IJC International Journal of Cancer

IL-6 enriched lung cancer stem-like cell population by inhibition of cell cycle regulators via DNMT1 upregulation Chen-Chi Liu1,2, Jiun-Han Lin3, Tien-Wei Hsu3, Kelly Su3, Anna Fen-Yau Li4, Han-Shui Hsu3,5 and Shih-Chieh Hung1,6,7,8 1

Institute of Clinical Medicine, National Yang-Ming University School of Medicine, Taipei, Taiwan Department of Emergency, Taipei Veterans General Hospital, Taipei, Taiwan 3 Institute of Emergency and Critical Care Medicine, National Yang-Ming University School of Medicine, Taipei, Taiwan 4 Department of Pathology, Taipei Veterans General Hospital, Taipei, National Yang-Ming University School of Medicine, Taipei, Taiwan 5 Division of Thoracic Surgery, Department of Surgery, Taipei Veterans General Hospital, Taipei, Taiwan 6 Stem Cell Laboratory, Department of Medical Research and Education, Taipei Veterans General Hospital, Taipei, Taiwan 7 Institute of Pharmacology, National Yang-Ming University School of Medicine, Taipei, Taiwan 8 Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan

Tumors are influenced by a microenvironment rich in inflammatory cytokines, growth factors and chemokines, which may promote tumor growth. Interleukin-6 (IL-6) is a multifunctional cytokine and known as a regulator of immune and inflammation responses. IL-6 has also been reported to be associated with tumor progression and chemoresistance in different types of cancers. In our study, we demonstrated that IL-6 enriches the properties of lung cancer stem-like cells in A549 lung cancer cells cultured in spheroid medium. IL-6 also promotes sphere formation and stem-like properties of A549 cells by enhancing cell proliferation. Methylation-specific polymerase chain reaction (PCR) was performed and revealed that IL-6 increased methylation of p53 and p21 in A549 cancer cells. Western blot analysis and quantitative real-time PCR demonstrated that IL-6 increased the expression of DNA methyltransferase 1 (DNMT1) in A549 cells cultured in spheroid medium, but not the expression of DNMT3a or DNMT3b. Knockdown of DNMT1 eliminated IL-6-mediated hypermethylation of cell cycle regulators and enrichment of lung cancer stem-like properties. In conclusion, our study, for the first time, shows that the IL-6/JAK2/STAT3 pathway upregulates DNMT1 and enhances cancer initiation and lung cancer stem cell (CSC) proliferation by downregulation of p53 and p21 resulting from DNA hypermethylation. Upon blockage of the IL-6/JAK2/STAT3 pathway and inhibition of DNMT1, the proliferation of lung CSCs was reduced and their formation of spheres and ability to initiate tumor growth were decreased. These data suggest that targeting of the IL-6/JAK2/STAT3 signaling pathway and DNMT1 may become important strategies for treating lung cancer.

Key words: IL-6/JAK2/STAT3 pathway, DNMT1, lung cancer stem cell, proliferation Abbreviations: BCA: bicinchoninic acid; bFGF: basic fibroblastic growth factor; BrdU: bromodeoxyuridine; CDK: cyclin-dependent kinase; CSCs: cancer stem cells; DAPI: 40 ,6-diamidino-2-phenylindole; DMEM: Dulbecco’s modified Eagle’s medium; DNMT1: DNA methyltransferase 1; EGFR: epidermal growth factor receptor; EMT: epithelial mesenchymal transition; FACS: fluorescence-activated cell sorting; FBS: fetal bovine serum; HDAC1: histone deacetylase 1; IL-6: interleukin-6; JAK2: Janus kinase 2; M-PER: mammalian protein extraction reagent; miRNA: microRNA; MS-PCR: methylation-specific polymerase chain reaction; NF-kB: nuclear factor-kappa B; NOD/ SCID: nonobese diabetic/severe combined immunodeficient; PBS: phosphate-buffered saline; PCR: polymerase chain reaction; PI: propidium iodide; PKB: protein kinase B; PVDF: polyvinylidene difluoride; RT-PCR: real-time polymerase chain reaction; SD: standard deviation; SDS: sodium dodecyl sulfate; shRNA: small hairpin RNA; STAT3: signal transducer and activator of transcription 3; TBST: Trisbuffered saline and Tween 20; TIMP-3: tissue inhibitor of metalloproteinase 3; TUNEL: terminal deoxynucleotidyl transferase dUTP nick end labeling Additional Supporting Information may be found in the online version of this article. Grant sponsor: Taipei Veterans General Hospital; Grant numbers: V102C-028, V102E8-005; Grant sponsor: National Science Council; Grant numbers: NSC 102-2325-B-010-009, NSC 101-2321-B-010-012, NSC 101-2314-B-010-028-MY3; Grant sponsor: Lung Cancer Foundation, Taipei DOI: 10.1002/ijc.29033 History: Received 29 Oct 2013; Accepted 13 Jun 2014; Online 20 Jun 2014 Correspondence to: Han-Shui Hsu, Division of Thoracic Surgery, Department of Surgery, Taipei Veterans General Hospital and Institute of Emergency and Critical Care Medicine, National Yang-Ming University School of Medicine, No. 155, Sec. 2, Li-Nong Street, Taipei, Taiwan, Tel.: 1886-2-28757546, Fax: 1886-2-28746193, E-mail: [email protected] or Shih-Chieh Hung, Stem Cell Laboratory, Department of Medical Research and Education, Taipei Veterans General Hospital, No. 201, Sec. 2, Shih-Pai Road, Taipei, Taiwan, Tel.: 1886-2-77368497, Fax: 1886-2-28746815, E-mail: [email protected]

C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

Cancer Cell Biology

2

2

IL-6 enriched lung cancer stem-like cell via DNMT1 upregulation

Cancer Cell Biology

What’s new? Dysregulation of interleukin-6 is implicated in the progression of lung cancer, but the mechanisms by which IL-6 may facilitate disease progression are not fully known. Here, in cell and tumor sphere models, cancer initiation and lung cancer stem cell (CSC) proliferation were enhanced by upregulation of DNA methyltransferase 1 (DNMT1) as a consequence of IL-6/JAK2/STAT3 pathway activity. DNMT1 upregulation resulted in DNA hypermethylation and downregulation of p53 and p21. Upon blockage of the IL-6/JAK2/STAT3 pathway and inhibition of DNMT1, the proliferation of lung CSCs, their formation of spheres, and their ability to initiate tumor growth decreased.

