59

Mrus Research, 20 (1991) 59-69 0 1991 Elsevier Science Publishers B.V. 0168-1702/91/$03.50 ADONIS 0168170291000928

VIRUS

00671

Identification of two protein binding sites within the varicella-zoster virus major immediate early gene promoter Tom A. McKee * and Chris M. Preston Znstitute of virology, Glasgow, (Accepted

15 March

UX

1991)

Summary Binding sites for cellular proteins in the promoter of the varicella-zoster virus (VZV) major immediate early (IE) gene were investigated. Protein binding was detected at sequence motifs possessing homology to the CCAAT element and an ATF/AP-l-like binding site, and recognition of the ATF/AP-1 site was apparently facilitated by occupation of the CCAAT site. Gene expression directed by the VZV major IE promoter was stimulated by the adenovirus 5, 289 amino acid EIA gene product. The implications of the results for VZV gene expression and replication are discussed. Varicella-zoster

virus transcription;

Protein binding to DNA

Introduction Varicella-zoster virus (VZV), an alphaherpesvirus, is a human pathogen that causes chicken pox and shingles. Despite the efficient replication and spread of VZV during infection of an individual, the virus is difficult to propagate and study in tissue culture. As a consequence, biochemical investigations on virus gene expression and replication have been hindered. The availability of the entire * Present address: Scripps Clinic and Research Foundation, Dept. of Neuropharmacology, 10666 North Torrey Pines Road, La Jolla, CA 92037-1093, U.S.A. Correspondence to: C. Preston, Institute of Virology, Church Street, Glasgow Gil 5JR, U.K.

60

nucleotide sequence of the VZV genome (Davison and Scott, 1986) enables plasmid-based studies to be carried out, thereby circumventing many of the problems encountered in working with the virus. As found with other alphaherpesviruses, a distinct class of genes, the immediate early (IE) genes, can be identified as the first class to be expressed after VZV infection of tissue culture cells (Shiraki and Hyman, 1987). The major IE gene is located in each copy of the repeat region of the genome and encodes a 140,000 molecular weight protein which functions as a transactivator in transfection assays (Everett and Dunlop, 1984; Everett, 1984; Davison and Scott, 1986; Inchauspe et al., 1989; Disney and Everett, 1990). Investigation of the control of expression of the major IE gene (McKee et al., 1990) showed that the DNA region located upstream of the IE mRNA cap site could be classified into a promoter, represented by sequences between - 131 and +57, and an upstream region between - 410 and - 131. The upstream region contains sequences that respond to activation by the herpes simplex virus type 1 (HSV-1) virion protein Vmw65 (VP16), whereas the promoter was required for ‘basal’ expression in the absence of Vmw65. Binding sites for the cellular protein act-1 were found in the upstream region (McKee et al., 1990). Surprisingly, the VZV IE promoter and upstream regions are far less efficient at directing gene expression than the corresponding sequences from HSV-1 or human cytomegalovirus (HCMV) (McKee et al., 1990), and it is possible that the lower efficiency of IE gene expression is partly responsible for the inefficient replication of VZV in tissue culture systems. We report here a characterisation of protein binding sites within the VZV promoter using the gel retardation (band shift) technique. Two distinct factors, one a CCAAT-binding protein and the other a member of the ATF/AP-1 family, bind to the promoter and may influence the regulation of VZV IE gene expression.

Materials and Methods Cells HeLa cells (Flow Laboratories) were grown as monolayer cultures in Dulbecco’s medium containing 2.5% newborn and 2.5% foetal calf serum, with added penicillin (100 U/ml) and streptomycin (100 pg/ml). Plasmids

Plasmid pBLW2 contains the chloramphenicol acetyl transferase (CAT) gene with an array of unique restriction endonuclease cleavage sites upstream from the structural gene (Gaffney et al., 1985). DNA sequences from - 1146 to +57 with respect to the VZV major IE mRNA were cloned upstream of CAT to yield pl40CAT, as described previously (McKee et al., 1990). A plasmid containing a 5’ deletion to an X/z01 site at - 131, p14OA131CAT, has also been described

