Pediatric Exercise Science, 2014, 26, 470-476 http://dx.doi.org/10.1123/pes.2014-0158 © 2014 Human Kinetics, Inc.
IGF-I and IGF-I Receptor Polymorphisms Among Elite Swimmers Sigal Ben-Zaken and Yoav Meckel Wingate Institute
Nitzan Dror, Dan Nemet, and Alon Eliakim Tel Aviv University In recent years several genetic polymorphisms related to the GH-IGF-I axis were suggested to promote athletic excellence in endurance and power sports. We studied the presence of the C-1245T SNP (rs35767), a nucleotide substitution in the promoter region of the IGF-I gene, and the presence of the 275124A > C SNP (rs1464430), a common nucleotide substitution in the intron region of the IGF-I receptor (IGF-IR) gene in elite long and short-distance swimmers compared with nonphysically active controls. The rare T/T IGF-I polymorphism was found only in 5.3% of the long-distance swimmers, and was not found at all in the short-distance swimmers or among the control group participants. The prevalence of the IGF-I receptor AA genotype was significantly lower in the swimming group as a whole (35%) compared with the control group (46%), in particularly due to reduced frequency of the AA genotype among short-distance swimmers (26%). In contrast to previous reports in elite endurance and power track and field athletes, single nucleotide polymorphisms of the IGF-I and the IGF-IR were not frequent among elite Israeli short- and long-distance swimmers emphasizing the importance of other factors for excellence in swimming. The results also suggest that despite seemingly similar metabolic characteristics different sports disciplines may have different genetic polymorphisms. Thus, combining different disciplines for sports genetic research purposes should be done with extreme caution. Keywords: insulin-like growth factors, genetics, SNP, swimming Identification of significant genes for athletic excellence is complicated, since each gene makes a small contribution to the overall heritability. This is particularly important in children who are expected to take part in sports at a level that matches their abilities. Thus, children are discouraged from exercising above their capabilities, or to specialize in a single sport before adolescence. Despite this, a growing number of children specialize and compete at an “elite” level at early ages. Furthermore, in attempt to identify future champions, selection processes start even before elementary school in certain sports (29). Selection complexity is even greater because the sports-talented prepubertal child may often excel in both aerobic, and anaerobic, as well as individual and team sports (7). It seems, therefore, that identification of a sport Ben-Zaken and Meckel are with the Genetics and Molecular Biology Laboratory, Zinman College of Physical Education and Sports Sciences at the Wingate Institute, Netanya, Israel. Dror, Nemet, and Eliakim are with the Child Health & Sport Center, Pediatric Dept., Meir Medical Center, Tel Aviv University, Israel. Address author correspondence to Alon Eliakim at [email protected]
470
event that best fits the athlete’s ability at a proper age is essential for competitive success. Genetic polymorphism has been suggested as a possible supplementary tool to assist athletes and coaches in sport selection. In recent years several genetic polymorphisms related to the GH-IGF-I axis were suggested to promote athletic excellence in endurance and power sports. It was shown previously that both functional (eg, maximal oxygen consumption, VO2max) and structural (eg, thigh muscle volume determined by magnetic resonance images) indices of fitness were correlated with serum IGF-I levels in pre and late pubertal girls (4,6). This suggested that fitness in prepubertal and adolescent females may be associated with anabolic adaptations of the GH-IGF-I system. C-1245T (rs35767) is a genetic variation in the promoter region of the IGF-I gene, with the T allele being the minor allele. Presence of the minor T allele was associated with higher circulating IGF-I levels (3,23,24). Interestingly, the variation of the IGF-I promoter gene has rarely been studied among professional athletes. It was found that the frequency of the IGF-I promoter T allele polymorphism was significantly greater among athletes (9.2%) compared with nonactive controls (2.4%) (15). Moreover, a considerably higher
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
IGF-I and IGF-I Receptor Polymorphisms 471
sequence frequency was found among strength athletes (11%) compared with team-sport athletes (7.8%). More recently, our group demonstrated a greater frequency of the T/T polymorphism among both endurance and power track and field athletes (4.8%), compared with nonexistence among the controls (1). These findings suggest a possible contribution of the relatively rare IGF-I T/T genotype to endurance performance, and in particularly to power sport excellence. The exercise-associated IGF-I effects are mediated by an interaction with its receptor (IGF-IR) (25). However, while the relationship between exercise and IGF-I have been studied extensively (5,21), much less is known about the effect of a single exercise and/or exercise training on the IGF-IR. Animal studies have shown an essential role for IGF-IR in mediating exercise-associated cardiomyocyte hypertrophy (9,11,28). The 275124A > C (rs1464430) is a common genetic variation in the intron of the IGF-IR gene, with a global minor A allele frequency of 40%. We recently demonstrated that the IGF-IR AA polymorphism is beneficial for endurance-type runners, but is not associated with elite endurance performance (2). In contrast, the presence of the AA genotype may be a disadvantage for power track and field athletes. The results raised the possibility that IGF-IR polymorphism may differentiate between the 2 edges of the endurancepower athletic performance spectrum. Hormonal genetic polymorphisms and their applicability to swimming performance, and as a consequence to the prediction of swimming excellence, have never been studied. Therefore, the aim of the current study was to assess the frequency of the IGF-I C-1245T (rs35767) polymorphism and the IGF-IR 275124A > C (rs1464430) polymorphism among elite Israeli swimmers. We hypothesized that like track and field athletes, the rare IGF-I T allele will be more prevalent among both short- and long-distance swimmers, and that the prevalence of the IGF-IR A allele would be more frequent among longdistance swimmers.
ranked among the top Israeli results in their event and had competed in national and/or international level meets on a regular basis (eg, the average 100 m swim time was 50.90 ± 1.53 s for males and 57.5 ± 1.9 s for females, the average female 800m swim time was 9:20.30 ± 00:20.15 min, and the average male 1500 m swim time was 15:50.20 ± 00:07.20 min). Training experience of the participants consisted of an average of 10 swimming sessions per week, covering distances of about 40 to 50 km/week. Out of that, about 50% was devoted to long-distance aerobic-type training, 25% to interval training, and 15% to sprint training. In addition, swimmers practiced special water technical drills (about 10% of total distance). The control group for the IGF-I polymorphism consisted of nonathletic healthy individuals who were not engaged in competitive sport and included 159 participants for the IGF-I polymorphism and 96 for the IGF-IR polymorphism (age 20–29). Characteristics of the swimmers and controls are presented in Table 1.