Lung cancer has become the most frequent cause of cancer death worldwide. The poor prognosis for lung cancer patients is mainly due to early relapse and metastasis following treatment with chemotherapy and radiotherapy.1 The study of cancer stem cells (CSCs) has attracted enormous attention during the past 10 years.2–11 The concept underlying the role of CSCs is that there is a specific subpopulation of tumor cells that retain the distinct stem cell properties needed to initiate tumorigenesis by undergoing self-renewal and differentiation during tumor growth. Dysregulation of CSC self-renewal is a likely requirement for the development of cancer.2–11 Understanding the origin of CSCs, the mechanisms that support the ability of CSCs to invade or metastasize and the relationship between CSCs and the microenvironment surrounding them is extremely important for improving the treatment of lung cancer.11 Tumors are influenced by a microenvironment rich in inflammatory cytokines, growth factors and chemokines, all of which may promote tumor growth.12 Also, factors produced by the tumor itself and its surrounding tissue contribute to malignant progression.13 For example, chronic inflammation triggered by smoking tobacco promotes lung tumorigenesis.14 Patients with inflammatory bowel diseases, such as ulcerative colitis and Crohn’s disease, are at increased risk of developing colorectal cancer.15 In a colitis-associated cancer mouse model, chronic inflammation was demonstrated to damage DNA and/or alter cell proliferation and survival, thereby promoting tumorigenesis.16 It was also reported that the presence of inflammation in a cell’s microenvironment can influence the stem-like characteristics of cancer cells. Jinushi et al. reported that tumor-associated macrophages increase the tumor-initiating capacity and drug resistance of CSCs through the secretion of interleukin-6 (IL6).17 In breast cancer, IL-6 enhanced conversion of breast cancer progenitor cells to a more stem-like phenotype via a positive feedback loop involving NF-kB, Lin28 and Let-7 miRNA.18,19 In brain tumors, targeting of the IL-6 receptor by using short hairpin RNAs in glioma stem cells reduced neurosphere formation capacity while increasing apoptosis.20 In lung cancer, aberrant production and increased secretion of IL-6 were implicated in the regulation of tumor growth and metastatic spread.21,22 Our previous data also demonstrated that in lung cancer, tumor initiation can be enhanced by mesenchymal stem cells through activation of the IL-6/ JAK2/STAT3 pathway.23

It has been suggested that DNA methylation plays a major role in enhancing transcriptional silence, especially in tumor suppressor genes. DNA methyltransferases (DNMTs) are responsible for the transfer of a methyl group from the universal methyl donor, S-adenosyl-L-methionine, to the 5position of the cytosine residue in DNA. There are four members of the DNMT family: DNMT1, DNMT3A, DNMT3B and DNMT3L. Dnmt3A and Dnmt3B encode de novo methyltransferases, while Dnmt1 encodes a maintenance methyltransferases, which are essential for mammalian development and reported to be associated with human tumorigenesis.24–26 Wehbe et al. investigated the effects of IL-6 on methylation-dependent gene expression and transformed cell growth in human cholangiocarcinoma, and reported that IL6 overexpression resulted in the altered expression and promoter methylation of several genes, including the gene for epidermal growth factor receptor (EGFR). Those investigators also concluded that epigenetic regulation of gene expression by IL-6 contributes to tumor progression in cholangiocarcinoma.27 There are few, if any, reports regarding the relationship between IL-6 and DNMT1. Our study demonstrates for the first time that IL-6 promotes lung CSC proliferation via inhibiting the expression of cell cycle regulators, including p53 and p21, by upregulating DNMT1 and inducing DNA hypermethylation in these genes.

Material and Methods Cancer cells and spheroid culture

The lung cancer cell lines including A549, CL1-1 and H1650 were used in our study. Cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Grand Island, NY) containing 10 U/mL penicillin, 10 lg/mL streptomycin, 2 mM glutamine and 10% fetal bovine serum (FBS; Gibco) in a 37 C humidified atmosphere with 5% CO2. For enrichment of CSCs, these lung cancer cell lines in DMEM with 10% FBS were reseeded and cultured in tumor sphere medium consisting of serum-free DMEM/F12 (Gibco), N2 supplement (Gibco), human recombinant epidermal growth factor (EGF) (20 ng/mL; PeproTech, Rocky Hill, NJ) and basic fibroblastic growth factor (bFGF) (10 ng/mL; PeproTech).2 IL-6 (10 ng/ mL; R&D Systems, Minneapolis, MN) was added into spheroid medium in experimental groups. Spheres were defined as cell colonies with a diameter >200 lm and area >50% showing three-dimensional structure and blurred cell C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

3

Liu et al.

Western blot analysis

Cell extracts were prepared with M-PER (Pierce, Rockford, IL) plus a protease inhibitor cocktail (HaltTM Pierce), and protein concentrations were determined using the bicinchoninic acid (BCA) assay (Pierce). Aliquots of protein lysates were separated on SDS–10% polyacrylamide gels and transferred to PVDF membrane filters, followed by blocking with 5% blotting grade milk (Bio-Rad, Hercules, CA) in TBST [20 mM Tris–HCl (pH 7.6), 137 mM NaCl and 1% Tween 20]. Membranes were then probed with the indicated primary antibodies [pJAK2, pSTAT3S727, DNMT1 and b-actin; Sigma, St. Louis, MO; p53, JAK2 and STAT3; Cell Signaling Technology, Beverly, MA; Nanog (H-155), Oct4 (H-134), Sox2 (H-65) and p21 (N-20); Santa Cruz Biotechnology, Santa Cruz, CA and IL-6; R&D Systems], reacted with corresponding secondary antibodies and detected using a chemiluminescence assay (Millipore, Billerica, MA). Membranes were exposed to X-ray film to visualize the bands (Amersham Pharmacia Biotech, Piscataway, NJ). TUNEL assay

For evaluating the effects of spheroid culture with/without IL-6 on chemoresistance, cells were treated with cisplatin (3.18 lM) and gemcitabine (0.74 mg/mL) for 48 hr before harvesting on day 12 of culture. Doses of cisplatin and gemcitabine were determined as previously described.28 Detection of apoptotic cells was performed on cytospin preparations and also on adherent cells cultured on chamber slides by using the TUNEL assay according to the manufacturer’s instructions (In Situ Cell Death Detection Kit; AP; Roche Molecular Biochemicals, Mannheim, Germany). In brief, cells were harvested by trypsin treatment, subjected to the TUNEL assay and visualized using a fluorescence microscope. Apoptosis of A549 cells cultured in spheroid culture with/without IL-6 was also determined by the TUNEL assay and counting the number of apoptotic cells under a fluorescence microscope. Cell proliferation assay and bromodeoxyuridine incorporation

