombinant plasmids containing these segments were constructed with the expectation of finding previously unreported conformational epitopes which could alter the nature of the antigen and corresponding regions affected by the protein conformation. The spatial conformations of the expressed protein must be conducive to the exposure of the major antigenic cluster in order for it to be accessed by the specific antibodies. In this study, rBCG expressing predicted antigenic regions of the E2 protein were constructed. As the first report of a bivalent vaccine targeting M. tuberculosis and BVDV diseases, the results obtained here laid the foundation for a strategy to simultaneously defend against these frequently co-morbid infections in animals. Giving mice boosters with the rBCG expressing different E2 gene fragments after the optimized initial immunization could generate a strong antibody response. However, antibody titers of all rBCG groups were lower than that of the BVDV inactivated vaccine group, suggesting that the inactivated virus produced a more rapid immune
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS 8
D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
Fig. 8. CD4+, CD8+ and IL-12 expressing spleen lymphocytes from immunized mice. Group A, rBCG-E2-1; group B, rBCG-E2-2; group C, rBCG-E2-3; group D, rBCG-E2-4; group E, rBCG-E2-5; group F, rBCG-E2-6; group G, pMV361; group H, BCG; group I, BVDV inactivated vaccine; group J, sterile saline. The result of the CD4+ and IL-12 showed that the mice immunized with the rBCG-E2-6 group were significantly different from the BCG group and BVDV inactivated vaccine group. The result of the CD8+ showed that the mice immunized with the rBCG-E2-6 group were not significantly different from the BVDV inactivated vaccine group, but significantly different from the BCG group. On average, the change of CD4+, CD8+ and IL-12 expressing spleen lymphocytes of the rBCG-E2-6 group were greater than those of other test groups. Values are presented as the means ± S.D. based on three independent experiments.
response. Fourteen days after the second immunization, the BVDV specific antibody level induced by rBCG was increased but not obviously elevated. The serum antibody levels of groups A and B, which were immunized with the E2 protein lacking the transmembrane region were significantly higher than those of the other groups at 42 days post-inoculation. The BVDV antibody levels of group D were also higher, which potentially could be attributed to the antigen epitopes of the shorter E2 aa sequence expressed in BCG being more easily exposed. On day 42, protective effects of the vaccine in the A, B, D groups were slightly higher than that of the BVDV inactivated vaccine group. Apparently, the poor immunogenicity of the inactivated vaccine could not provide long-lasting protection. As an intracellular parasitic bacteria, rBCG can live long-term in vivo and sustain expression of exogenous genes, reflecting its advantages as a live vector and immunoadjuvant. The initial immune response to exogenous proteins generates low levels of serum antibodies. However, the latency to a secondary immune response is generally shortened, producing a significantly increased antigen specific antibody titer that can be maintained over a period of time, the extent of which depends on the specific antigen and inoculation protocol. Vaccination in young mice generally yields better immune effects than in adult mice, perhaps because young mice can be more easily produce interferonγ. Optimizing the immunization dose of rBCG is one of the key factors to achieving effective immune protection. Low-dose vaccination of newborn animals has been found to produce better immunogenicity than with high-dose vaccination. In addition, the protective effect of low-dose immunization is maintained for a long time, while the immune protection afforded by high-dose immunization in young animals is relatively weak. The reason for this difference is unclear, and it may be attributed to age-related immune tolerance in the animals. In this study, rBCG immunized mice were shown to produce BVDV specific humoral and cellular immune responses, indicating the feasibility of this vaccine approach. In future studies, a comprehensive and in-depth analysis of the immune effects of E2-expressing rBCG is warranted, particularly in cattle, sheep, deer, camels and pigs which are all susceptible to infection by BVDV. As the immunized mice in this study were only monitored for a relatively short time after inoculation, long-term protection will need to be evaluated in subsequent studies. Inoculation doses for cows and other animals are different from that for mice, and different rBCG effective immune dose would have variable impacts on the production of antibody responses. Furthermore, inoculation methods via nasal inhalation, eye droppings, intramuscular injection or subcutaneous injection,
