Gene 537 (2014) 51–62

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Identification of the glycerol kinase gene and its role in diapause embryo restart and early embryo development of Artemia sinica Cheng Cheng a, Feng Yao a, Bing Chu a, Xuejie Li a, Yan Liu a, Yang Wu a, Yanli Mei a, Peisheng Wang b, Lin Hou a,⁎, Xiangyang Zou b,⁎⁎ a b

College of Life Sciences, Liaoning Normal University, Dalian 116081, PR China Department of Biology, Dalian Medical University, Dalian 116044, PR China

a r t i c l e

i n f o

Article history: Accepted 11 December 2013 Available online 21 December 2013 Keywords: GK Artemia sinica Diapause termination Stress response

a b s t r a c t Glycerol kinase (GK) catalyzes the rate-limiting step in glycerol utilization by transferring a phosphate from ATP to glycerol, yielding glycerol 3-phosphate, which is an important intermediate for both energy metabolism and glycerolipid production. Artemia sinica has an unusual diapause process under stress conditions of high salinity, low temperature and lack of food. In the process, diapause embryos of A. sinica (brine shrimp) accumulate high concentrations of glycerol as a cryoprotectant to prevent low temperature damage to embryos. Upon embryo restart, glycerol is converted into glucose and other carbohydrates. Therefore, GK plays an important role in the diapause embryo restart process. However, the role of GK in diapause termination of embryo development in A. sinica remains unknown. In the present study, a 2096 bp full-length cDNA of gk from A. sinica (As-gk) was obtained, encoding putative 551 amino acids, 60.6 kDa protein. As a crucial enzyme in glycerol uptake and metabolism, GK has been conserved structurally and functionally during evolution. The expression pattern of As-gk was investigated by quantitative real-time PCR and Western blotting. Expression locations of As-gk were analyzed using in situ hybridization. As-gk was widely distributed in the early embryo and several main parts of Artemia after differentiation. The expression of As-GK was also induced by stresses such as cold exposure and high salinity. This initial research into the expression pattern and stress response of GK in Artemia provides a sound basis for further understanding of the function and regulation of genes in early embryonic development in A. sinica and the stress response. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Artemia sinica is a small crustacean distributed worldwide in hypersaline waters. It has been used economically as a main food resource for newly born fish and crustacean species in aquaculture because of its high protein and unsaturated fatty acid content in the nauplii. Artemia has a relatively short process of embryo development. It is easy to obtain and feed, which makes it a perfect animal model for experimental research of genetics, evolution, molecular biology, developmental biology,

Abbreviations: GK, glycerol kinase; As-gk, glycerol kinase gene of Artemia sinica; G3P, glycerol 3-phosphate; FBP, fructose-1,6-bisphosphate; PTS, phosphotransferase system; ISH, in situ hybridization; NJ, neighbor-joining; DIG, Digoxigenin; PBS, phosphatebuffered saline; DEPC, diethylpyrocarbonate; RT-PCR, real-time PCR; LSD, least square difference; ORF, open reading frame; PI, isoelectric point; GKD, glycerol kinase deficiency. ⁎ Correspondence to: L. Hou, College of Life Sciences, Liaoning Normal University, No. 1, Liushu South Street, Ganjingzi District, Dalian 116081, PR China. Tel./fax: + 86 411 85827082. ⁎⁎ Correspondence to: X. Zou, Department of Biology, Dalian Medical University, Dalian 116044, PR China. Tel.: +86 411 86110296. E-mail addresses: [email protected] (L. Hou), [email protected] (X. Zou). 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.12.029

ecology and other life science fields (Abatzopoulos et al., 2002). Artemia has an unusual diapause process under conditions of high salinity and low temperature stress (MacRae, 2010). During this process, diapause embryos accumulate high concentrations of glycerol as cryoprotectant to prevent low temperature damage to the embryos (Michaud and Denlinger, 2007). After diapause termination, glycerol is converted into glucose and other carbohydrates (Kihara et al., 2009). Diapause may be terminated under suitable conditions and embryos resume development. Previous studies demonstrated that glycerol kinase plays a vital role in embryo diapause termination of Bombyx mori (Kihara et al., 2009); however, the role of GK in glycerol metabolic process of diapause embryo restart and early embryonic development of A. sinica remains unknown. Glycerol is an important intermediate of energy metabolism that plays fundamental roles in several vital physiological processes. Glycerol metabolism provides a central link between sugar and fatty acid catabolism (Yeh et al., 2009). Glycerol kinase (ATP: glycerol 3phosphotransferase, GK) was first isolated and studied by Lin et al. in the 1960s and was extensively investigated in Escherichia coli (Lin, 1976). It catalyzes the rate-limiting step in glycerol utilization by transferring a phosphate from ATP to glycerol, thus yielding glycerol