Cell proliferation assays were conducted by measuring bromodeoxyuridine (BrdU) incorporation, which was detected by staining of nuclei with a FITC-fluorochrome-coupled monoclonal antibody. DNA content in the nuclei was determined on the basis of fluorescence intensity of propidium iodide (PI). Aliquots of 2 3 105 cells in 10-cm dishes were cultured in spheroid medium and treated with IL-6 or vehicle for 3, 6 and 12 days. After 18 hr of BrdU uptake, the cells were harvested by trypsinization and fixed in PBS with 70% ethanol at 4 C. The cells were then washed with PBS, subjected to DNA denaturation in 4 M HCl and treated with C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

serum to block nonspecific binding sites. BrdU was detected using the In Situ Cell Proliferation Kit, FLUOS (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s instructions. Cells were counterstained for 30 min at 1 C with a solution containing PI (20 lg/mL) and RNase A (100 lg/mL), filtered using a 40-mm filter (BD Biosciences, San Jose, CA) and then subjected to flow cytometric analysis. Fluorescence-activated cell sorting (FACS) analysis was performed using the FACScanto II cell sorter (BD Biosciences) equipped with a blue laser (488 nm). Debris and damaged cells were excluded by gating on a forward and side scatter dot plot. DNA content of single live cells was determined using the area parameter from PI, and the percentage of cells in each phase of the cell cycle was analyzed by FlowJo software (TreeStar, San Carlos, CA). Cells without BrdU feeding were used as controls to determine the fluorescence intensity for BrdU incorporation (FITC). 5-Methylcytosine staining

Total 5-methylcytosine levels were visualized using a monoclonal antibody against 5-methyl cytidine. Cells were fixed with 4% paraformaldehyde for 10 min at room temperature, permeabilized with 0.1% Triton X-100 for 30 min, blocked with blocking buffer (5% heat-inactivated serum and 0.1% Triton X-100 soluble in PBS) for 30 min and then incubated with antibody against 5-methyl cytidine [mouse monoclonal (33D3) to 5-methyl cytidine; Abcam] at appropriate dilutions overnight at 4 C. The cells were then washed with PBS and reacted with a secondary antibody labeled with Alexa Flour 488 (Molecular Probes, Eugene, OR). After washing with PBS, the samples were stained with DAPI for 30 sec and examined by fluorescence microscopy. To determine inhibition of DNA methylation, A549 cells cultured in spheroid culture were treated with 5-aza-20 deoxycytidine (5 lM; Sigma-Aldrich). Fresh medium containing 5-aza-20 -deoxycytidine was added every 3–4 days. Cells were harvested for further analysis on day 12 of culture. Quantitative real-time polymerase chain reaction

Total RNA was extracted using a TRIzol Kit (Invitrogen, Carlsbad, CA). RNA was reverse transcribed in a 20 lL volume using 0.5 lg of oligo dT and 200 U Superscript III RT (Invitrogen) for 30 min at 50 C, followed by 2 min at 94 C to inactivate the reverse transcriptase. For the quantitative real-time polymerase chain reaction (RT-PCR), the amplification was carried out in a total volume of 25 lL containing 0.5 lM of each primer, 12.5 lL of LightCyclerTM-FastStart DNA Master SYBR Green I (Roche Molecular Systems, Alameda, CA) and 10 lL of 1:20-diluted cDNA. PCRs were prepared in duplicate and heated to 95 C for 10 min, followed by 40 cycles of denaturation at 95 C for 15 sec, annealing at 60 C for 1 min and extension at 72 C for 20 sec. Standard curves (cycle threshold values versus template concentration) were prepared for each target gene and for the endogenous

Cancer Cell Biology

margins. Sphere formation was observed starting at day 5 of culture. Cells were harvested and protein lysates were collected on day 12 of culture for all experiments.

4

reference [glyceraldehyde 3-phosphate dehydrogenase (GAPDH)] in each sample. Quantification of unknown samples was performed using LightCycler Relative Quantification Software version 3.3 (Roche). Primer sequences are listed in Table 1.

Cancer Cell Biology

Methylation-specific PCR

For the methylation-specific PCR (MS-PCR), genomic DNA of cells was isolated using a phenol–chloroform extraction followed by ethanol precipitation. DNA was treated with sodium bisulfites as previously described.29 Briefly, 2 lg of genomic DNA was resuspended in 50 lL of water and then denatured in 2 M NaOH for 10 min at 37 C. The denatured DNA was diluted in 550 lL of freshly prepared solution containing 10 mM hydroquinone (Sigma-Aldrich) and 3 M sodium bisulfite (Sigma-Aldrich). The resultant solution was covered with mineral oil and incubated for 16 hr at 50 C. After incubation, the samples were desalted using a Wizard DNA Clean-Up System (Promega, Madison, WI) and treated with 3 M NaOH for 5 min at room temperature. Then, 66 lL of NH4OAc and 2 vol of 100% ethanol were added, and the DNA was precipitated for at least 1–2 hr at 28 C. After precipitation, the pellets were washed with 70% ethanol, dried, resuspended in 20 lL of water and stored at 220 C. The sodium bisulfite-modified DNA was amplified using a Multi GeneTM Gradient Thermal Cycler (Labnet, Edison, NJ). Primer sequences for MS-PCR are listed in Table 1. The modified genomic DNA samples were amplified using PCR in a total volume of 50 lL enclosed in a thermal cooler. Sodium bisulfite-modified DNA of A549 cells was used as the positive control for nonmethylated alleles. As a positive control for all methylated alleles, A549 cell DNA was treated in vitro with SssI methyltransferase and then subjected to sodium sulfite modification. The PCR products were separated on 2.5% agarose gels and visualized using ethidium bromide staining. Tumor xenograft mouse model

Study protocols involving mice were approved by the Institutional Animal Committee of Taipei Veterans General Hospital. Nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice were obtained from Jackson Laboratory (Bar Harbor, ME) and maintained as a clone at the BioLASCO Taiwan (Taipei, Taiwan) in specific pathogen-free conditions. The mice were used for experiments at 6–8 weeks of age. Lung cancer cells and enriched cancer stem-like cells were subcutaneously injected into mice at doses of 104, 105 and 106, respectively, per injection site. Tumor nodules usually became palpable within 2–4 weeks after cell injection. The length and width of the tumors were measured, and tumor volumes were calculated as: tumor volume 5 (length 3 width2)/2. A nodule was labeled as a tumor when its size approached 50 mm3. Absolute tumor-initiating frequency was calculated using the L-CalcTM Version 1.1 (StemCell Technologies, Vancouver, Canada).