Genotyping IGF-I: Genomic DNA was extracted from samples of peripheral venous blood according to the salting-out procedure (20). Genotypes were determined using the Taqman allelic discrimination assay. The Assay-by-Design service (www.appliedbio-systems.com) was used to set up a Taqman allelic discrimination assay for the IGF-I G1245A SNP (rs35767) and for the IGF-IR 275124A > C SNP (rs1464430). Primer sequences for IGF-I and IGF-IR were forward: GGATTTCAAGCAGAACTGTGTTTTCA, reverse: GGTGGAAATAACCTGGACCTTGAAT. Probe sequences for IGF-I G1245A and IGF-IR 275124A > C SNP (rs1464430) were forward: VIC-TTTTTTCCGCATGACTCT, reverse: FAM-TTTTTTTTCCACATGACTCT. The PCR reaction mixture included 5 ng genomic DNA, 0.125 μl TaqMan assay (40*, ABI), 2.5 μl Master mix (ABI) and 2.375 μl water. PCR was performed in 384 well PCR plates in an ABI 9700 PCR system (Applied Biosystems Inc., Foster City, CA, USA) and consisted of initial denaturation for 10 min at 95 °C, and 40 cycles with denaturation of 15 s at 92 °C and annealing and extension for 60 s at 60 °C. Results were analyzed by the ABI Taqman 7900HT using the sequence detection system 2.22 software (Applied Biosystems Inc).
Methods Participants Eighty swimmers (49 males and 31 females, age 16–49) participated in the study. Swimmers were assigned to 2 groups according to their main swimming event as follows: long-distance swimmers (major event: 400–1500 m swim, n = 38) and short-distance swimmers (major event: 50–100m swim, n = 42). All swimmers were
Data Analysis The SPSS statistical package, version 20.0, was used to perform all statistical evaluations (SPSS, Chicago, IL,
Table 1 Athlete and Control Subjects’ Data Group
n
Main Event
M/F
Top/National Level
Age (Mean + SD, range)
Long-distance swimmers
38
400–1500 m
22/16
9/29
25.3+9.3 (16–48)
Short-distance swimmers
42
50–100 m
27/15
8/34
23.1+7.6 (16–49)
Controls
217
nr
137/80
nr
26.4+5.8 (19–29)
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
472 Ben-Zaken et al
USA). A χ2 test was used to confirm that the observed genotype frequencies were in Hardy-Weinberg equilibrium, and to compare alleles and genotype frequencies between swimmers and controls. If observed or expected values included a cell with a value of 5, we used Fisher’s exact test to compare alleles and genotype frequencies.
frequency of the AA carriers among the short-distance swimmers (26% versus 46% among short-distance and control participants, respectively; χ2 (2) =8.41, p < .01, Figure 2).
Results
We studied the presence of the C-1245T SNP (rs35767), a nucleotide substitution in the promoter region of the IGF-I gene, in elite long and short-distance swimmers compared with nonphysically active controls. The rare T/T polymorphism was found only in 5.3% of the long-distance swimmers, and was not found at all in the short-distance swimmers or among the control group participants. In addition, we studied the presence of the 275124A > C SNP (rs1464430), a common nucleotide substitution in the intron region of the IGF-IR gene, in the elite long- and short-distance swimmers. In contrast to our hypothesis, the prevalence of the AA genotype was significantly lower in the swimming group as a whole (35%) compared with the control group (46%), in particularly due to reduced frequency of the AA genotype among short-distance swimmers (26%). The regulatory effect of the IGF-I gene on muscle hypertrophy and age-related decreases in muscle mass and strength (19,27), the consequent reduction in functional abilities and increased risk of falling and fractures (17,26), have led investigators to study the effect of the
Discussion
The complete data on allele and genotype frequencies of the IGF-I C-1245T and IGF-IR 275124A > C SNP are shown in Table 2. IGF-I C-1245T genotype distribution was in agreement with the Hardy-Weinberg equilibrium within the 3 groups (p < .05). Genotype subtype did not differ by age or gender. The long-distance and shortdistance swimmers allele and genotype frequencies did not differ significantly from those of the control group (Figure 1). We observed that the TT genotype was very rare among long-distance swimmers (5.3%), and was not found at all in short-distance swimmers or among the control group. The IGF-IR 275124A > C genotype distribution was in agreement with the Hardy-Weinberg equilibrium within the 3 groups (p > .05). Genotype subtype did not differ by age or gender. All swimmers’ genotype frequencies differed significantly from the control group (AA carriers: 35% versus 46%, respectively; χ2 = 6.11, d.f.= 2, p < .05; Figure 2). This was mainly due to reduced
Table 2 The IGF1 C-1245T and IGF-IR 275124A > C Genotype and Allele Frequencies in All Groups Genotype Frequency Group
Allele Frequency
n
CC
CT
TT
T-allele carriers
C-allele
T-allele
Long-distance swimmers
42
23(61)
13(34)
2(5)
15(39)
59(78)
17(22)
Short-distance swimmers
38
29(69)
13(31)
0(0)
13(31)
71(85)
13(15)
All swimmers
80
52(65)
26(33)
2(2)
28(35)
130(81)
30(19)
Controls
159
119 (75)
40 (25)
0(0)
40(25)
278 (87)
40 (13)
n
AA
AC
CC
C-allele carriers
A-allele
C-allele
42
18(43)
18(43)
6(14)
24(57)
54(64)
30(36)
Short-distance swimmers
38
10(26)*
20(53)*
8(21)*
28(74)
40(52)#
36(48)#
All swimmers
80
28(35)**
38(48)**
14(18)**
52(65)
94(59)##
66(41)##
Controls
96
44(46)
46(48)
6(6)
52(54)
134(70)
58(30)
IGF1 C-1245T (rs35767)
Genotype Frequency
Allele Frequency
IGF-IR 275124A>C (rs1464430) Long-distance swimmers
Note. Values are absolute (relative frequencies in parentheses). *χ2 (2) =8.41, p < .01, genotype frequency, short-distance swimmers vs. controls. **χ 2 (2) =6.11, p < .05, genotype frequency, all swimmers vs. controls. # χ 2 (1) =7.04, p < .01, allele frequency, short-distance swimmers vs. controls. ## χ 2 (1) =4.66, p < .05, allele frequency, all swimmers vs. controls.
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
IGF-I and IGF-I Receptor Polymorphisms 473
Figure 1 — The IGF1 C-1245T polymorphism (1a: genotype frequencies, 1b: allele frequencies) in swimmers and controls.