61 Xhol

CCAAT

CATGGAACTTCCCGCCTCGAGTCTCGTCCAATCACTACATCGTCTTATCA

-95

ATFlAP-

SW1

TTAAGAATATTTACACGGTGACGACACGGGGAGGAAATATGCGGTCGAGG

-45 mRNA

Afllll

TATA

GGGGGGCACAACACGTTTTAAGTACTGTTGGAACTCCCTCACCAA

L-CGCA

+5

Fig. 1. Nucleotide sequence of the VZV IE promoter from - 145 to +5. The mRNA cap sites, TATA, CCAAT and ATF/AP-1 homologies, and relevant restriction endonuclease cleavage sites are shown. For reference, -145 and +5 correspond to nucleotides 120547 and 120696, respectively, in TR,, as designated by Davison and Scott (1986).

previously (McKee et al., 1990). Plasmid pVZVBH was constructed by a two-step procedure from the genomic clone of Sst I f (Davison and Scott, 1983). A 1266 base pair (bp) DdeI/HindIII fragment from SstI f was cloned between the PstI (blunt ended) and Hind111 sites of pUC9. A BumHI (from pUC9)/ScaI fragment, representing nucleotides - 782 to - 25, was then excised and cloned between the BumHI and HincII sites of pUC9, to yield pVZVBH. Plasmids that express the “12s” (243 amino acid) or “13s” (289 amino acid) product of the adenovirus 5 EIA gene were kindly provided by Dr N. Jones. DNA fragments and oligonucleotides

DNA fragments were excised from pVZVBH, purified and radiolabelled for gel retardation assays. Oligonucleotides containing CCAAT and TAATGARAT (R = purine) sequences were synthesised by Dr J. McLauchlan. The sequences were (top strand only) GATCCGTGTICGAATTCGCCAATGACAAGACGCA and AGCTTGCCTCATGAGTGCGGTAATGAGATGCGACTG, respectively. Oligonucleotides 1 and 2, representing sequences from - 138 to - 104 and - 109 to -59 in the VZV IE promoter (Fig. l), were synthesised by Dr J. McLauchlan. Oligonucleotides BS2wt, containing an ATF binding site, BS3wt, containing an AP-1 binding site and BS2/4, containing a point mutation that abolishes binding (Hurst and Jones, 19871, were kindly provided by Drs H. Hurst and N. Jones, Imperial Cancer Research Fund Laboratories, Lincoln’s Inn Fields, London, U.K. Gel retardation assays Preparation of HeLa cell nuclear extracts, radiolabelling of fragments and gel retardation assays were performed as described by McKee et al. (1990). Transfection and CAT assays

Transfection of HeLa cells and subsequent described by McKee et al. (19901.