52

C. Cheng et al. / Gene 537 (2014) 51–62

3-phosphate (G3P) in the cytoplasm (Aragon et al., 2008). As the phosphorylated form of glycerol, G3P can be converted to dihydroxyacetone phosphate by G3P dehydrogenase and fed into the glycolysis or gluconeogenesis pathways, according to the metabolic status of the cell (Schnick et al., 2009). Therefore, GK enables glycerol derived from fats or glycerides to enter the glycolytic/gluconeogenesis pathway and facilitate external glycerol to participate in cellular metabolism. Meanwhile, it is also an obligatory step in glycerolipid production (Agosto and McCabe, 2006). GK has been found throughout all three kingdoms of living organisms, from bacteria to humans. As a crucial enzyme in glycerol uptake and metabolism, it has been conserved both structurally and functionally during evolution (Koga et al., 1998). GK belongs to the FGGY family of carbohydrate kinases, a sub-family hierarchy of the NBD_sugarkinase_HSP70_actin superfamily (Pawlyk and Pettigrew, 2001). This family predominantly comprises GK and similar carbohydrate kinases, including rhamnulokinase (RhuK), xylulokinase (XK), gluconokinase (GntK), ribulokinase (RBK) and fuculokinase (FK). They show a high degree of structural similarity, even though they share little sequence similarity (Bork et al., 1992; Holmes et al., 1993). The FGGY proteins contain two large domains: the N-terminal domain that adopts a ribonuclease H-like fold, and the structurally related C-terminal domain (Agosto and McCabe, 2006). The N-terminal domain is primarily involved in substrate binding, while the C-terminal domain is mainly responsible for ATP binding. They are separated by a deep cleft that forms the active site (Pettigrew et al., 1996). The high affinity ATP binding site of GK is created only by a substrate-induced conformational change. GKs from different species may exist in different oligomeric states. The enzyme exists at physiological concentrations in equilibrium between functional dimers and tetramers (Riel and Paulus, 1978; Feese1 et al., 1998). The tetrameric protein is composed of identical subunits, but it can be dissociated into dimers at low protein concentrations (Riel and Paulus, 1978; Thorner and Paulus, 1971). GK is a regulatory enzyme that was shown to be subject to feedback regulation by the glycolytic intermediate, fructose-1,6bisphosphate (FBP), in a noncompetitive manner with respect to both substrates (Thorner and Paulus, 1973; Huang et al., 1998). FBP is said to bind to and stabilize only the tetrameric form, decreasing the dimer– dimer dissociation dramatically. IIAGlc, glycose phosphotransferase system (PTS) phosphocarrier protein, has been identified as another allosteric effector whose effect is independent of GK concentration over a wide range (Novotny et al., 1985; Mao et al., 1999). A lower metabolic rate is a vital survival strategy and common feature of diapause. Previous research showed that proteins related to carbohydrate and energy metabolism make up the largest proportion of the identified proteins in A. sinica undergoing diapause. This result further indicated that proteins, especially metabolic enzymes, may be the key factors in diapause regulation (Qiu and MacRae, 2007). In mammals, GK is already known as a key enzyme for the utilization of glycerol (Agosto and McCabe, 2006). There have been reports that GK also functions as a rate-limiting enzyme in insect diapause (Kihara et al., 2009). However, its corresponding role in crustacean metabolic regulation remains undetermined. In the present study, the gk gene from A. sinica was cloned and its expression levels during early embryonic development and in response to salinity/temperature stress were analyzed by real-time PCR. In addition As-GK was expressed in E. coli by a prokaryotic expression plasmid, pET30a. Meanwhile, the expression pattern of GK and the location of its gene expression were investigated using Western blotting and in situ hybridization (ISH), respectively. Our aims are to further understand the role of the glycerol metabolic process during diapause embryo restart and early embryonic development of A. sinica.