C-1245T SNP (rs35767) polymorphism, mainly among the elderly. It was suggested that the C/C genotype of rs35767 is associated with lower levels of IGF-I in skeletal muscle, potentially leading to the increased adiposity and reduced muscle mass of elderly women (13). Furthermore, it was shown that carriers of the T/T genotype in the IGF-I promoter region demonstrated a significantly greater muscle strength gain following strength training intervention, compared with noncarriers (12). These studies suggested that the IGF-I promoter polymorphism is responsible not only for muscle mass, but also for its response to strength training. Interestingly, only 2 studies examined the variation of the IGF-I promoter in professional athletes. The frequency of the IGF-I promoter polymorphism was significantly greater among athletes (9.2%) compared with nonactive controls (2.4%). Moreover, a considerably higher
sequence frequency was found among strength athletes (11%) compared with team-sport athletes (7.8%) (15). Consistent with these results, we recently demonstrated a higher frequency of the T/T polymorphism among athletes (4.8%), compared with nonexistence among controls (1). Despite an equal polymorphism distribution among endurance and power athletes, one of the most interesting findings of that study was that while the 4 endurance athletes were of national level, the 4 power athletes were elite-level athletes (international and Olympic). In addition, overall, the T allele was found significantly more frequently in the top-level power athletes. These results suggest that the IGF-I T/T polymorphism possible association’s with muscle mass increase is more important to power sport excellence. Thus, the results of the current study were surprising, since only 2 long-distance swimmers carried the T/T genotype and the T/T genotype was
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
474 Ben-Zaken et al
Figure 2 — The IGF-IR 275124A > C polymorphism (1a: genotype frequencies, 1b: allele frequencies) in swimmers and controls. *χ2 (2) =8.41, p < .01, genotype frequency, short-distance swimmers vs. controls. **χ2 (2) =6.11, p < .05, genotype frequency, all swimmers vs. controls. #χ2 (1) =7.04, p < .01, allele frequency, short-distance swimmers vs. controls. ##χ2 (1) =4.66, p < .05, allele frequency, all swimmers vs. controls
not found at all in the short-distance swimmers or among the control group participants. The results may suggest, therefore, that the C-1245T SNP (rs35767) is probably less important for swimming than for running excellence, and cannot be used as a possible marker for sports selection among swimmers at early ages. Consistent with this speculation, IGF-I levels were similar among adolescent female swimmers compared with untrained controls (8), and were even reduced in synchronized swimmers (18). IGF-I levels were unchanged following intense water polo practice among adolescent females (22). Only a single study demonstrated an increase in total and free IGF-I levels following intense training and maintenance of these levels among collegiate swimmers (14). In contrast to the relationship between exercise and IGF-I, much less is known about exercise-associated
effects of the IGF-IR. The majority of studies focused on the importance of IGF-IR in mediating exercise training-related cardiac hypertrophy (9,11,28). Human studies indicated that polymorphisms in the IGF-IR gene were associated with left ventricular mass in male athletes (10). Endurance training was associated with up-regulation of IGF-I binding to erythrocyte IGF-IR in adolescent males (16). Whether there is an organ-specific (eg, cardiac) association between exercise and IGF-IR is currently unknown. Further studies are needed to clarify the relationship between exercise and IGF-IR in other organs (eg, skeletal muscle). We recently demonstrated (2) that the IGF-IR AA genotype, known to mediate exercise-related cardiac hypertrophy, was significantly higher in endurance compared with the power track and field athletes, but did
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
IGF-I and IGF-I Receptor Polymorphisms 475
not differ from control participants. Interestingly, there was no significant difference in the prevalence of the AA genotype between elite and national level endurance athletes. This suggests that while IGF-IR AA genotype is one of the SNPs that may promote endurance over power athletic performance, its presence is not associated with top-level endurance performance. In addition, the prevalence of the IGF-IR AA polymorphism was significantly lower among elite compared with national level power track and field athletes (17% versus 42%, p < .05), suggesting the possibility that its presence prevents excellence in power sports. It was therefore suggested that IGF-IR polymorphism may possibly distinguish between the 2 ends of the endurance-power athletic performance spectrum. However, the use this information for sport selection and prediction of athletic success still needs to be explored. In contrast to our hypothesis, despite rather similar endurance and sprint/power characteristics for track and field athletes, the AA genotype was not more prevalent among long-distance swimmers. However, consistent with the findings in power/sprint track and field athletes, the prevalence of the AA genotype was significantly reduced among short-distance swimmers. These results may imply that the presence of the AA genotype may have negative effect on short-distance swimming success. In addition, the results indicate that different sports disciplines (eg, swimming and track and field) may have different genetic polymorphisms, despite seemingly similar metabolic characteristics. Thus, combining different disciplines for sports genetic research purposes should not be done, or at least be done with extreme caution. The identification of relevant genes for athletic excellence is difficult, mainly because each gene makes a small contribution to overall heritability. However, these efforts are important when geared to young ages. Directing children to exercise intensely above their limits or to specialize in a single sport is generally discouraged before adolescence. Despite this, many children do specialize in a sport event on early age, and compete at the elite level. In several Olympic sports, the selection processes to identify future winners and to specialize in training starts even before elementary school. Moreover, media coverage of sports events frequently focuses on the very talented young competitors (29). On top of this, sportstalented prepubertal children often excel in more than 1 type of sport, such as aerobic, anaerobic, individual, and team sports (7), adding to the complexity of sports selection at a young age. Therefore, identification of a sport event that best matches the athlete’s ability at a proper age seems crucial for competitive sports success. Genetic polymorphism is suggested as an additional tool to assist in sport selection. The results of the current study suggest that in contrast to elite endurance and power track and field athletes, single nucleotide polymorphisms of IGF-I and the IGF-IR were not frequent among elite Israeli shortand long-distance swimmers. Moreover, the IGF-IR AA polymorphism was significantly less frequent among
short-distance swimmers compared with controls, possibly implying that its presence may prevent success. Whether a multipotent athlete who wants to develop a competitive career and carries a lower frequency of the IGF-IR AA polymorphism should prefer swimming and not select endurance track and field is currently speculative. Moreover, it should be noted that while a favorable genetic predisposition is essential, psychological and environmental factors, including training equipment and facilities, nutrition, familial support, and motivational factors, are also imperative for top-level sports development.