IL-6 enriched lung cancer stem-like cell via DNMT1 upregulation

Table 1. Primers for quantitative and methylation-specific PCR study Primer name

Primer sequences

Primers for quantitative RT-PCR P53

P21

DNMT1

DNMT3a

DNMT3b

F

GGAGCCGCAGTCAGATCCTAG

R

CAAGGGGGACAGAACGTTG

F

GCCGAAGTCAGTTCCTT

R

TCATGCTGGTCTGCCGC

F

ACCGCTTCTACTTCCTCGAGGCCTA

R

GTTGCAGTCCTCTGTGAACACTGTGG

F

CGCAAAGCCATCTACGAGGTC

R

GGGATTCTTCTCTTCTTCTGGTGG

F

AATGTGAATCCAGCCAGGAAAGGC

R

ACT GGATTACACTCCAGGAACCGT

Primers for methylation-specific PCR P53-1 M

P53-1 U

P53-2 M

P53-2 U

P53-3 M

P53-3 U

P21-1 M

P21-1 U

P21-2 M

P21-2 U

P21-3 M

P21-3 U

F

TTCGGTAGGCGGATTATTTG

R

AAATATCCCCGAAACCCAAC

F

TTGGTAGGTGGATTATTTGTTT

R

CCAATCCAAAAAAACATATCAC

F

TTCGGTTTCGTGTATTTTTAGTTC

R

ACCTAAACGTTCAACTTTAAATTCG

F

GTTTTTGGTTTTGTGTATTTTTAGTTT

R

CTACCTAAACATTCAACTTTAAATTCAA

F

TTTAGTATCGCGGGTCGTTAC

R

AAAATTACCGCGAAACTCGATA

F

TTTTTTAGTATTGTGGGTTGTTAT

R

AAAATTACCACAAAACTCAATAAAA

F

TACGCGAGGTTTCGGGATC

R

CCCTAATATACAACCGCCCCG

F

GGATTGGTTGGTTTGTTGGAATTT

R

ACAACCCTAATATACAACCACCCCA

F

GTGTTTTTGCGTGTTCGC

R

CGTATACGCAAACCGAACG

F

GTGTGTTTTTGTGTGTTTGT

R

ACCATATACACAAACCAAACA

F

CGGATTCGTCGAGGTATC

R

ACGCGAACACGCTTAACT

F

GTGGATTTGTTGAGGTATT

R

CACACAAACACACTTAACT

Lentiviral vector production and cell infection

The expression plasmids and bacterial clones for DNMT1 shRNA (TRCN0000021893 and TRCN0000021891) were provided by an RNAi core facility (Academia Sinica, Taiwan). Subconfluent cells were infected with lentivirus in the presence of 8 lg/mL polybrene (Sigma-Aldrich). At 24 hr postinfection, media were removed and replaced with fresh growth media containing puromycin (4 lg/mL) to select for infected cells at 48 hr postinfection. C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

5

Liu et al.

The plasmid pcDNA-vector and pcDNA-p53 were kindly provided by Professor Yi-Ching Wang in the Department of Pharmacology, College of Medicine, National Cheng Kung University. pRcCMVp21 plasmid was purchased from Addgene (Cambridge, MA) and then subcloned into pcDNA3 plasmid. These plasmids were transfected into cells with Lipofectamine 2000 transfection reagent according to the manufacturer’s instructions (Invitrogen). After 24 hr of transfection, cells were subjected to G418 selection (600 mg/ mL) for 10 days. Statistical analysis

All values are expressed as mean 6 standard deviation (SD). The independent t-test was used for comparison of data from independent samples. A probability (p) value < 0.05 was considered statistically significant.

Results IL-6 enriches lung cancer stem-like properties in spheroid culture

A549, CL1-1 and H1650 lung cancer cells cultured in serumfree medium supplemented with EGF and FGF2 (spheroid medium) adopted sphere morphology 5 days after subculture from parental cells. Control cells consisting of lung cancer cells cultured in DMEM with 10% FBS showed no sphere morphology after 12 days (Fig. 1a and Supporting Information Fig. 1A). We defined a sphere as a cell colony with a diameter >200 mm, and the number of spheres was increased by addition of IL-6 to spheroid medium (Fig. 1a and Supporting Information Fig. 1A). Our previous studies had demonstrated that lung CSCs show increased expression of pluripotency markers and increased chemoresistance.23 Because IL-6 increased tumor sphere formation by A549 cells cultured in spheroid medium, we further investigated whether IL-6 could enhance the expression of pluripotency makers and the ability to resist chemotoxicity in cancer stem-like cells. Western blotting analysis demonstrated that increased expression of the pluripotency markers Nanog, Sox2 and Oct4 was observed in A549, CL1-1 and H1650 cells cultured in spheroid medium with IL-6, when compared to cells cultured in medium with serum, and cells cultured in spheroid medium without IL-6 (Fig. 1b and Supporting Information Fig. 1B). DNA fragmentation was assayed by the TUNEL technique to examine the effect of IL-6 on the chemoresistance of A549 cells. Results showed that apoptosis induced by a combination of cisplatin and gemcitabine was significantly reduced in A549 cells cultured in spheroid medium containing IL-6, when compared to A549 cells cultured in growth medium, and A549 cells cultured in spheroid medium without IL-6 (Fig. 1c). A549 cells cultured in spheroid medium containing IL-6 also demonstrated increased capacity to form tumors in immunodeficient mice, when compared to the bulk control cells or cells cultured in spheC 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

roid medium without IL-6 (Fig. 1d). The tumor-initiating frequency of tumor formation was significantly increased in A549 cells cultured in spheroid medium containing IL-6, compared to the bulk control cells or cells cultured in spheroid medium without IL-6 (Fig. 1d). Tumors formed by these cells had the same histomorphology and expressed the same markers as primary lung tumors (Fig. 1e), indicating that the tumors had originated from the lung cancer. These data suggest that IL-6 enriches the properties of lung cancer stem-like cells in A549 lung cancer cells cultured in spheroid medium. IL-6 enhances lung cancer cell proliferation and downregulates cell cycle regulators

We further investigated whether IL-6 could induce cell proliferation or apoptosis in the A549 cells cultured in spheroid medium. Cell cycle analysis by flow cytometry and staining with PI were performed after 3, 6 and 12 days of culture to determine DNA content. BrdU incorporation was also determined by flow cytometry and staining of nuclei with a FITCfluorochrome-coupled monoclonal antibody after 18 hr of BrdU uptake. The results showed that IL-6 increased the percentage of A549 cells in S-phase (Fig. 2a). Similarly, BrdU incorporation assay also revealed that IL-6 increased cells with BrdU incorporation in spheroid culture (Fig. 2b). Increase of S-phase percentage and cells with BrdU incorporation by IL-6 in spheroid culture was also observed in CL11 and H1650 cells (Supporting Information Fig. 2). However, IL-6 did not influence the percentage of A549 cells showing apoptosis in a spheroid culture as assayed by TUNEL staining (Fig. 2c). These data suggest that IL-6 promotes sphere formation and stem-like properties of A549 cells by enhancing cell proliferation. Western blotting analysis of p53, p21, cyclin-dependent kinase 2 (CDK2), cyclin-dependent kinase 4 (CDK4) and cyclin D1 was performed to investigate if the cell cycle and checkpoint regulators were influenced by the addition of IL6. Results showed that IL-6 inhibited the expression of p53 and p21 in lung cancer cells cultured in spheroid medium and also decreased the transcription of p53 and p21 (Fig. 2d and Supporting Information Fig. 2C); however, the expressions of CDK2, CDK4 and cyclin D1 remained unchanged (Fig. 2e). These data indicate that IL-6 enhances lung cancer cell proliferation through inhibiting tumor suppressors such as p53 and p21. Overexpression of p53 and p21 abrogates the effects of IL-6 on lung cancer cells in spheroid culture