Table 1 Oligonucleotide primers used in this study. Primer

Sequence (5′–3′)

Direction

As-gkF As-gkR 3′As-gk(outer) 3′As-gk(inner) 5′As-gk ISH-gkF ISH-gkR RT-gkF RT-gkR ORF-gkF ORF-gkR β-actinF β-actinR

CTGGGAAAAACTAAACGACC GCTTGTATCTGAAGGAGGA GAAGGTTCTGTAGCCGTAGC TATTTTGTGCCCGCCTTCTC GCGGGCACAAAATAAACGCCACCAGAAT TGCGAATAGCAGTGGACGA CACACATCTGACCAAGAAGCG GCAATAGTTTGGTGCGATAA AGCAACAGGTAAGCCACAAT CGGAATTCATGGGAGACGCCTTA CCGCTCGAGTCACTGGGAAGCA AGCGGTTGCCATTTATTGTT GGTCGTGACTTGACGGACTATAT

Forward Reverse Forward Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

2. Materials and methods 2.1. Animal preparation A. sinica cysts were harvested from the salt lake of Yuncheng, Shanxi Province (China) and stored at −20 °C in the dark until use. The cysts were hatched in filtered seawater (salinity 28‰) under laboratory conditions: 28 °C, at an illumination intensity of 1000 lx. The development of A. sinica consists of five main stages: the embryo, nauplius, metanauplius, pseudoadult and the adult stages. In this experiment, 0–10 h corresponded to the cyst stage; 15–20 h corresponded to the nauplius stage; 40 h corresponded to the metanauplius stage; 3 and 5 d corresponded to the pseudoadult stage; after 5 d corresponded to the adult stage. Animal samples of roughly 50 mg were collected each time point (0, 5, 10, 15, 20 and 40 h; 3, 5 and 7 d, adult) at different periods of development for subsequent experiments. 2.2. Cloning of full-length gk cDNA To prepare a cDNA template for PCR amplifications, total RNA was extracted using TRIzol-A+ (Tiangen, Beijing, China), followed by reverse-transcription with an oligo (dT) primer and MLV reverse transcriptase (TaKaRa, Dalian, China). Specific primers (As-gkF, As-gkR, Table 1) were designed using primer Premier 5.0 (Premier), based on the partial sequence of Artemia franciscana gk and synthesized by TaKaRa. The PCR reaction conditions were as follows: an initial incubation at 94 °C for 5 min; followed by 30 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and elongation at 72 °C for 1 min; with a final incubation at 72 °C for 10 min. PCR products were separated on 1.0% agarose/TAE gels and sequenced by TaKaRa. A 359 bp fragment of As-gk was obtained. Subsequently, the full-length cDNA sequence of As-gk was obtained by 5′–3′ rapid amplification of cDNA ends (RACE) using the 3′RACE Core Set Ver.2.0 (TaKaRa) and the SMART™ RACE cDNA Amplification Kit (Clontech, Dalian, China), respectively. All the reaction processes of RACE were carried out according to the manufacturers' instructions. Gene-specific primers of 3′RACE (3′As-gk, Table 1) and 5′RACE (5′Asgk, Table 1) were designed based on the amplified 359 bp gene fragment of As-gk mentioned above. The RACE-PCR products were purified with a Gel Extraction Kit (TaKaRa), ligated into a pMD19-T vector (TaKaRa), transformed into E. coli strain DH5α and then sequenced by TaKaRa. The 3′ and 5′ termination fragments were spliced together using DNAman 6.0.3.48 (Lynnon Biosoft) to obtain the full-length

Fig. 1. Sequence analysis of Artemia sinica GK. Sequence of A. sinica gk cDNA and the deduced protein sequence. The start and stop codons are shown in green and pink, respectively. Carbohydrate kinase FGGY N-terminal domain is indicated by a straight blue line, with the C-terminal domain defined by a wavy green line. The red letters with asterisks show conserved sites in GK.

C. Cheng et al. / Gene 537 (2014) 51–62

53

54

C. Cheng et al. / Gene 537 (2014) 51–62

Table 2 Predicted phosphorylation sites in As-GK. Name

Position

Contexta

Scoreb

Name

Position

Contexta

Scoreb

Ser

14 15 114 230 231 291 336 346 445 485 517 521

DQGTSSSRF QGTSSSRFL NRTVSTVDS EIRSSSEIY IRSSSEIYG KPIFSDKGL GIIKSEHEI SLAASVTDS VIRPSMCET TFQPSILEE DTPVSKPDS SKPDSGRQL

0.889 0.930 0.997 0.972 0.965 0.654 0.903 0.995 0.996 0.943 0.995 0.983

Thr

40 90 97 115 306 374 391 399 514 234 311

IHKKTPKED QRETTIVWD WDKFTGKPL RTVSTVDSL QLGKTKRPV DARGTICGL IARATLEAV VCYQTRDVL PSIDTPVSK SSEIYGYIT KRPVYAIEG

0.989 0.973 0.566 0.701 0.775 0.984 0.840 0.568 0.969 0.943 0.738

a b

Tyr

The sequences surrounding the phosphorylation sites. The probability of the phosphorylation sites.