References 1. Ben-Zaken S, Eliakim A, Nemet D, Rabinovich M, Kassem E, Meckel Y. Differences in MCT1 A1470T polymorphism prevalence between runners and swimmers. Scand J Med Sci Sports. 2014; Epub ahead of print. 2. Ben-Zaken S, Meckel Y, Nemet D, Eliakim A. IGF-I receptor 275124A>C (rs1464430) polymorphism and athletic performance. J Sci Med Sport. 2014; Epub ahead of print. 3. Canzian F, McKay JD, Cleveland RJ, et al. Polymorphisms of genes coding for insulin-like growth factor 1 and its major binding proteins, circulating levels of IGF-I and IGFBP-3 and breast cancer risk: results from the EPIC study. Br J Cancer. 2006; 94(2):299–307. PubMed doi:10.1038/sj.bjc.6602936 4. Eliakim A, Brasel JA, Mohan S, Barstow TJ, Berman N, Cooper DM. Physical fitness, endurance training, and the growth hormone-insulin-like growth factor I system in adolescent females. J Clin Endocrinol Metab. 1996; 81(11):3986–3992. PubMed 5. Eliakim A, Nemet D. Exercise training, physical fitness and the growth hormone-insulin-like growth factor-1 axis and cytokine balance. Med Sport Sci. 2010; 55:128–140. PubMed doi:10.1159/000321977 6. Eliakim A, Scheett TP, Newcomb R, Mohan S, Cooper DM. Fitness, training, and the growth hormone®insulinlike growth factor I axis in prepubertal girls. J Clin Endocrinol Metab. 2001; 86(6):2797–2802. PubMed 7. Gonçalves CEB, Rama LML, Figueiredo AB. Talent identification and specialization in sport: an overview of some unanswered questions. Int J Sports Physiol Perform. 2012; 7(4):390–393. PubMed 8. Gruodyte R, Jürimäe J, Saar M, Jürimäe T. The relationships among bone health, insulin-like growth factor-1 and sex hormones in adolescent female athletes. J Bone Miner Metab. 2010; 28(3):306–313. PubMed doi:10.1007/ s00774-009-0130-2 9. Ikeda H, Shiojima I, Ozasa Y, et al. Interaction of myocardial insulin receptor and IGF receptor signaling in exerciseinduced cardiac hypertrophy. J Mol Cell Cardiol. 2009; 47(5):664–675. PubMed doi:10.1016/j.yjmcc.2009.08.028 10. Karlowatz R-J, Scharhag J, Rahnenführer J, et al. Polymorphisms in the IGF1 signalling pathway including the myostatin gene are associated with left ventricular mass in male athletes. Br J Sports Med. 2011; 45(1):36–41. PubMed doi:10.1136/bjsm.2008.050567
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
476 Ben-Zaken et al
11. Kim J, Wende AR, Sena S, et al. Insulin-like growth factor I receptor signaling is required for exercise-induced cardiac hypertrophy. Mol Endocrinol. 2008; 22(11):2531–2543. PubMed doi:10.1210/me.2008-0265 12. Kostek MC, Delmonico MJ, Reichel JB, et al. Muscle strength response to strength training is influenced by insulin-like growth factor 1 genotype in older adults. J Appl Physiol. 2005; 98(6):2147–2154. PubMed doi:10.1152/ japplphysiol.00817.2004 13. Kostek MC, Devaney JM, Gordish-Dressman H, et al. A polymorphism near IGF1 is associated with body composition and muscle function in women from the Health, Aging, and Body Composition Study. Eur J Appl Physiol. 2010; 110(2):315–324. PubMed doi:10.1007/s00421-0101500-0 14. Koziris LP, Hickson RC, Chatterton RT, et al. Serum levels of total and free IGF-I and IGFBP-3 are increased and maintained in long-term training. J Appl Physiol. 1999; 86(4):1436–1442. PubMed 15. Krych-Garsztka K, Mizgajska-Wiktor H, GozdzuckaJojefiak A. An analysis of the regulatory region of the IGF1 gene in professional athletes in youth sports teams. Hum Mov. 2011; 12(3):216–222. 16. Lee C, Eliakim A, Brasel JA, Cooper DM. Effect of exercise training on erythrocyte insulin-like growth factor-I receptor binding in adolescent males. J Pediatr Endocrinol Metab. 2000; 13(6):621–627. PubMed doi:10.1515/ JPEM.2000.13.6.621 17. Lord SR, Ward JA, Williams P, Anstey KJ. Physiological factors associated with falls in older community-dwelling women. J Am Geriatr Soc. 1994; 42(10):1110–1117. PubMed 18. Ludwa IA, Falk B, Yao M, Corbett L, Klentrou P. Bone speed of sound, bone turnover and IGF-I in adolescent synchronized swimmers. Pediatr Exerc Sci. 2010; 22(3):421–430. PubMed 19. Lynch NA, Metter EJ, Lindle RS, et al. Muscle quality. I. Age-associated differences between arm and leg muscle groups. J Appl Physiol. 1999; 86(1):188–194. PubMed 20. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated
cells. Nucleic Acids Res. 1988; 16(3):1215. PubMed doi:10.1093/nar/16.3.1215 21. Nemet D, Eliakim A. Growth hormone-insulin-like growth factor-1 and inflammatory response to a single exercise bout in children and adolescents. Med Sport Sci. 2010; 55:141–155. PubMed doi:10.1159/000321978 22. Nemet D, Rose-Gottron CM, Mills PJ, Cooper DM. Effect of water polo practice on cytokines, growth mediators, and leukocytes in girls. Med Sci Sports Exerc. 2003; 35(2):356–363. PubMed doi:10.1249/01. MSS.0000048722.84182.E3 23. Palles C, Johnson N, Coupland B, et al. Identification of genetic variants that influence circulating IGF1 levels: a targeted search strategy. Hum Mol Genet. 2008; 17(10):1457–1464. PubMed doi:10.1093/hmg/ddn034 24. Patel AV, Cheng I, Canzian F, et al. IGF-1, IGFBP-1, and IGFBP-3 polymorphisms predict circulating IGF levels but not breast cancer risk: findings from the Breast and Prostate Cancer Cohort Consortium (BPC3). PLoS ONE. 2008; 3(7):e2578. PubMed doi:10.1371/journal.pone.0002578 25. Philippou A, Halapas A, Maridaki M, Koutsilieris M. Type I insulin-like growth factor receptor signaling in skeletal muscle regeneration and hypertrophy. J Musculoskelet Neuronal Interact. 2007; 7(3):208–218. PubMed 26. Rantanen T, Era P, Heikkinen E. Physical activity and the changes in maximal isometric strength in men and women from the age of 75 to 80 years. J Am Geriatr Soc. 1997; 45(12):1439–1445. PubMed 27. Reed RL, Pearlmutter L, Yochum K, Meredith KE, Mooradian AD. The relationship between muscle mass and muscle strength in the elderly. J Am Geriatr Soc. 1991; 39(6):555–561. PubMed 28. Scheinowitz M, Kessler-Icekson G, Freimann S, et al. Short- and long-term swimming exercise training increases myocardial insulin-like growth factor-I gene expression. Growth Horm IGF Res. 2003; 13(1):19–25. PubMed doi:10.1016/S1096-6374(02)00137-5 29. Valovich McLeod TC, Decoster LC, Loud KJ, et al. National Athletic Trainers’ Association position statement: prevention of pediatric overuse injuries. J Athl Train. 2011; 46(2):206–220. PubMed doi:10.4085/1062-6050-46.2.206
IGF-I and IGF-I Receptor Polymorphisms Among Elite Swimmers Sigal Ben-Zaken and Yoav Meckel Wingate Institute