To demonstrate IL-6 enhances cell proliferation through suppressing p53 and p21 in our study, we examined if overexpression of p53 and p21 would abrogate the effects of IL-6 on lung cancer cells in spheroid culture. Western blot analysis revealed that IL-6 still caused upregulation of DNMT1 (Fig. 3a) but did not increase sphere numbers in A549 cells with p53 or p21 overexpression (Fig. 3b). Cell cycle analysis also revealed that IL-6 did not increase the S-phase

Cancer Cell Biology

Plasmid reconstruction and transfection

IL-6 enriched lung cancer stem-like cell via DNMT1 upregulation

Cancer Cell Biology

6

Figure 1. IL-6 enriches lung cancer stem-like properties in spheroid culture. A549 lung cancer cells (1 3 105) were cultured in growth medium (DMEM with 10% FBS, CTR), or in serum-free medium supplemented with EGF and FGF2 (spheroid medium) in the absence or presence of IL-6. The number of spheres formed at 12 days of culture was calculated (mean 6 SD, n 5 3). A sphere was defined as a colony with a diameter >200 mm. (b) Western blot analysis of A549 cells cultured in growth medium or in spheroid medium in the absence or presence of IL-6 for 12 days. (c) A549 cells in (b) were recovered and treated with cisplatin (3.18 mM) and gemcitabine (0.74 mg/mL) for 48 hr, and then assayed with TUNEL staining to measure the percentage of cells undergoing apoptosis (mean 6 SD, n 5 3). (d) A549 cells in (b) were harvested and single-cell suspensions with indicated cell numbers were injected s.c. into the dorsal skin of NOD/SCID mice. (e) Histology of tumors formed by the injected cells. H&E staining revealing injected cells showed the same histomorphology and expressed the same markers as primary lung tumors, indicating that tumors were of lung cancer origin. *p < 0.05, **p < 0.01. Scale bar: 50 mm.

C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

7

Cancer Cell Biology

Liu et al.

Figure 2. IL-6 enhances lung cancer cell proliferation and downregulates cell cycle regulators. (a and b) A549 cells were cultured in growth medium or in spheroid medium in the absence or presence of IL-6. (a) Cell cycle analysis was performed after 3, 6 and 12 days of culture by flow cytometry with staining by PI to determine DNA content, and (b) BrdU incorporation was determined by flow cytometry with staining of nuclei with a FITC-fluorochrome-coupled monoclonal antibody after 18 hr of BrdU uptake. Dot plots display fluorescence intensity for BrdU incorporation (FITC, Y-axis) and DNA content (PI, X-axis), with gating to quantitate fractions of cells in S-phase. Cells with high intensity for BrdU staining are in S-phase, compared to G1-phase cells (both low PI and BrdU staining intensity) and G2-phase cells (high PI but low BrdU staining intensity). The rectangular areas are BrdU1 cells. (c) DNA fragmentation assayed by the TUNEL technique revealed that apoptosis of A549 cells in spheroid culture was not influenced by IL-6. (d and e) Western blot analysis of A549 cells cultured in spheroid medium for 12 days in the absence or presence of IL-6 (CDK2: cyclin-dependent kinase 2; CDK4; cyclin-dependent kinase 4).

percentage in A549 cells with p53 or p21 overexpression after 12 days of culture in spheroid medium (Fig. 3c). Similar data were also obtained using BrdU incorporation assay (Fig. 3d). These results suggest that IL-6 enhances cell proliferation through suppressing p53 and p21 in spheroid culture.

C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

IL-6 increases DNA methylation mainly by upregulating DNMT1

Because IL-6 enriches lung cancer stem-like properties in A549 cells cultured in spheroid medium by enhancing cell proliferation and inhibiting tumor suppressors, we continued

IL-6 enriched lung cancer stem-like cell via DNMT1 upregulation

Cancer Cell Biology

8

Figure 3. Overexpression of p53 and p21 abrogates the effects of IL-6. Western blot analysis of A549 cells with overexpression of p53 and p21 in the absence or presence of IL-6. (b) The sphere number of A549 cells with overexpression of p53 or p21 in spheroid medium with or without IL-6. (c) The results of cell cycle analysis in A549 cells with p53 or p21 overexpression after 12 days of culture by flow cytometry with staining by PI to determine DNA content. (d) BrdU incorporation was determined by flow cytometry with staining of nuclei with a FITCfluorochrome-coupled monoclonal antibody after 18 hr of BrdU uptake.

to study whether IL-6 could induce DNA hypermethylation in tumor suppressor genes, and specifically p53 and p21. A 5-methylcytosine staining study was performed and demonstrated that IL-6 increased the ratio of 5-methylcytosine/ DAPI in A549 cells cultured in spheroid medium (Fig. 4a), indicating that IL-6 increased DNA hypermethylation in these cells. MS-PCR of p53 and p21 was performed and revealed that IL-6 increased methylation of p53 and p21 (Fig. 4b). These data suggest that IL-6 downregulates p53 and p21 expression by inducing DNA methylation. Furthermore, Western blot analysis showed that in the presence of 5-aza20 -deoxycytidine, an inhibitor of DNA methylation, IL-6mediated downregulation of p53 and p21 was reversed (Fig. 4c). Staining with 5-methylcytosine also revealed that IL-6mediated DNA hypermethylation was eliminated by addition of 5-aza-20 -deoxycytidine (Fig. 4d). Because IL-6 increased DNA methylation in A549 cells cultured in spheroid medium, we further investigated which DNMTs were involved. Western blot analysis and quantitative real-time PCR demonstrated that IL-6 increased the expression of

DNMT1, but not the expression of DNMT3A or DNMT3B in A549 cells (Figs. 4e and 4f). Therefore, these results suggest that IL-6 increases DNA methylation of p53 and p21 mainly through upregulation of DNMT1. Because IL-6 can enrich lung cancer stem-like properties and inhibit cell cycle regulators by upregulating DNMT1, we further investigated the possible signaling pathways between IL-6 and DNMT1. In a previous study, we showed that mesenchymal stem cells could enhance lung cancer initiation by activating the IL-6/ JAK2/STAT3 pathway.23 Moreover, STAT3 is directly involved in the induction of DNMT1 expression via binding to the SIE/GAS sites of DNMT1 gene promoter.30 Therefore, we further investigated if this pathway is associated with DNMT1 overexpression. Western blot analysis revealed that IL-6 increased the levels of DNMT1, phospho-JAK2 and phospho-STAT3 in A549, CL1-1 and H1650 cells cultured in spheroid medium. Addition of a JAK2 inhibitor (Ag490) or a STAT3 inhibitor (S3I-201) did not increase the level of DNMT1 expression. These data indicate that in lung cancer cells cultured in a spheroid medium, IL-6 upregulates C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

9

Cancer Cell Biology

Liu et al.