cDNA of As-gk. The full-length nucleotide sequence was submitted to GenBank with the accession number KC188663.

in phosphate-buffered saline (PBS) treated with diethylpyrocarbonate (DEPC), followed by fixation in freshly prepared 4% paraformaldehyde solution in 100 mmol l−1 PBS (pH 7.4) at 4 °C for 5–8 h. The specimens were taken through an increasing methanol concentration series (30%, 50% and 70%) and then in 70% methanol. The sample was then immersed in paraffin wax and cut into 7–8 μm sections. After dissolving the paraffin and rehydrating, the sections were taken through: 0.3% TritonX-100, RNase-free ProK, 4% paraformaldehyde (pH 7.4), washing buffer, blocking solution, antibody solution, detection buffer (pH 9.5), separately. After pre-hybridization in a pre-hybridization buffer containing 50% formamide deionized (v/v), 1 × Denhardt's solution, 5 × SSC, and 5 mg/ml salmon sperm DNA at 50 °C for 2 h, samples were hybridized in the prehybridization buffer with 10% dextran sulfate and 1 mg/ml DIG-labeled gk riboprobe added at 52 °C for 12–16 h in a moist chamber. Subsequently, the DIG nucleic acid detection kit (Roche) was used to detect the signal. Finally, nuclear fast red was used for counterstaining and signals were detected under a BX51 Olympus microscope. 2.5. Expression level of As-gk tested by quantitative real-time PCR

2.3. Bioinformatics The similarity of gk among different species was performed using the NCBI Online Search Tool (Blastx) (http://blast.ncbi.nlm.nih.gov/Blast. cgi). The ORF Finder tool (http://www.ncbi.nlm.nih.gov/gorf/gorf. html) was used to find the open reading frame. A conserved domain tool (http://www.ncbi.nlm.nih.Gov/Structure/cdd/wrpsb.cgi) the online analysis software ExPASy (http://prosite.expasy.org/) and InterProScan (http://www.ebi.ac.uk/Tools/pfa/iprscan/) predicted the structure and functional domains. The ProtParam tool of ExPASy predicted the molecular weight (Mw) and theoretical isoelectric point (pI) of the protein. The analysis of hydrophobicity and hydrophilicity was performed using Protscale (http://web.expasy.org/protscale/). Psort II (http://psort.hgc.jp/form2.html) was employed to predict the subcellular localization. NetPhos 2.0 Server (http://www.cbs.dtu.dk/ services/NetPhos/) predicted the phosphorylation sites of GK. SignalP4.0 (http://www.cbs.dtu.Dk/services/SignalP/) and TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) were used for signal peptide and transmembrane region prediction, respectively. Finally, the ClustalX2.0 program, DNAman and the online service of ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/) were used to carry out protein multiple sequence alignment among different species. ClustalX 2.0 and MEGA 4.1 software, the neighbor-joining (NJ) method, constructed a phylogenetic tree. The Bootstrap method was used to evaluate the accuracy of the tree (Bootstrap = 1000). 2.4. In situ hybridization (ISH) assay Templates for the RNA probes were prepared by PCR with a pair of specific primers (ISH-gkF, ISH-gkR, Table 1) designed based on the full-length sequence of As-gk. The product (about 320 bp) was purified on an agarose gel and cloned into a pGM-T vector (Tiangen) to add the SP6/T7 polymerase binding sites. The RNA probes were synthesized with a DIG-label using a DIG RNA Labeling Kit (SP6/T7; Roche, Indianapolis, USA) according to the manufacturer's instructions. A. sinica samples from different developmental stages (0, 5, 10, 15, 20, and 40 h; 3, 5, and 7 d; adult) were collected and 0, 5 and 10 h samples were first completely decapsulated with 50% NaClO, rapidly rinsed