Nitzan Dror, Dan Nemet, and Alon Eliakim Tel Aviv University In recent years several genetic polymorphisms related to the GH-IGF-I axis were suggested to promote athletic excellence in endurance and power sports. We studied the presence of the C-1245T SNP (rs35767), a nucleotide substitution in the promoter region of the IGF-I gene, and the presence of the 275124A > C SNP (rs1464430), a common nucleotide substitution in the intron region of the IGF-I receptor (IGF-IR) gene in elite long and short-distance swimmers compared with nonphysically active controls. The rare T/T IGF-I polymorphism was found only in 5.3% of the long-distance swimmers, and was not found at all in the short-distance swimmers or among the control group participants. The prevalence of the IGF-I receptor AA genotype was significantly lower in the swimming group as a whole (35%) compared with the control group (46%), in particularly due to reduced frequency of the AA genotype among short-distance swimmers (26%). In contrast to previous reports in elite endurance and power track and field athletes, single nucleotide polymorphisms of the IGF-I and the IGF-IR were not frequent among elite Israeli short- and long-distance swimmers emphasizing the importance of other factors for excellence in swimming. The results also suggest that despite seemingly similar metabolic characteristics different sports disciplines may have different genetic polymorphisms. Thus, combining different disciplines for sports genetic research purposes should be done with extreme caution. Keywords: insulin-like growth factors, genetics, SNP, swimming Identification of significant genes for athletic excellence is complicated, since each gene makes a small contribution to the overall heritability. This is particularly important in children who are expected to take part in sports at a level that matches their abilities. Thus, children are discouraged from exercising above their capabilities, or to specialize in a single sport before adolescence. Despite this, a growing number of children specialize and compete at an “elite” level at early ages. Furthermore, in attempt to identify future champions, selection processes start even before elementary school in certain sports (29). Selection complexity is even greater because the sports-talented prepubertal child may often excel in both aerobic, and anaerobic, as well as individual and team sports (7). It seems, therefore, that identification of a sport Ben-Zaken and Meckel are with the Genetics and Molecular Biology Laboratory, Zinman College of Physical Education and Sports Sciences at the Wingate Institute, Netanya, Israel. Dror, Nemet, and Eliakim are with the Child Health & Sport Center, Pediatric Dept., Meir Medical Center, Tel Aviv University, Israel. Address author correspondence to Alon Eliakim at [email protected]
470
event that best fits the athlete’s ability at a proper age is essential for competitive success. Genetic polymorphism has been suggested as a possible supplementary tool to assist athletes and coaches in sport selection. In recent years several genetic polymorphisms related to the GH-IGF-I axis were suggested to promote athletic excellence in endurance and power sports. It was shown previously that both functional (eg, maximal oxygen consumption, VO2max) and structural (eg, thigh muscle volume determined by magnetic resonance images) indices of fitness were correlated with serum IGF-I levels in pre and late pubertal girls (4,6). This suggested that fitness in prepubertal and adolescent females may be associated with anabolic adaptations of the GH-IGF-I system. C-1245T (rs35767) is a genetic variation in the promoter region of the IGF-I gene, with the T allele being the minor allele. Presence of the minor T allele was associated with higher circulating IGF-I levels (3,23,24). Interestingly, the variation of the IGF-I promoter gene has rarely been studied among professional athletes. It was found that the frequency of the IGF-I promoter T allele polymorphism was significantly greater among athletes (9.2%) compared with nonactive controls (2.4%) (15). Moreover, a considerably higher
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
IGF-I and IGF-I Receptor Polymorphisms 471
sequence frequency was found among strength athletes (11%) compared with team-sport athletes (7.8%). More recently, our group demonstrated a greater frequency of the T/T polymorphism among both endurance and power track and field athletes (4.8%), compared with nonexistence among the controls (1). These findings suggest a possible contribution of the relatively rare IGF-I T/T genotype to endurance performance, and in particularly to power sport excellence. The exercise-associated IGF-I effects are mediated by an interaction with its receptor (IGF-IR) (25). However, while the relationship between exercise and IGF-I have been studied extensively (5,21), much less is known about the effect of a single exercise and/or exercise training on the IGF-IR. Animal studies have shown an essential role for IGF-IR in mediating exercise-associated cardiomyocyte hypertrophy (9,11,28). The 275124A > C (rs1464430) is a common genetic variation in the intron of the IGF-IR gene, with a global minor A allele frequency of 40%. We recently demonstrated that the IGF-IR AA polymorphism is beneficial for endurance-type runners, but is not associated with elite endurance performance (2). In contrast, the presence of the AA genotype may be a disadvantage for power track and field athletes. The results raised the possibility that IGF-IR polymorphism may differentiate between the 2 edges of the endurancepower athletic performance spectrum. Hormonal genetic polymorphisms and their applicability to swimming performance, and as a consequence to the prediction of swimming excellence, have never been studied. Therefore, the aim of the current study was to assess the frequency of the IGF-I C-1245T (rs35767) polymorphism and the IGF-IR 275124A > C (rs1464430) polymorphism among elite Israeli swimmers. We hypothesized that like track and field athletes, the rare IGF-I T allele will be more prevalent among both short- and long-distance swimmers, and that the prevalence of the IGF-IR A allele would be more frequent among longdistance swimmers.
ranked among the top Israeli results in their event and had competed in national and/or international level meets on a regular basis (eg, the average 100 m swim time was 50.90 ± 1.53 s for males and 57.5 ± 1.9 s for females, the average female 800m swim time was 9:20.30 ± 00:20.15 min, and the average male 1500 m swim time was 15:50.20 ± 00:07.20 min). Training experience of the participants consisted of an average of 10 swimming sessions per week, covering distances of about 40 to 50 km/week. Out of that, about 50% was devoted to long-distance aerobic-type training, 25% to interval training, and 15% to sprint training. In addition, swimmers practiced special water technical drills (about 10% of total distance). The control group for the IGF-I polymorphism consisted of nonathletic healthy individuals who were not engaged in competitive sport and included 159 participants for the IGF-I polymorphism and 96 for the IGF-IR polymorphism (age 20–29). Characteristics of the swimmers and controls are presented in Table 1.