CAT assays were performed

as

62

Results

Previous work has shown that the functional promoter of the VZV IE gene lies within nucleotides - 131 and +57 with respect to the mRNA cap site (McKee et al., 1990). In preliminary studies, binding of HeLa cell nuclear proteins to this region was investigated by the gel retardation technique. Formation of proteinDNA complexes was detected with a probe spanning nucleotides - 131 to -25, whereas none was observed using a fragment representing - 25 to + 197 (results not shown). Inspection of the - 131 to -25 region revealed the presence of two sequence elements that correspond to known protein binding sites (Fig. 1). At - 121 to - 111, CGTCCAATCAC is homologous to the CCAAT box, which is recognised by at least three cellular factors, C/EBP, CTF/NFl and CP1/2 (Graves et al., 1986; Jones et al., 1987; Chodosh et al., 1988). Between -78 and - 71, the element TGACGACA resembles the related ATF/CREB (TGACGTCA) and the AP-1 (TGACTCA) consensus binding sites. The possibility that these factors bind to the sequences identified in the VZV IE promoter was investigated. Radiolabelled DNA fragments were incubated with HeLa cell nuclear extract, and protein-DNA complexes resolved on 3.5% native polyacrylamide gels. An AflIII/SspI fragment, representing sequences between -246 and -90, gave a single major complex (Fig. 2A, lane 1, labelled n), whereas an xhoI/AflIII fragment representing the region - 131 to - 35 gave two prominent bands (Fig. 2A, lane 21, one ( n ) comigrating with the complex in lane 1, the other (0) a diffuse slowly migrating band. An SspI/AflIII (-90 to -35) fragment gave multiple bands (Fig. 2A, lane 3, bracketed), the major pair migrating more rapidly than the complex observed in lane 1. Addition of a lOO-fold excess of double stranded oligonucleotide spanning the CCAAT (oligo 1) and ATF/AP-1 (oligo 2) sites competed for the formation of the complexes, but in an unexpected manner. The presence of both oligonucleotides effectively abolished complex formation (Fig. 2B, lane 41, while oligo 2 alone competed for the upper complex without affecting the lower one (Fig. 2B, lane 3). Addition of oligo 1, however, competed for the formation of both complexes (Fig. 2B, lane 2). The results suggested that CCAAT and ATF/AP-l-related proteins are the major factors that bind to the VZV IE promoter. Further competition experiments were performed to confirm this conclusion. Oligonucleotides previously characterised by their abilities to bind ATF and AP-1 (Hurst and Jones, 1987) were used as probes and competitors in gel retardation assays (Fig. 3). An oligonucleotide containing an ATF site formed a major complex (Fig. 3, lane 1, labelled + > which was competed strongly by the homologous oligonucleotide (lane 21, weakly by an AP-1 site-containing oligonucleotide (lane 3) and not by 2/4, which contains a point mutation that abolishes the binding of ATF and AP-1 (lane 4). Similarly, in lanes 5-8, a complex formed by protein binding at the AP-1 site (lane 5, labelled o) was competed by the homologous oligonucleotide (lane 7) but not by the ATF site-containing oligonucleotide or 2/4 (lanes 6 and 8). These results are in agreement with previous findings using the same oligonucleotides (Hurst and Jones, 1987). When a fragment representing sequences from - 131 to - 25 in the

63

Afllll -246

Xhol -131

Afllll -35

Sspl -90

I~ATA

ATWCRE TGACGACA

CCAAT CGTCCAATCAC

1

TTTTAA

. :.....................‘.................*..

oligo 2

oligo 1

Section

Section

A

Probe

:- Afilil~ Xholi SspU Sspl AfUll Afltll

Lane

:-

1

2

3

B

Probe

:- X~oi~Afllll

Competitor

:-

-

Lane

:-

1

fragment oli 1 oli 2 o’i’/oli2 2

3

4

Fig. 2. Proteins binding to the VW IE promoter. Section A shows gel retardation assays with radiolabelied AflIII/SspI (- 246 to -90, lane I), ~oI/~~III (- 131 to - 35, lane 2) or SspI/Af2III (-90 to - 35, lane 3) fragments. Section B shows a gel retardation assay using radiolabelled .WzoI/AflIII (- 131 to -35) fragment, and either no competitor (lane 1) or a lOCkfold molar excess of oligo 1 (lane 21, oligo 2 (lane 3) or oligos 1 and 2 (lane 4).

64 Probe

ATF oligo

:-

Competitor :Oligonucleotide

_

Lane

1

:-

ATF

APl

2345678

APl oligo Z/4

-

ATF

APl

XholiHindlll 214

fragment

-

ATF

AP1

214

9

IO

11

12

Fig. 3. Competition with ATF and AP-l-specific oligonucleotides. Gel retardation out using radiolabelled ATF (lanes l-4) or AP-I (lanes 5-8) oligonucleotides, or a ing - 131 to -25 in the VSV IE promoter (lanes 9-12). No competitor (lanes 1, 5 molar excess of ATF (lanes 2, 6 and lo), AP-1 (lanes 3, 7 and 11) or mutant 2/4 oligonucleotides was added.

of pVZVBH

assays were carried fragment representand 9) or a 100.fold (lanes 4, 8 and 12)

VZV IE promoter was tested, two complexes (labelled n and 0) were observed, as expected from the results shown in Fig. 2. Both the ATF and AP-1 site-containing oligonucleotides competed for the formation of the slower migrating complex (lanes 10 and ll), whereas 2/4 competed only slightly (lane 12). Upon competition