2.5.1. Expression of As-gk in different developmental stages Gene expression was confirmed by quantitative real-time PCR (RTPCR), with β-actin (primers: β-actinF, β-actinR, Table 1) used as a normalization control for each starting quantity of RNA (Li et al., 2013; Zhang et al., 2013). Different growth time periods (0, 5, 10, 15, 20 and 40 h; 3 d) of A. sinica were collected to extract RNA and prepared as cDNA templates by the method used in Section 2.2. A pair of primers specific for As-gk (RT-gkF, RT-gkR, Table 1) was used to amplify cDNA products. Real-time PCR was performed in triplicate for each sample using SYBR® Premix Ex Taq™ (TaKaRa). TaKaRa TP800 (Dalian Development Zone, China) was employed as the detection system. Each reaction system (25 μl) comprised 12.5 μl of SYBR, 0.5 μl of each primer, 2 μl of cDNA template, and water to a final volume of 25 μl. Reaction conditions were 95 °C for 30 s, followed by 40 cycles (95 °C for 5 s, 58 °C for 30 s, and 95 °C for 15 s, 60 °C for 30 s) and 95 °C for 15 s. At the end of each PCR reaction, dissociation analysis of the amplified products was performed to ensure that only one PCR product was amplified. Gene expression data were analyzed using Thermal Cycler Dice Real Time system software (TaKaRa), and quantified with the comparative CT method (2 − ΔΔCt method) based on CT values for both As-gk and βactin to calculate the fold increase. The statistical significance of any change was analyzed by least square difference (LSD) and significance was set at P b 0.05, as assessed by a t-test using the SPSS 16.0 software. 2.5.2. Expression of As-gk in response of stress Real-time PCR was also performed to investigate the expression of As-gk in response to stress. For the salinity-challenge assay, A. sinica cysts were first reared in filtered seawater at a salinity of 28‰ for 20 h. Afterwards, the 20 h-embryos were removed to different vessels with an ascending salinity of 50‰, 100‰, 150‰ and 200‰, separately. For different salinity concentrations, sea salt was added to natural seawater and a salinometer measured the salinity. The 28‰ salinity treatment conditions served as the control. RNA was extracted from each salinity sample after 24 h treatment. The RNA was reverse transcribed into cDNA template for real-time PCR. For the temperature-challenge assay, adult brine shrimps were reared for 48 h at 30 °C. The temperature was reduced suddenly to

Fig. 2. Multiple alignment of known GK sequences from 17 species. Identical amino-acid residues are indicated by black boxes. Less conserved residues are indicated by gray boxes, whereas somewhat similar residues are indicated by pale gray boxes. The FGGY N-terminal and C-terminal domains are indicated by boxes. Conserved sites were emphasized by asterisks. Single conserved sites T273, G321 and W498 are indicated by triangles. The sequences and their accession numbers of GK are as follows: CeGK, Caenorhabditis elegans, Q21944; MrGK, Megachile rotundata GK, XP_003701934; CfGK, Camponotus floridanus GK, EFN74384; AfGK, Apis florae GK, XP_392723; PhGK, Pediculus humanus corporis GK, XP_002430181; DmGK, Drosophila melanogaster GK, NP_524655; AsGK, Artemia sinica GK, KC188663; CiGK, Ciona intestinalis GK, XP_002127360; DrGK, Danio rerio GK, XP_005159996; TrGK, Takifugu rubripes GK, XP_003966700; XtGK, Xenopus (Silurana) tropicalis GK, NP_001090867; GgGK, Gallus gallus GK, XP_003640558; BtGK, Bos taurus GK, NP_001068704; PaGK, Pongo abelii GK, NP_001127474; MmGK, Mus musculus GK, EDL29154; RnGK, Rattus norvegicus GK, NP_077357; HsGK, Homo sapiens GK, CAA55364.

C. Cheng et al. / Gene 537 (2014) 51–62

55

56

C. Cheng et al. / Gene 537 (2014) 51–62

The components of the binding buffer were: 100 mM PBS, 50 mM NaCl, 8 M Urea and 20 mM imidazole. The supernatant was collected after centrifugation at 13,000 rpm for 10 min at 4 °C and filtered through a 0.45-μm filter membrane. Purification of the As-GK recombinant protein was accomplished with HisTrap™ HP crude (GE Healthcare), following the supplier's protocol. The imidazole concentrations of the elution buffer were: 40 mM, 60 mM, 100 mM, 200 mM and 400 mM. The purified protein was dialyzed into 100 mM PBS, with decreased urea concentrations of 6 M, 4 M and 2 M. Terminal products were concentrated using a vacuum centrifuge. 2.7. Production of polyclonal antibodies Polyclonal antibodies directed against the As-GK recombinant protein were prepared in rabbits. Rabbits were immunized every two weeks by multipoint intradermal injections. For the first immunization, the purified protein (600 μg/ml) was emulsified with an equal volume of Freund's complete adjuvant. For the three subsequent immunizations, 300 μg/ml purified protein was emulsified with an equal volume of Freund's incomplete adjuvant. The antiserum was collected by centrifugation at 7000 rpm for 5 min, and ELISA was used to check the concentration. The specificity of the antibody for the purified protein was determined by Western blotting. 2.8. Western blotting