Genotyping IGF-I: Genomic DNA was extracted from samples of peripheral venous blood according to the salting-out procedure (20). Genotypes were determined using the Taqman allelic discrimination assay. The Assay-by-Design service (www.appliedbio-systems.com) was used to set up a Taqman allelic discrimination assay for the IGF-I G1245A SNP (rs35767) and for the IGF-IR 275124A > C SNP (rs1464430). Primer sequences for IGF-I and IGF-IR were forward: GGATTTCAAGCAGAACTGTGTTTTCA, reverse: GGTGGAAATAACCTGGACCTTGAAT. Probe sequences for IGF-I G1245A and IGF-IR 275124A > C SNP (rs1464430) were forward: VIC-TTTTTTCCGCATGACTCT, reverse: FAM-TTTTTTTTCCACATGACTCT. The PCR reaction mixture included 5 ng genomic DNA, 0.125 μl TaqMan assay (40*, ABI), 2.5 μl Master mix (ABI) and 2.375 μl water. PCR was performed in 384 well PCR plates in an ABI 9700 PCR system (Applied Biosystems Inc., Foster City, CA, USA) and consisted of initial denaturation for 10 min at 95 °C, and 40 cycles with denaturation of 15 s at 92 °C and annealing and extension for 60 s at 60 °C. Results were analyzed by the ABI Taqman 7900HT using the sequence detection system 2.22 software (Applied Biosystems Inc).
Methods Participants Eighty swimmers (49 males and 31 females, age 16–49) participated in the study. Swimmers were assigned to 2 groups according to their main swimming event as follows: long-distance swimmers (major event: 400–1500 m swim, n = 38) and short-distance swimmers (major event: 50–100m swim, n = 42). All swimmers were
Data Analysis The SPSS statistical package, version 20.0, was used to perform all statistical evaluations (SPSS, Chicago, IL,
Table 1 Athlete and Control Subjects’ Data Group
n
Main Event
M/F
Top/National Level
Age (Mean + SD, range)
Long-distance swimmers
38
400–1500 m
22/16
9/29
25.3+9.3 (16–48)
Short-distance swimmers
42
50–100 m
27/15
8/34
23.1+7.6 (16–49)
Controls
217
nr
137/80
nr
26.4+5.8 (19–29)
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
472 Ben-Zaken et al
USA). A χ2 test was used to confirm that the observed genotype frequencies were in Hardy-Weinberg equilibrium, and to compare alleles and genotype frequencies between swimmers and controls. If observed or expected values included a cell with a value of 5, we used Fisher’s exact test to compare alleles and genotype frequencies.
frequency of the AA carriers among the short-distance swimmers (26% versus 46% among short-distance and control participants, respectively; χ2 (2) =8.41, p < .01, Figure 2).
Results
We studied the presence of the C-1245T SNP (rs35767), a nucleotide substitution in the promoter region of the IGF-I gene, in elite long and short-distance swimmers compared with nonphysically active controls. The rare T/T polymorphism was found only in 5.3% of the long-distance swimmers, and was not found at all in the short-distance swimmers or among the control group participants. In addition, we studied the presence of the 275124A > C SNP (rs1464430), a common nucleotide substitution in the intron region of the IGF-IR gene, in the elite long- and short-distance swimmers. In contrast to our hypothesis, the prevalence of the AA genotype was significantly lower in the swimming group as a whole (35%) compared with the control group (46%), in particularly due to reduced frequency of the AA genotype among short-distance swimmers (26%). The regulatory effect of the IGF-I gene on muscle hypertrophy and age-related decreases in muscle mass and strength (19,27), the consequent reduction in functional abilities and increased risk of falling and fractures (17,26), have led investigators to study the effect of the
Discussion
The complete data on allele and genotype frequencies of the IGF-I C-1245T and IGF-IR 275124A > C SNP are shown in Table 2. IGF-I C-1245T genotype distribution was in agreement with the Hardy-Weinberg equilibrium within the 3 groups (p < .05). Genotype subtype did not differ by age or gender. The long-distance and shortdistance swimmers allele and genotype frequencies did not differ significantly from those of the control group (Figure 1). We observed that the TT genotype was very rare among long-distance swimmers (5.3%), and was not found at all in short-distance swimmers or among the control group. The IGF-IR 275124A > C genotype distribution was in agreement with the Hardy-Weinberg equilibrium within the 3 groups (p > .05). Genotype subtype did not differ by age or gender. All swimmers’ genotype frequencies differed significantly from the control group (AA carriers: 35% versus 46%, respectively; χ2 = 6.11, d.f.= 2, p < .05; Figure 2). This was mainly due to reduced
Table 2 The IGF1 C-1245T and IGF-IR 275124A > C Genotype and Allele Frequencies in All Groups Genotype Frequency Group
Allele Frequency
n
CC
CT
TT
T-allele carriers
C-allele
T-allele
Long-distance swimmers
42
23(61)
13(34)
2(5)
15(39)
59(78)
17(22)
Short-distance swimmers
38
29(69)
13(31)
0(0)
13(31)
71(85)
13(15)
All swimmers
80
52(65)
26(33)
2(2)
28(35)
130(81)
30(19)
Controls
159
119 (75)
40 (25)
0(0)
40(25)
278 (87)
40 (13)
n
AA
AC
CC
C-allele carriers
A-allele
C-allele
42
18(43)
18(43)
6(14)
24(57)
54(64)
30(36)
Short-distance swimmers
38
10(26)*
20(53)*
8(21)*
28(74)
40(52)#
36(48)#
All swimmers
80
28(35)**
38(48)**
14(18)**
52(65)
94(59)##
66(41)##
Controls
96
44(46)
46(48)
6(6)
52(54)
134(70)
58(30)
IGF1 C-1245T (rs35767)
Genotype Frequency
Allele Frequency
IGF-IR 275124A>C (rs1464430) Long-distance swimmers
Note. Values are absolute (relative frequencies in parentheses). *χ2 (2) =8.41, p < .01, genotype frequency, short-distance swimmers vs. controls. **χ 2 (2) =6.11, p < .05, genotype frequency, all swimmers vs. controls. # χ 2 (1) =7.04, p < .01, allele frequency, short-distance swimmers vs. controls. ## χ 2 (1) =4.66, p < .05, allele frequency, all swimmers vs. controls.
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
IGF-I and IGF-I Receptor Polymorphisms 473
Figure 1 — The IGF1 C-1245T polymorphism (1a: genotype frequencies, 1b: allele frequencies) in swimmers and controls.