Figure 4. IL-6 increases DNA methylation mainly through upregulating DNMT1. A549 cells cultured for 12 days in spheroid medium in the absence or presence of IL-6 were subjected to 5-methylcytosine/DAPI staining. The ratio of 5-methylcytosine1/DAPI1 cells (mean 6 SD, n 5 3). (b) A549 cells were cultured for 12 days in spheroid medium in the absence or presence of IL-6. DNA from cells was treated with bisulfite. Representative results obtained by methylation-specific PCR analysis of the (upper) p53 and (lower) p21 promoters are shown with “M” representing methylated and “U” nonmethylated alleles. Positive controls were A549 cell DNA samples treated with Sss1 methyltransferase and sodium sulfite modification. (c and d) A549 cells were cultured for 12 days in spheroid medium in the absence or presence of IL-6 or 5-aza-20 -deoxycytidine (Aza). Cells were subjected to (c) Western blotting analysis and (d) 5-methylcytosine staining. (e and f) A549 cells were cultured in spheroid medium for 12 days in the absence or presence of IL-6. Cells were subjected to (e) Western blotting analysis and (f) quantitative real-time PCR. (g) A549 cells were cultured in spheroid medium without or with IL-6 and in the absence or presence of a JAK2 inhibitor (Ag490) or a STAT3 inhibitor (S3I-201) for 12 days, followed by Western blot analysis. **p < 0.01. Scale bar: 50 mm. C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

IL-6 enriched lung cancer stem-like cell via DNMT1 upregulation

Cancer Cell Biology

10

Figure 5. Knockdown of DNMT1 eliminates IL-6-mediated hypermethylation of cell cycle regulators and enrichment of lung cancer stem-like properties. (a–c) A549 cells were infected with lentiviral vectors carrying control scrambled (Scr) or DNMT1-specific shRNAs (DNMT1KD), followed by puromycin selection of infected cells for 2 days. These cells were expanded and harvested for spheroid culture in the absence or presence of IL-6 for 12 days, followed by (a) Western blot analysis, (b) methylation-specific PCR and (c) cell cycle analysis and BrdU incorporation assay. (d) Numbers of spheres produced by these cells were counted. (e) These cells were recovered from sphere cultures, followed by treatment with cisplatin and gemcitabine for 48 hr. The percentages of apoptotic cells were counted (mean 6 SD, n 5 3). (f) These cells were harvested and single-cell suspensions with indicated cell numbers were injected s.c. into the dorsal skin of NOD/SCID mice. **p < 0.01.

DNMT1 by activating the JAK2/STAT3 pathway (Fig. 4g and Supporting Information Fig. 3). Knockdown of DNMT1 eliminates IL-6-mediated hypermethylation of cell cycle regulators and enrichment of lung cancer stem-like properties

Knockdown of DNMT1 (DNMT1KD) in A549 cells using lentiviral transduction was performed to confirm the role of DNMT1 in the overall effect of IL-6-mediated hypermethylation of p53 and p21 in A549 cells cultured in spheroid medium. Western blot analysis demonstrated that IL-6 increased the expression of DNMT1 and inhibited the

expression of p53 and p21 in A549 cells without DNMTKD; however, in A549 cells with DNMT1KD, the expression of p53 and p21 was not inhibited (Fig. 5a). MS-PCR revealed that IL6 increased the methylation of p53 and p21 in A549 cells without DNMTKD, but not in A549 cells with DNMT1KD (Fig. 5b). Cell cycle analysis and the BrdU incorporation assay also demonstrated that IL-6 increased the percentage of A549 cells in S-phase and the rate of BrdU incorporation in A549 cells without DNMTKD, but not in A549 cells with DNMT1KD (Fig. 5c). A sphere formation assay showed that IL-6 did not increase sphere numbers in A549 cells with DNMTKD (Fig. 5d). Also, a DNA fragmentation assay revealed that IL-6 did C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

not decrease apoptosis following combination treatment with cisplatin and gemcitabine in A549 cells with DNMT1KD (Fig. 5e). A tumor xenograft transplantation study performed in vivo showed that when mice were injected with A549 cells with IL-6 and DNMT1KD, tumor formation was not observed after 12 weeks. This result indicates that A549 cells with IL-6 and DNMT1KD had less capacity to form tumors when compared to A549 cells with IL-6, but without DNMT1KD (Fig. 5f). These data show that knockdown of DNMT1 eliminates IL-6-mediated hypermethylation of p53 and p21, and also eliminates IL-6-mediated increase in lung cancer stem-like properties.

Discussion In the 19th century, Rudolf Virchow suggested a possible link between inflammation and cancer.13 Since then, the influence of inflammation on human tumorigenesis has been intensively investigated. Some of the underlying molecular mechanisms that may link an inflammatory response with cancer formation have been elucidated. The expression of certain cytokines or chemokines in the tumor microenvironment is reported to be associated with tumor progression and patient survival.21,22 We have reported that in lung cancer, IL-6 secreted by mesenchymal stem cells enhanced tumor initiation through the IL-6/ JAK2/STAT3 pathway.23 In our study, we further demonstrated, for the first time, that IL-6 promotes the proliferation of lung CSCs by inhibiting the expression of cell cycle regulators such as p53 and p21 via upregulation of DNMT1 and DNA hypermethylation. Blockage of the IL-6/JAK2/STAT3 pathway and inhibition of DNMT1 reduced the proliferation of lung CSCs, and also their ability to form spheres and initiate tumors. These data suggest a possible link between the inflammation status of the tumor environment and epigenetic regulation of lung CSCs. In 2006, Wehbe et al. reported that overexpression of IL-6 resulted in the altered expression and promoter methylation of several genes, including EGFR. They also concluded that epigenetic regulation of gene expression by IL-6 contributed to tumor progression in cholangiocarcinoma27; however, DNMTs were not examined in the study. In contrast to our report, Wu et al. suggested that in lung cancer, increased IL-6 production via tumor necrosis factor alpha was produced by the loss of TIMP-3, which was caused by increased DNMT1 expression.31 The relationship between IL-6 and DNMT1 in cancer or CSCs has not been widely discussed in the literature. However, the relationship between DNMT1 and STAT3 in different forms of cancer has been reported. In 2006, Zhang et al. suggested that STAT3 can activate the transcription of DNMT1 in malignant T lymphocytes.30 Additionally, our study showed that under conditions of DNM1 overexpression, the IL-6/JAK2/ STAT3 signaling pathway may represent a possible cause of epigenetic alteration in CSCs. Other studies regarding the mechanism of DNMT1 overexpression have been previously reported. Lai et al. reported that expression of wild-type p53 in H1299 lung cancer cells C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