Fig. 3. A neighbor-joining phylogenetic tree constructed based on the amino acid sequence of As-GK (this study) and 16 other species from GenBank utilizing the sequence analysis tool MEGA 4.1. For the sequences and their accession numbers refer to the legend of Fig. 2. A red dot indicates As-GK.

the desired temperature (25 °C, 20 °C, 15 °C, 10 °C and 5 °C) separately. Each treatment was maintained for 48 h and the 30 °C treatment was used as the control. Samples were collected to extract RNA, which was then reverse transcribed into a cDNA template. Real-time PCR was carried out as described in Section 2.5. 2.6. Construction, expression and purification of pET-30a GK protein The full-length ORF, with EcoRI and XhoI sites introduced at the 5′and 3′-ends, respectively, was first cloned into vector pMD19-T (TaKaRa). Both the recombinant plasmid PMD19-T-GK and pET-30a expression vector were digested with the enzymes EcoRI and XhoI. The As-gk cDNA was ligated into the pET-30a expression vector using T4 DNA ligase (TaKaRa). The two recombinant plasmids, PMD19-T-GK and Pet-30a-GK, were sequenced by TaKaRa. To facilitate the overexpression of GK, pET-30a-GK was transformed into the E. coli BL21 (DE3) as follows: 1 mM IPTG for 3 h at 37 °C, 1 mM IPTG for 3 h at 30 °C, 0.25 mM IPTG for 3 h at 37 °C, and 0.25 mM IPTG for 3 h at 30 °C. Cells were collected by centrifugation at 7000 rpm for 5 min at 4 °C. The cell pellets were washed twice with PBS, and resuspended in PBS. One volume of 5 × SDS-PAGE loading buffer was added and the samples were boiled for 8 min. The products were detected by SDSPAGE to find the best induction conditions for large-scale purification (Lova et al., 2000; Wu et al., 2007). The recombinant protein was expressed in 1 L E. coli BL21 (DE3) containing 10 ml overnight cultured thallus and induced with 0.25 mM IPTG at 30 °C for 3 h. Cells were collected by centrifugation at 7000 rpm for 5 min at 4 °C, and washed twice with 100 mM PBS. The sediment was resuspended in PBS (20 ml/g thallus) with 1% TritonX-100 before being lysed by ultrasonication. Proteins expressed as inclusion bodies were washed with 100 mM PBS containing 50 mM NaCl and 2 M Urea twice, followed by denaturation with 8 M Urea.

2.8.1. Expression of As-GK in different stages of early embryo development Total proteins were extracted from each sample (0, 5, 10, 15, 20, and 40 h; 3 d) with RIPA Lysis Buffer and quantified with the Bradford method (Bradford, 1976). 100 μg of each sample was subjected to fractionation by SDS-PAGE and transferred to PVDF membranes. The membrane was blocked with 5% nonfat powdered milk (Sangon, Shanghai, China) for 1 h at room temperature. Rabbit anti-As-GK polyclonal antibody and GAPDH antibody were diluted 1:500 with PBST and incubated with the membrane overnight at 4 °C. Afterwards, the membrane was washed with PBST (3 × 10 min), and then incubated with HRP-conjugated goat anti-rabbit IgG (Transgen, Beijing, China) antibody for 1 h at 37 °C, followed by washing with PBST (3 × 10 min) and PBS once (10 min). The reactive protein bands on the membrane were visualized using ECL (Transgen) and exposed in the darkroom. Image gray scale analysis in the ImageJ documentation was used to compare the density (aka the intensity) of bands on the Western blot. The expression intensities of AsGK-specific bands were normalized against the GAPDH bands. 2.8.2. Salinity and temperature stress analysis A. sinica cysts were hatched in 28‰ salinity seawater for 20 h and then treated with seawater of different salinity (50‰, 100‰, 150‰, and 200‰) in separate vessels for 24 h. The salinity of the seawater was adjusted by adding crude salt to natural seawater and measuring the salinity with a salinometer. Total proteins were extracted from each salinity sample and quantified. The expression trend of As-GK in response to increasing salinity was also assayed by Western blotting, as described in Section 2.8.1, with GAPDH as the control. For the temperature-challenge assay, cysts were reared for 20 h at 30 °C. Then, the temperature was reduced suddenly to the desired temperature (25 °C, 20 °C, 15 °C, 10 °C and 5 °C) separately. Each treatment was maintained for 24 h. Samples were collected to extract and quantify total proteins. Western blotting identified expression trends. 3. Results 3.1. Cloning and bioinformatic analysis of As-gk A 2096 bp full-length cDNA of As-gk was obtained (GenBank accession number: KC188663) with an open reading frame of 1656 bp, and 326 bp 5′- and 114 bp 3′-untranslated regions (Fig. 1). As predicted