C-1245T SNP (rs35767) polymorphism, mainly among the elderly. It was suggested that the C/C genotype of rs35767 is associated with lower levels of IGF-I in skeletal muscle, potentially leading to the increased adiposity and reduced muscle mass of elderly women (13). Furthermore, it was shown that carriers of the T/T genotype in the IGF-I promoter region demonstrated a significantly greater muscle strength gain following strength training intervention, compared with noncarriers (12). These studies suggested that the IGF-I promoter polymorphism is responsible not only for muscle mass, but also for its response to strength training. Interestingly, only 2 studies examined the variation of the IGF-I promoter in professional athletes. The frequency of the IGF-I promoter polymorphism was significantly greater among athletes (9.2%) compared with nonactive controls (2.4%). Moreover, a considerably higher
sequence frequency was found among strength athletes (11%) compared with team-sport athletes (7.8%) (15). Consistent with these results, we recently demonstrated a higher frequency of the T/T polymorphism among athletes (4.8%), compared with nonexistence among controls (1). Despite an equal polymorphism distribution among endurance and power athletes, one of the most interesting findings of that study was that while the 4 endurance athletes were of national level, the 4 power athletes were elite-level athletes (international and Olympic). In addition, overall, the T allele was found significantly more frequently in the top-level power athletes. These results suggest that the IGF-I T/T polymorphism possible association’s with muscle mass increase is more important to power sport excellence. Thus, the results of the current study were surprising, since only 2 long-distance swimmers carried the T/T genotype and the T/T genotype was
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
474 Ben-Zaken et al
Figure 2 — The IGF-IR 275124A > C polymorphism (1a: genotype frequencies, 1b: allele frequencies) in swimmers and controls. *χ2 (2) =8.41, p < .01, genotype frequency, short-distance swimmers vs. controls. **χ2 (2) =6.11, p < .05, genotype frequency, all swimmers vs. controls. #χ2 (1) =7.04, p < .01, allele frequency, short-distance swimmers vs. controls. ##χ2 (1) =4.66, p < .05, allele frequency, all swimmers vs. controls
not found at all in the short-distance swimmers or among the control group participants. The results may suggest, therefore, that the C-1245T SNP (rs35767) is probably less important for swimming than for running excellence, and cannot be used as a possible marker for sports selection among swimmers at early ages. Consistent with this speculation, IGF-I levels were similar among adolescent female swimmers compared with untrained controls (8), and were even reduced in synchronized swimmers (18). IGF-I levels were unchanged following intense water polo practice among adolescent females (22). Only a single study demonstrated an increase in total and free IGF-I levels following intense training and maintenance of these levels among collegiate swimmers (14). In contrast to the relationship between exercise and IGF-I, much less is known about exercise-associated
effects of the IGF-IR. The majority of studies focused on the importance of IGF-IR in mediating exercise training-related cardiac hypertrophy (9,11,28). Human studies indicated that polymorphisms in the IGF-IR gene were associated with left ventricular mass in male athletes (10). Endurance training was associated with up-regulation of IGF-I binding to erythrocyte IGF-IR in adolescent males (16). Whether there is an organ-specific (eg, cardiac) association between exercise and IGF-IR is currently unknown. Further studies are needed to clarify the relationship between exercise and IGF-IR in other organs (eg, skeletal muscle). We recently demonstrated (2) that the IGF-IR AA genotype, known to mediate exercise-related cardiac hypertrophy, was significantly higher in endurance compared with the power track and field athletes, but did
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
IGF-I and IGF-I Receptor Polymorphisms 475
not differ from control participants. Interestingly, there was no significant difference in the prevalence of the AA genotype between elite and national level endurance athletes. This suggests that while IGF-IR AA genotype is one of the SNPs that may promote endurance over power athletic performance, its presence is not associated with top-level endurance performance. In addition, the prevalence of the IGF-IR AA polymorphism was significantly lower among elite compared with national level power track and field athletes (17% versus 42%, p < .05), suggesting the possibility that its presence prevents excellence in power sports. It was therefore suggested that IGF-IR polymorphism may possibly distinguish between the 2 ends of the endurance-power athletic performance spectrum. However, the use this information for sport selection and prediction of athletic success still needs to be explored. In contrast to our hypothesis, despite rather similar endurance and sprint/power characteristics for track and field athletes, the AA genotype was not more prevalent among long-distance swimmers. However, consistent with the findings in power/sprint track and field athletes, the prevalence of the AA genotype was significantly reduced among short-distance swimmers. These results may imply that the presence of the AA genotype may have negative effect on short-distance swimming success. In addition, the results indicate that different sports disciplines (eg, swimming and track and field) may have different genetic polymorphisms, despite seemingly similar metabolic characteristics. Thus, combining different disciplines for sports genetic research purposes should not be done, or at least be done with extreme caution. The identification of relevant genes for athletic excellence is difficult, mainly because each gene makes a small contribution to overall heritability. However, these efforts are important when geared to young ages. Directing children to exercise intensely above their limits or to specialize in a single sport is generally discouraged before adolescence. Despite this, many children do specialize in a sport event on early age, and compete at the elite level. In several Olympic sports, the selection processes to identify future winners and to specialize in training starts even before elementary school. Moreover, media coverage of sports events frequently focuses on the very talented young competitors (29). On top of this, sportstalented prepubertal children often excel in more than 1 type of sport, such as aerobic, anaerobic, individual, and team sports (7), adding to the complexity of sports selection at a young age. Therefore, identification of a sport event that best matches the athlete’s ability at a proper age seems crucial for competitive sports success. Genetic polymorphism is suggested as an additional tool to assist in sport selection. The results of the current study suggest that in contrast to elite endurance and power track and field athletes, single nucleotide polymorphisms of IGF-I and the IGF-IR were not frequent among elite Israeli shortand long-distance swimmers. Moreover, the IGF-IR AA polymorphism was significantly less frequent among
short-distance swimmers compared with controls, possibly implying that its presence may prevent success. Whether a multipotent athlete who wants to develop a competitive career and carries a lower frequency of the IGF-IR AA polymorphism should prefer swimming and not select endurance track and field is currently speculative. Moreover, it should be noted that while a favorable genetic predisposition is essential, psychological and environmental factors, including training equipment and facilities, nutrition, familial support, and motivational factors, are also imperative for top-level sports development.