65

Probe

:-

Competitor :Oligon~cleotides Lane

:-

Xhol/Hindlll -

12

CAAT

fragment ATF

34

of pVZVBH

CAATCAATATF

TG

Ah

;,4

d-4

;G

567

Fig. 4. ~m~tition with ATF or CCAAT-specific oligonucleotides. Details are as in the legend for Fig. 3, except that either no competitor (lane I), or CCAAT (lane Z), ATF (lane 31, CCAAT plus ATF (lane 4), CCAAT plus mutant 2/4 (lane 51, ATF plus TAATGARAT (lane 6) or TAATGARAT plus mutant 2/4 (lane 7) oligonucleotides were added.

66

for the slower migrating complex, more probe was associated with the faster migrating (presumably CCAAT-specific) complex (lanes 10 and 11). Additional competition experiments were carried out using an oligonucleotide containing the HSV-1 thymidine kinase (TK) CCAAT sequence and a control containing the HSV-1 IE-specific TAATGARAT element (Fig. 4). The CCAAT and TAATGARAT-containing oligonucleotides were equal in size and GC content. Addition of the CCAAT oligonucleotide competed strongly for the formation of the two major complexes (lanes 2, 4 and 5, labelled H and 0) as also shown in Fig. 2B, lane 2, whereas the ATF oligonucleotide competed only for the upper complex (lanes 3 and 61, as expected from the results in Figs. 2B and 3. The experiments show that a CCAAT binding protein and a member of the ATF/AP-1 family bind to the promoter region of the VZV IE gene. Binding at CCAAT was readily observed but binding at the ATF/AP-1 site was more easily detected as an additional band shift when CCAAT is occupied. This observation suggests the possibility of cooperation between the two proteins that bind to the - 131 to -35 region, and in particular facilitation of binding to the ATF/AP-1 site when the CCAAT site on the same oligonucleotide molecule is occupied. Binding of ATF can confer responsiveness to transactivation by the adenovirus EIA protein in certain cases, thus it was of interest to investigate whether the VZV IE promoter is responsive to EIA. A plasmid containing the CAT gene under the control of the VZV IE promoter, to position - 131, was transfected into HeLa cells together with plasmids that express the active “13s” (289 amino acid) or inactive “12s” (243 amino acid) EIA proteins, and the accumulation of CAT was assayed (Fig. 5). The presence of the active EIA product resulted in a stimulation of approximately 7-fold (lane 21, whereas the inactive product had no effect (lane 1). No detectable CAT activity was specified by pBLW2, the vector without the VZV IE promoter (lanes 4-6). Therefore, the VZV IE promoter is responsive to stimulation by the adenovirus EIA protein. Reporter Plasmid Cotransfected with Lane

CAT

:::-

p1401?1131~~~ 12s 13s pUC 1 2 3

12s 4

pBLW2 13s put 5 6

MT 7

Activity

Normalised Fig. 5. Stimulation of expression from the VZV IE promoter were transfected with ~140 131CAT (lanes l-3) or pBLW2 expressing the adenovirus EIA ‘12s’ (lanes 1 and 4), ‘13s’ (lanes 3 and 6). CAT production by mock-transfected

by adenovirus EIA protein. HeLa cells (lanes 4-61, together with a plasmid 2 and 5) products, or with pUC9 (lanes cells is shown in lane 7.