as well as different inoculation schedules may affect cellular and humoral immunity levels. Finally, comparisons of the protective immune effects produced by rBCG-E2 and conventional BVDV vaccines (e.g., BVDV oil seepage and attenuated) on virus challenge also should be assessed further. Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (No. 30671572) References Baker, J.C., 1987. Bovine viral diarrhea virus: a review. Journal of the American Veterinary Medical Association 190, 1449–1458. Baker, J.C., 1995. The clinical manifestations of bovine viral diarrhea infection. The Veterinary Clinics of North America 11, 425–445. Bastos, R.G., Borsuk, S., Seixas, F.K., Dellagostin, O.A., 2009. Recombinant Mycobacterium bovis BCG. Vaccine doi:10.1016/j.Vaccine.2009.08.044. Bolin, S.R., 1995. Control of bovine viral diarrhea infection by use of vaccination. The Veterinary Clinics of North America 11, 616–625. Christianne, J.M., 1999. An experimental multivalent bovine virus diarrhea virus E2 subunit vaccine and two experimental conventionally inactivated vaccines induce partial fetal protection in sheep. Vaccine 17, 1983–1991. Cosivi, O., Meslin, F.X., Daborn, C.J., Grange, J.M., 1995. Epidemiology of Mycobacterium bovis infection in animals and humans, with particular reference to Africa. Revue Scientifique et Technique (International Office of Epizootics) 14, 733– 746. de la Rua-Domenech, R., 2006. Human Mycobacterium bovis infection in the United Kingdom: incidence, risks, control measures and review of the zoonotic aspects of bovine tuberculosis. Tuberculosis (Edinburgh, Scotland) 86, 77–109. Dietrich, G., Viret, J.F., Hess, J., 2003. Mycobacterium bovis BCG-based vaccines against tuberculosis: novel developments. Vaccine 21, 667–670. Fuller, F., Huang, J., Ma, H., Rozelle, S., 2006. Got milk? The rapid rise of China’s dairy sector and its future prospects. Food Policy 31, 201–205. Grange, J.M., 2001. Mycobacterium bovis infection in human beings. Tuberculosis 81, 71–77. Grigera, P.R., Marzocca, M.P., Capozzo, A.V., Buonocore, L., Donis, R.O., Rose, J.K. 2000. Presence of bovine viral diarrhea virus (MDV)E2 glycoprotein in VSV recombinant particles and induction of neutralizing MDV antibodies in mice. Virus Research 69, 3–15. Liang, R., van den Hurk, J.V., Babiuk, L.A., van Drunen Littel-van den Hurk, S., 2006. Priming with DNA encoding E2 and boosting with E2 protein formulated with CpG oligodeoxynucleotides induces strong immune responses and protection from Bovine viral diarrhea virus in cattle. The Journal of General Virology 87, 2971–2982. Nobiron, I., 2003. DNA vaccination against bovine viral diarrhoea virus induces humoral and cellular responses in cattle with evidence for protection against viral challenge. Vaccine 21, 2082–2092. Ohara, N., Yamada, T., 2001. Recombinant BCG vaccines. Vaccine 19, 4089–4098. Radostits, O.M., Littlejohns, I.R., 1988. New concepts in the pathogensis, diagnosis and control of diseases caused by the bovine viral diarrhea virus. The Canadian Veterinary Journal 29, 513–528.
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
ARTICLE IN PRESS D. Liu et al./Research in Veterinary Science ■■ (2014) ■■–■■
Rauzier, J., Moniz-Pereira, J., Gicquel-Sanzey, B., 1988. Complete nucleotide sequence of pAL5000, a plasmid from Mycobacterium fortuitum. Gene 3071 (2), 315–321. Roeder, P.L., Harkness, J.W., 1986. BVD virus infection: prospects for control. The Veterinary Record 119 (6), 143–147. Song, H., Niederweis, M., 2007. Functional expression of the Flp recombinase in Mycobacterium bovis BCG. Gene 399, 112–119.
9
Stover, C.K., dela Cruz, V.F., Fuerst, T.R., Burlein, J.E., Benson, L.A., Bennett, L.T., et al., 1991. New use of BCG for recombinant vaccines. Nature 351, 456–460. Winter, N., Lagranderie, M., Rauzier, J., Timm, J., Leclerc, C., Guy, B., et al., 1991. Expression of heterologous genes in Mycobacterium bovis BCG: induction of a cellular response against HIV-1 Nef protein. Gene 109, 47– 54.
Please cite this article in press as: Dongxu Liu, et al., Immunogenicity of recombinant BCGs expressing predicted antigenic epitopes of bovine viral diarrhea virus E2 gene, Research in Veterinary Science (2014), doi: 10.1016/j.rvsc.2014.07.004