References 1. Ben-Zaken S, Eliakim A, Nemet D, Rabinovich M, Kassem E, Meckel Y. Differences in MCT1 A1470T polymorphism prevalence between runners and swimmers. Scand J Med Sci Sports. 2014; Epub ahead of print. 2. Ben-Zaken S, Meckel Y, Nemet D, Eliakim A. IGF-I receptor 275124A>C (rs1464430) polymorphism and athletic performance. J Sci Med Sport. 2014; Epub ahead of print. 3. Canzian F, McKay JD, Cleveland RJ, et al. Polymorphisms of genes coding for insulin-like growth factor 1 and its major binding proteins, circulating levels of IGF-I and IGFBP-3 and breast cancer risk: results from the EPIC study. Br J Cancer. 2006; 94(2):299–307. PubMed doi:10.1038/sj.bjc.6602936 4. Eliakim A, Brasel JA, Mohan S, Barstow TJ, Berman N, Cooper DM. Physical fitness, endurance training, and the growth hormone-insulin-like growth factor I system in adolescent females. J Clin Endocrinol Metab. 1996; 81(11):3986–3992. PubMed 5. Eliakim A, Nemet D. Exercise training, physical fitness and the growth hormone-insulin-like growth factor-1 axis and cytokine balance. Med Sport Sci. 2010; 55:128–140. PubMed doi:10.1159/000321977 6. Eliakim A, Scheett TP, Newcomb R, Mohan S, Cooper DM. Fitness, training, and the growth hormone®insulinlike growth factor I axis in prepubertal girls. J Clin Endocrinol Metab. 2001; 86(6):2797–2802. PubMed 7. Gonçalves CEB, Rama LML, Figueiredo AB. Talent identification and specialization in sport: an overview of some unanswered questions. Int J Sports Physiol Perform. 2012; 7(4):390–393. PubMed 8. Gruodyte R, Jürimäe J, Saar M, Jürimäe T. The relationships among bone health, insulin-like growth factor-1 and sex hormones in adolescent female athletes. J Bone Miner Metab. 2010; 28(3):306–313. PubMed doi:10.1007/ s00774-009-0130-2 9. Ikeda H, Shiojima I, Ozasa Y, et al. Interaction of myocardial insulin receptor and IGF receptor signaling in exerciseinduced cardiac hypertrophy. J Mol Cell Cardiol. 2009; 47(5):664–675. PubMed doi:10.1016/j.yjmcc.2009.08.028 10. Karlowatz R-J, Scharhag J, Rahnenführer J, et al. Polymorphisms in the IGF1 signalling pathway including the myostatin gene are associated with left ventricular mass in male athletes. Br J Sports Med. 2011; 45(1):36–41. PubMed doi:10.1136/bjsm.2008.050567
Downloaded by Northern Illinois University on 09/16/16, Volume 26, Article Number 4
476 Ben-Zaken et al
11. Kim J, Wende AR, Sena S, et al. Insulin-like growth factor I receptor signaling is required for exercise-induced cardiac hypertrophy. Mol Endocrinol. 2008; 22(11):2531–2543. PubMed doi:10.1210/me.2008-0265 12. Kostek MC, Delmonico MJ, Reichel JB, et al. Muscle strength response to strength training is influenced by insulin-like growth factor 1 genotype in older adults. J Appl Physiol. 2005; 98(6):2147–2154. PubMed doi:10.1152/ japplphysiol.00817.2004 13. Kostek MC, Devaney JM, Gordish-Dressman H, et al. A polymorphism near IGF1 is associated with body composition and muscle function in women from the Health, Aging, and Body Composition Study. Eur J Appl Physiol. 2010; 110(2):315–324. PubMed doi:10.1007/s00421-0101500-0 14. Koziris LP, Hickson RC, Chatterton RT, et al. Serum levels of total and free IGF-I and IGFBP-3 are increased and maintained in long-term training. J Appl Physiol. 1999; 86(4):1436–1442. PubMed 15. Krych-Garsztka K, Mizgajska-Wiktor H, GozdzuckaJojefiak A. An analysis of the regulatory region of the IGF1 gene in professional athletes in youth sports teams. Hum Mov. 2011; 12(3):216–222. 16. Lee C, Eliakim A, Brasel JA, Cooper DM. Effect of exercise training on erythrocyte insulin-like growth factor-I receptor binding in adolescent males. J Pediatr Endocrinol Metab. 2000; 13(6):621–627. PubMed doi:10.1515/ JPEM.2000.13.6.621 17. Lord SR, Ward JA, Williams P, Anstey KJ. Physiological factors associated with falls in older community-dwelling women. J Am Geriatr Soc. 1994; 42(10):1110–1117. PubMed 18. Ludwa IA, Falk B, Yao M, Corbett L, Klentrou P. Bone speed of sound, bone turnover and IGF-I in adolescent synchronized swimmers. Pediatr Exerc Sci. 2010; 22(3):421–430. PubMed 19. Lynch NA, Metter EJ, Lindle RS, et al. Muscle quality. I. Age-associated differences between arm and leg muscle groups. J Appl Physiol. 1999; 86(1):188–194. PubMed 20. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated
cells. Nucleic Acids Res. 1988; 16(3):1215. PubMed doi:10.1093/nar/16.3.1215 21. Nemet D, Eliakim A. Growth hormone-insulin-like growth factor-1 and inflammatory response to a single exercise bout in children and adolescents. Med Sport Sci. 2010; 55:141–155. PubMed doi:10.1159/000321978 22. Nemet D, Rose-Gottron CM, Mills PJ, Cooper DM. Effect of water polo practice on cytokines, growth mediators, and leukocytes in girls. Med Sci Sports Exerc. 2003; 35(2):356–363. PubMed doi:10.1249/01. MSS.0000048722.84182.E3 23. Palles C, Johnson N, Coupland B, et al. Identification of genetic variants that influence circulating IGF1 levels: a targeted search strategy. Hum Mol Genet. 2008; 17(10):1457–1464. PubMed doi:10.1093/hmg/ddn034 24. Patel AV, Cheng I, Canzian F, et al. IGF-1, IGFBP-1, and IGFBP-3 polymorphisms predict circulating IGF levels but not breast cancer risk: findings from the Breast and Prostate Cancer Cohort Consortium (BPC3). PLoS ONE. 2008; 3(7):e2578. PubMed doi:10.1371/journal.pone.0002578 25. Philippou A, Halapas A, Maridaki M, Koutsilieris M. Type I insulin-like growth factor receptor signaling in skeletal muscle regeneration and hypertrophy. J Musculoskelet Neuronal Interact. 2007; 7(3):208–218. PubMed 26. Rantanen T, Era P, Heikkinen E. Physical activity and the changes in maximal isometric strength in men and women from the age of 75 to 80 years. J Am Geriatr Soc. 1997; 45(12):1439–1445. PubMed 27. Reed RL, Pearlmutter L, Yochum K, Meredith KE, Mooradian AD. The relationship between muscle mass and muscle strength in the elderly. J Am Geriatr Soc. 1991; 39(6):555–561. PubMed 28. Scheinowitz M, Kessler-Icekson G, Freimann S, et al. Short- and long-term swimming exercise training increases myocardial insulin-like growth factor-I gene expression. Growth Horm IGF Res. 2003; 13(1):19–25. PubMed doi:10.1016/S1096-6374(02)00137-5 29. Valovich McLeod TC, Decoster LC, Loud KJ, et al. National Athletic Trainers’ Association position statement: prevention of pediatric overuse injuries. J Athl Train. 2011; 46(2):206–220. PubMed doi:10.4085/1062-6050-46.2.206