Discussion The experiments presented here demonstrate that binding sites for two members of ubiquitous transcription factor families exist in the WV major IE promoter, in addition to the act-1 recognition sites in the upstream region (McKee et al., 1990). The SCAT-binding and ATF/AP-1 families both consist of a heterogeneous group of proteins and further work, using purified components, will be necessary to determine the exact identities of the factors involved. Nevertheless, the characterisation of binding sites, and particularly the demonstration of an ATF/AP-1 site, provide a basis for further studies to investigate the regulation of VZV IE transcription. The CCAAT element is commonly found in eukaryotic promoters at approximately the same position as it exists in the VZV major IE promoter (- 128 to - 124). At least three distinct families of CCAAT-binding proteins have been described. One of these, CTF/NFI, is both a tran~ription and replication factor which was initialiy characterized by its binding to the human @-globin CCAAT box and to the adenovirus origin of DNA replication (Jones et al., 1987). A distinct protein, first recognised by its binding to the HSV-1 TK gene CCAAT box, is a transcription factor named C/EBP (Graves et al., 1986). The third set of CC~T-binding proteins is represented by CPl and CP2. These act as homo- or heterodimers and share functional homology with the yeast proteins HAP-2 and HAP-3, which control catabolite derepression of cycl expression in Succharclmyces cereuisiue (Chodosh et al., 1988). Competition experiments show that an additional protein, with affinity for oligonucleotides containing ATF or AP-1 sites, binds to the VZV major IE promoter. The binding is difficult to detect in the absence of CCAAT occupation, and probably results in the formation of the two complexes which migrate more rapidly than the CCAAT-containing species. The protein responsible is unlikely to be the ATF or AP-1 factors defined by the oligonucleotides used, since the complexes migrate at different rates. In addition, the base change in the VZV ATF-like site from the consensus (TGACGACA instead of TGACGTCA) abolishes the binding of one member of the ATF family when introduced, as a point mutation, into the ATF-response element of the phosphoenol pyruvate carboxykinase (GTP) gene promoter (Bokar et al., i988). The ATF factors comprise a complex family of at least 8 distinct proteins that have .different regulation properties and DNA-binding specificities (Hai et al., 1990). Furthermore, a heterogeneous group of proteins is capable of binding to AP-1 sites (Rauscher et al., 1988; Ryder et al., 1988). Identi~cation of the factor that binds to the VZV ATF/AP-l-like site will require the use of purified protein fractions or products expressed from cloned cDNAs. The competition experiments suggest that binding of the ATF/AP-l-like factor is facilitated by binding of the CCAAT factor to a DNA fragment containing both sites. The simplest interpretation of this observation is that contacts exist between the two proteins, resulting in an increased affinity of the ATF/AP-1-Iike factor for its sequence and/or greater stability of the complex once formed, although other

68

explanations are possible. Protein-protein interaction is now recognised as an important feature of transcription regulation, but association between CCAATbinding and ATF or AP-1 factors has not, to our knowledge, been reported. Response to the adenovirus EIA protein can be mediated through ATF in certain circumstances, but the TATA binding factor TFIIID, and other proteins, can also act as targets for EIA stimulation of transcription (Flint and Shenk, 1989). Deletion of the VZV major IE promoter to -35, leaving only the TATA box, reduced the already low activity below the level of detection (unpublished results), thus it was not possible to determine which element was required for EIA responsiveness. The VZV IE TATA box, however, does not contain the motif TATAA that is required for EIA inducibility (Simon et al., 1988), thus it is likely that sequences further upstream mediate the response. The existence of EIA-like factors in certain cell types, and the documented changes in their levels or activities with alterations in cell differentiation and metabolism (LaThangue and Rigby, 1987), might influence the expression of the VZV major IE promoter. It may be that specific cell types possess a set of factors that recognise the VZV IE promoter efficiently, or contain enzymes that modify existing factors, thereby allowing the promoter to exhibit greater activity in vivo than is observed experimentally in tissue culture systems. A situation of this type may, at least partially, explain the apparent contradiction between the replication capabilities of VZV in natural infections and in tissue culture.

Acknowledgements We thank Professor J.H. Subak-Sharpe for his interest in the work. The gifts of plasmids and oligonucleotides from Drs H. Hurst and N. Jones are gratefully acknowledged. T.A.M. was a recipient of a Medical Research Council Training Fellowship.