11

can reduce the levels of DNMT1 and histone deacetylase 1 (HDAC1).32 Lin et al. also pointed out that dysregulation of p53/specific protein 1 control can cause DNMT1 overexpression in lung cancer.33 Cheng et al. found that knockdown of endogenous p53 in ovarian tumor cells induced DNMT1 expression and increased E-cadherin promoter methylation and cell invasion.34 Hodge et al. reported that IL-6 enhanced the nuclear translocation of DNMT1 through phosphorylation of the nuclear localization sequence by AKT kinase.35 In contrast to the mechanisms proposed in those reports, our study suggests that the IL-6/JAK2/STAT3 pathway induces overexpression of DNMT1, which causes DNA hypermethylation of p53 and p21 genes in lung CSCs, and thus enhances lung CSC proliferation. To be noted, DNMT3B, one of the de novo DNMTs, has been reported to serve as the downstream mediator of IL-6 and its expression correlates with poor prognosis in clinical patients of oral cancer.36 There is no literature discussing the relationship between DNMT3A and IL-6 or STAT3. In our study, DNMT3A and DNMT3B have not been increased upon treatment of all of these lung adenocarcinoma cell lines with IL-6. Our data were supported by the previous study that identified DNMT1 as the downstream regulator of IL-6 to maintain the promoter methylation of p53 tumor suppressor gene, thereby increasing the growth and survival of multiple myeloma cell lines.37 Moreover, Hodge et al. also reported that IL-6 enhances the nuclear translocation of DNMT1 via phosphorylation of the nuclear localization sequence by the AKT kinase.35 Together these data suggest that IL-6 mediates the effects on lung adenocarcinoma cells through upregulation of DNMT1. IL-6 is a multifunctional cytokine that is known to help regulate immune and inflammatory responses. IL-6 has also been reported to be associated with tumor progression and chemoresistance in different types of cancer, and increased serum levels of IL-6 are predictive of a poor prognosis.19–23 In 2001, Conze et al. found that autocrine production of IL-6 by tumor cells promotes drug resistance in breast cancer cells.38 Recently, the roles of IL-6 in cancer stem or stem-like cells and various molecular mechanisms have been widely investigated. In 2007, Sansone et al. reported that IL-6 promotes the survival of human mammospheres and breast cancer cell lines grown under hypoxic conditions via upregulating the Notch-3/carbonic anhydrase IX pathway.39 In 2011, Marotta et al. found that the IL-6/JAK2/STAT3 signaling pathway was active in CD441CD242 breast cancer cells, and inhibition of this pathway could be a promising strategy for inhibiting breast cancer stem-like cells.40 In our study, we demonstrated that the IL-6/JAK2/STAT3 pathway induced overexpression of DNMT1, and thus DNA hypermethylation that downregulated cell cycle regulation. These changes resulted in enhanced proliferation of lung CSCs, and increased tumor formation in a xenograft model. P53 and p21 are tumor suppressor genes and function as cell cycle regulators to block cellular proliferation. The involvement of p53 and p21 in proliferation of CSCs has

Cancer Cell Biology

Liu et al.

12

IL-6 enriched lung cancer stem-like cell via DNMT1 upregulation

been reported in the literature.41,42 Liu et al. found that loss of p21 enhanced features of epithelial mesenchymal transition (EMT) and putative CSCs.41 Cha et al. investigated the function of microRNA-34, and demonstrated that loss of wildtype p53 and hyperactivation of Wnt were critical for maintaining CSC properties.42 Recently, Ahn et al. reported that Ell3 enhanced proliferation of breast CSCs, with upregulation of cyclin A, D and downregulation of p21.43 In our study, we found that p53 and p21 were inhibited by addition of IL-6; however, the downstream checkpoint proteins (CDK2, CDK4 and cyclin D1) were not downregulated. These results indicate that the presence of inflammation in a cancer microenvironment may be associated with p53 and p21 DNA hypermethylation caused by overexpression of DNMT1. Further investigations are required to elucidate the underlying mechanisms for these effects. In conclusion, our study, for the first time, showed that the IL-6/JAK2/STAT3 pathway and DNM1 overexpression

enhanced cancer initiation and lung CSC proliferation by downregulation of p53 and p21 resulting from DNA hypermethylation. Blockage of the IL-6/JAK2/STAT3 pathway and inhibition of DNMT1 expression reduced lung CSC proliferation. Also, certain properties of lung CSCs including sphere formation and ability to initiate tumors were decreased. These data suggest that targeting of the IL-6/JAK2/STAT3 signaling pathway and DNMT1 may become important strategies for treating lung cancer.

Acknowledgements This work was assisted in part by the Division of Experimental Surgery of the Department of Surgery, Taipei Veterans General Hospital, and supported by grants V102C-028 and V102E8-005 from Taipei Veterans General Hospital to Han-Shui Hsu, grant NSC 102-2325-B-010-009 to Han-Shui Hsu and NSC grants 101-2321-B-010-012 and 101-2314-B-010-028-MY3 from the National Science Council to Shih-Chieh Hung. It was also partly supported by the Lung Cancer Foundation, in memory of Dr. K.S. Lu, Taipei.

Cancer Cell Biology

References 1. 2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

12. 13.

14.

Jemal A, Bray F, Center MM, et al. Global cancer statistics. CA Cancer J Clin 2011;61:69–90. Singh SK, Clarke ID, Terasaki M, et al. Identification of a cancer stem cell in human brain tumors. Cancer Res 2003;63:5821–8. Eramo A, Lotti F, Sette G, et al. Identification and expansion of the tumorigenic lung cancer stem cell population. Cell Death Differ 2008;15: 504–14. Vermeulen L, Todaro M, de Sousa Mello F, et al. Single-cell cloning of colon cancer stem cells reveals a multi-lineage differentiation capacity. Proc Natl Acad Sci USA 2008;105:13427–32. Rosen JM, Jordan CT. The increasing complexity of the cancer stem cell paradigm. Science 2009; 324:1670–3. Shackleton M, Quintana E, Fearon ER, et al. Heterogeneity in cancer: cancer stem cells versus clonal evolution. Cell 2009;138:822–9. Vermeulen L, De Sousa EMF, van der Heijden M, et al. Wnt activity defines colon cancer stem cells and is regulated by the microenvironment. Nat Cell Biol 2010;12:468–76. Heddleston JM, Li Z, McLendon RE, et al. The hypoxic microenvironment maintains glioblastoma stem cells and promotes reprogramming towards a cancer stem cell phenotype. Cell Cycle 2009;8:3274–84. Mathieu J, Zhang Z, Zhou W, et al. HIF induces human embryonic stem cell markers in cancer cells. Cancer Res 2011;71:4640–52. Bartucci M, Svensson S, Romania P, et al. Therapeutic targeting of Chk1 in NSCLC stem cells during chemotherapy. Cell Death Differ 2012;19: 768–78. Li Y, Laterra J. Cancer stem cells: distinct entities or dynamically regulated phenotypes? Cancer Res 2012;72:576–80. Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat Rev Cancer 2006;6:392–401. Grivennikov SI, Greten FR, Karin M. Immunity, inflammation, and cancer. Cell 2010;140: 883–99. Takahashi H, Ogata H, Nishigaki R, et al. Tobacco smoke promotes lung tumorigenesis by