C. Cheng et al. / Gene 537 (2014) 51–62

57

Fig. 4. In situ hybridization analysis of As-gk expression during different developmental stages of Artemia sinica. A–J: experimental groups, A1–J1: control groups. (A) 0 h, gastrula stage of Artemia cysts; (B, C and D) 5, 10 and 15 h, embryonic stage; (E and F) 20 and 40 h, nauplius stage; (G) 3 d, metanauplius larva stage; (H and I) 5 and 7 d, pseudoadult stage; (J) adult stage. Arrows indicate positive signal regions.

Fig. 5. Expression of As-gk mRNA at different developmental stages quantified by real-time PCR. The control group was set at the beginning of development, 0 h. The expressions of As-gk and β-actin were measured and data are presented as the means ± SD of triplicate experiments. Very significant differences between experimental and control groups are indicated with asterisks (**) (P b 0.01), while (*) denotes significant difference compared with the control (0.01 b P b 0.05).

58

C. Cheng et al. / Gene 537 (2014) 51–62

Fig. 6. Quantitative real-time PCR analysis of As-gk mRNA expression in response to salinity stress. The 28‰ treatment conditions served as a control, and the expressions of As-gk and β-actin were measured 24 h after salinity challenge. Data are presented as the means ± SD of triplicate experiments. Very significant differences between treated and control groups are indicated with asterisks (**) (P b 0.01), while (*) denotes significant difference compared with the control (0.01 b P b 0.05).

in ProtParam, the putative GK protein contained 551 amino acids and had a calculated molecular mass of 60.3 kDa, with a pI of 6.04. As a member of the FGGY family of carbohydrate kinases, protein sequence domain analysis revealed the presence of a typical glycerol kinase domain. A hydrophobicity plot indicated that the putative protein was most likely to be hydrophilic (Min: −3.044, Max: 2.244). Results of the PSORT II program predicted GK to be localized in the cytoplasm (probability of 82.6%), mitochondria (8.7% probability), or the nucleus (8.7% probability). The protein sequence contained 23 predicted targets with high possibilities (score 0.5) of being phosphorylated: twelve serine, nine threonine and two tyrosine sites (Table 2). SignalP 4.0 did not predict the presence of a signal peptide, indicating GK was not a secretory protein. A potential transmembrane region was predicted at the C-terminus of As-GK, according to TMHMM 2.0. As a key enzyme in glycerol uptake, GK has been conserved in both structure and function during evolution (Agosto and McCabe, 2006). Multiple protein sequence alignment revealed conserved amino acid homologous sequences between different species, especially in the FGGY N-terminal (from residues 6 to 261 in A. sinica) and C-terminal (from residues 270 to 461 in A. sinica) domains, which supported the results of a previous study (Fig. 2) (Agosto and McCabe, 2006). Two conserved sites have been predicted in the As-GK sequence: 142-