References Bokar, J.A., Roesler, W.J., Vandenbark, G.R., Kaetzel, P.M., Hanson, R.W. and Nelson, J.H. (1988) Characterization of the CAMP responsive elements from the genes for the o-subunit of glycoprotein hormones and phosphoenolpyruvate carboxykinase (GTP). Conserved features of nuclear protein binding between tissues and species. J. Biol. Chem. 263, 19740-19747. Chodosh, L.A., Baldwin, A.S., Carthew, R.W. and Sharpe, P.A. (1988) Human C&UT-binding proteins have heterologous subunits. Cell 53, 11-24. Davison, A.J. and Scott, J. (1983) Molecular cloning of the varicalla-zoster virus genome and derivation of six restriction endonuclease maps. J. Gen. Viral. 64, 1811-1814. Davison, A.J. and Scott, J.E. (1986) The complete DNA sequence of varicella-zoster virus. J. Gen. Virol. 67, 1759-1816. Disney, G.H. and Everett, R.D. (1990) A herpes simplex virus type 1 recombinant with both copies of the Vmw175 coding sequence replaced by the homologous varicella-zoster virus open reading frame. J. Gen. Virol. 71, 2681-2689.

69 Everett, R.D. (1984) Transactivation of transcription by herpesvirus products. Requirements for two HSV-1 immediate-early polypeptides for maximum activity. Eur. Mol. Biol. Organ. J. 3, 3135-3141. Everett, R.D. and Dunlop, M. (1984) Transactivation of plasmid borne promoters by adenovirus and several herpes group viruses. Nucleic Acids Res. 12, 5969-5978. Flint, J. and Shenk, T. (1989) Adenovirus EIA protein paradigm viral transactivator. Ann. Rev. Genet. 23, 141-161. Gaffney, D.F., McLauchlan, J., Whitton, J.L. and Clements, J.B. (1985) A modular system for the assay of transcription regulatory signals: the sequence TAATGARAT is required for herpes simplex virus immediate early gene activation. Nucleic Acids Res. 13, 7847-7863. Graves, B.J., Johnson, P.F. and M&night, S.L., (1986) Homologous recognition of a promoter domain common to the MSV LTR and the HSV tk gene. Cell 44, 565-576. Hai, T., Liu, F., Coukos, W.J. and Green, M.R. (1990) Transcription factor ATF cDNA clones; an extensive family of leucine zipper proteins able to selectively form DNA-binding heterodimers. Genes Dev. 3, 2083-2090. Inchauspe, G., Nagpal, S. and Ostrove, J.M. (1989) Mapping of two varicella-zoster virus-encoded genes that activate the expression viral early and late genes. Virology 173, 700-709. Hurst, H.C. and Jones, N.C. (1987) Identification of factors that interact with the EIA-inducible adenovirus E3 promoter. Genes Dev. 1, 1132-1146. Jones, K.A., Kadonaga, J.T., Rosenfeld, P.J., Kelly, T.J. and Tjian, R. (1987) A cellular DNA-binding protein that activates eukaryotic transcription and DNA replication. Cell 48, 79-89. La Thangue, N.B. and Rigby, P.W.J. (1987) An adenovirus EIA-like transcription factor is regulated during the differentiation of murine embryonal carcinoma stem cells. Cell 49, 507-513. McKee, T.A., Disney, G.H., Everett, R.D. and Preston, C.M. (1990) Control of expression of the varicella-zoster virus major immediate early gene. J. Gen. Virol. 71, 8987-906. Rauscher, F.J., Cohen, D.R., Curran, T., Bos, T.J., Vogt, P.K. Bohmann, D., Tjian, R. and Franza, R. (1988) Fos-associated protein p39 is the product of the jun proto-oncogene. Science 240, 1010-1016. Ryder, K., Lau, L.F. and Nathans, D. (1988) A gene activated by growth factors is related to the oncogene v-jun. Proc. Natl. Acad. Sci. U.S.A. 85, 1487-1491. Shiraki, X. and Hyman, R.W. (1987) The immediate early proteins of varicella zoster virus. Virology 156, 423-426. Simon, M.C., Fisch, T.M., Benecke, B.J., Nevins, J.R. and Heintz, N. (1988) Definition of multiple, functionally distinct TATA elements, one of which is a target in the hsp70 promoter for EIA regulation. Cell 52, 723-729. (Received 14 January 1991; revision received 15 March 1991)