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

triggering IKKbeta- and JNK1-dependent inflammation. Cancer Cell 2010;17:89–97. Farraye FA, Odze RD, Eaden J, et al. AGA technical review on the diagnosis and management of colorectal neoplasia in inflammatory bowel disease. Gastroenterology 2010;138:746–74, 74e1–4; quiz e12-3. Meira LB, Bugni JM, Green SL, et al. DNA damage induced by chronic inflammation contributes to colon carcinogenesis in mice. J Clin Invest 2008;118:2516–25. Jinushi M, Chiba S, Yoshiyama H, et al. Tumorassociated macrophages regulate tumorigenicity and anticancer drug responses of cancer stem/initiating cells. Proc Natl Acad Sci USA 2011;108: 12425–30. Iliopoulos D, Hirsch HA, Wang G, et al. Inducible formation of breast cancer stem cells and their dynamic equilibrium with non-stem cancer cells via IL6 secretion. Proc Natl Acad Sci USA 2011;108:1397–402. Iliopoulos D, Hirsch HA, Struhl K. An epigenetic switch involving NF-kappaB, Lin28, Let-7 MicroRNA, and IL6 links inflammation to cell transformation. Cell 2009;139:693–706. Wang H, Lathia JD, Wu Q, et al. Targeting interleukin 6 signaling suppresses glioma stem cell survival and tumor growth. Stem Cells 2009;27: 2393–404. Gao SP, Mark KG, Leslie K, et al. Mutations in the EGFR kinase domain mediate STAT3 activation via IL-6 production in human lung adenocarcinomas. J Clin Invest 2007;117:3846–56. Yeh HH, Lai WW, Chen HH, et al. Autocrine IL-6-induced Stat3 activation contributes to the pathogenesis of lung adenocarcinoma and malignant pleural effusion. Oncogene 2006;25:4300–9. Hsu HS, Lin JH, Hsu TW, et al. Mesenchymal stem cells enhance lung cancer initiation through activation of IL-6/JAK2/STAT3 pathway. Lung Cancer 2012;75:167–77. Jin B, Ernst J, Tiedemann RL, et al. Linking DNA methyltransferases to epigenetic marks and nucleosome structure genome-wide in human tumor cells. Cell Rep 2012;2:1411–24.

25. Jin B, Robertson KD. DNA methyltransferases, DNA damage repair, and cancer. Adv Exp Med Biol 2013;754:3–29. 26. Morita R, Hirohashi Y, Suzuki H, et al. DNA methyltransferase 1 is essential for initiation of the colon cancers. Exp Mol Pathol 2013;94:322–9. 27. Wehbe H, Henson R, Meng F, et al. Interleukin-6 contributes to growth in cholangiocarcinoma cells by aberrant promoter methylation and gene expression. Cancer Res 2006;66:10517–24. 28. Hsu HS, Lin JH, Huang WC, et al. Chemoresistance of lung cancer stemlike cells depends on activation of Hsp27. Cancer 2011;117:1516–28. 29. Herman JG, Graff JR, Myohanen S, et al. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA 1996;93:9821–6. 30. Zhang Q, Wang HY, Woetmann A, et al. STAT3 induces transcription of the DNA methyltransferase 1 gene (DNMT1) in malignant T lymphocytes. Blood 2006;108:1058–64. 31. Wu DW, Tsai LH, Chen PM, et al. Loss of TIMP-3 promotes tumor invasion via elevated IL-6 production and predicts poor survival and relapse in HPV-infected non-small cell lung cancer. Am J Pathol 2012;181:1796–806. 32. Lai JC, Cheng YW, Goan YG, et al. Promoter methylation of O(6)-methylguanine-DNA-methyltransferase in lung cancer is regulated by p53. DNA Repair (Amst) 2008;7:1352–63. 33. Lin RK, Wu CY, Chang JW, et al. Dysregulation of p53/Sp1 control leads to DNA methyltransferase-1 overexpression in lung cancer. Cancer Res 2010;70:5807–17. 34. Cheng JC, Auersperg N, Leung PC. Inhibition of p53 represses E-cadherin expression by increasing DNA methyltransferase-1 and promoter methylation in serous borderline ovarian tumor cells. Oncogene 2011;30:3930–42. 35. Hodge DR, Cho E, Copeland TD, et al. IL-6 enhances the nuclear translocation of DNA cytosine-5-methyltransferase 1 (DNMT1) via phosphorylation of the nuclear localization sequence by the AKT kinase. Cancer Genomics Proteomics 2007;4:387–98.

C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V

13

Liu et al.

39. Sansone P, Storci G, Tavolari S, et al. IL-6 triggers malignant features in mammospheres from human ductal breast carcinoma and normal mammary gland. J Clin Invest 2007;117:3988–4002. 40. Marotta LL, Almendro V, Marusyk A, et al. The JAK2/STAT3 signaling pathway is required for growth of CD44(1)CD24(2) stem cell-like breast cancer cells in human tumors. J Clin Invest 2011; 121:2723–35. 41. Liu M, Casimiro MC, Wang C, et al. p21CIP1 attenuates Ras- and c-Myc-dependent breast

tumor epithelial mesenchymal transition and cancer stem cell-like gene expression in vivo. Proc Natl Acad Sci USA 2009;106:19035–9. 42. Cha YH, Kim NH, Park C, et al. MiRNA-34 intrinsically links p53 tumor suppressor and Wnt signaling. Cell Cycle 2012;11:1273–81. 43. Ahn HJ, Kim G, Park KS. Ell3 stimulates proliferation, drug resistance, and cancer stem cell properties of breast cancer cells via a MEK/ERKdependent signaling pathway. Biochem Biophys Res Commun 2013;437:557–64.

Cancer Cell Biology

36. Chen WC, Chen MF, Lin PY. Significance of DNMT3b in oral cancer. PLoS One 2014;9: e89956. 37. Hodge DR, Peng B, Cherry JC, et al. Interleukin 6 supports the maintenance of p53 tumor suppressor gene promoter methylation. Cancer Res 2005;65:4673–82. 38. Conze D, Weiss L, Regen PS, et al. Autocrine production of interleukin 6 causes multidrug resistance in breast cancer cells. Cancer Res 2001; 61:8851–8.

C 2014 UICC Int. J. Cancer: 00, 00–00 (2014) V