YFSAVKLSWLLQN-154, 373-GTICGLTHYSTSAHIARATLE-393. The T273, G321, W498 of As-GK correspond to human GK sites T278, G326, W503, where a single amino acid change will cause functional disorder (Fig. 2). To evaluate the evolutionary relationships among GK homologous sequences, we constructed a phylogenetic tree based on the protein sequences from 17 species. The phylogenetic tree was constructed by the neighbor-joining method and statistical significance of groups within trees was evaluated using the bootstrap method with 1000 replications. Analysis of the phylogenetic tree (Fig. 3) showed that there were five main clusters: the mammals cluster contained Homo sapiens, Pongo abelii, Mus musculus, Rattus norvegicus and Bos taurus; the lower vertebrates cluster comprised Gallus gallus, Xenopus (Silurana) tropicalis, Takifugu rubripes, Danio rerio; Ciona intestinalis as a representative of the chordates was an independent cluster; the arthropods cluster comprised Apis florae, Camponotus floridanus, Megachile rotundata, Pediculus humanus corporis, Drosophila melanogaster and A. sinica; Caenorhabditis elegans was separated as an independent branch. 3.2. Expression location of As-gk In situ hybridization was performed to determine the spatial expression pattern of As-gk at different developmental stages of A. sinica (Fig. 4). Positive As-gk signals (in purple) were detected throughout nearly the entire embryo at the 0-h stage (Fig. 4A), which was maintained until the 10-h stage (Fig. 4B, C) and gradually extended from head to tail in the umbrella stage of 15 h (Fig. 4D). At 20 h, As-gk mRNA was detected significantly in the whole larval body after the nauplius had hatched (Fig. 4E). When the initial differentiation occurred at 40h (Fig. 4F), positive signals could be found in the newly emerged cephalothorax, abdomen, appendages and body surface. At 3–7 days (Fig. 4G, H and I), the body shape, internal tissue, and external appendages began to develop. Distinct signals were detected only at the body surface and in the inner side of the digestive tract. As the individual developed (Fig. 4J), mRNA positive signals could be detected in the ovary and on the dorsal region, but barely in the diapause cysts. The assay performed under the same conditions without the antisense probe served as a negative control, in which no signal above background was detected (samples were dyed red) (Fig. 4 A1-J1). 3.3. Expression level of As-gk tested by quantitative real-time PCR in different developmental stages and to stress Real-time PCR analysis was performed to determine the amount of Asgk transcription during the development of A. sinica. An escalating trend

Fig. 7. Quantitative real-time PCR analysis of As-gk mRNA expression for a temperature challenge assay. The 30 °C treatment conditions served as a control, and the expressions of As-gk and β-actin were measured 24 h after temperature challenge. Data are presented as the means ± SD of triplicate experiments. Very significant differences between treated and control groups are indicated with asterisks (**) (P b 0.01), while (*) denotes significant difference compared with the control (0.01 b P b 0.05).

C. Cheng et al. / Gene 537 (2014) 51–62

59

Fig. 8. (A) Expression of Artemia sinica As-GK recombinant protein. M: protein markers from 40 to 200 kDa. Lanes 1–4 show the expression of As-GK recombinant protein from four induction treatments (1 mM IPTG at 37 °C, 1 mM IPTG at 30 °C, 0.25 mM IPTG at 37 °C, and 0.25 mM IPTG at 30 °C, respectively). Lane 5 indicates total proteins from uninduced cells. Lane 6 shows total proteins from induced cells harboring pET-30a (control). (B) Detection of the solubility of As-GK recombinant protein. Lane 1: total As-GK recombinant protein. Lane 2: soluble fraction of the lysate from induced cells harboring pET-30a-GK. Lane 3: insoluble fraction of the lysate from induced cells harboring pET-30a-GK. (C) Purification of As-GK recombinant protein. M: protein markers from 15 to 120 kDa. Lane 1 shows unpurified induced As-GK recombinant protein and Lane 2 shows purified As-GK.

was detected during early embryo development stages, from gastrula to the 10-h embryo, reaching a notably high level (about three-fold higher than the control). The level of As-gk expression then declined slightly at the umbrella stage of 15 h. Afterwards, the expression level decreased remarkably as the nauplius hatched and was maintained at a relative low level until the metanauplius larva stage (Fig. 5). To determine the expression level of As-gk in A. sinica under different salinity/temperature stress conditions, real-time PCR was employed. For the salinity stress assay, the expression of As-gk was downregulated at the salinity of 50‰. When the salinity increased, the expression level was upregulated sharply. Under very high salinity of 150‰ and 200‰, the expression remained upregulated, but not as much as that below 100‰ (Fig. 6). The levels of As-gk transcript differed significantly in

A. sinica subjected to 25, 20, 15, 10 and 5 °C treatment vs. the 30 °C control group. At temperatures of 10 °C and 15 °C, expression was significantly high, with a maximum at 10 °C. However, the expression of As-gk showed no significant difference between the control and temperature-treated samples ranging from 20 °C to 25 °C, and at 5 °C. An upregulation from 25 °C to 10 °C and a downregulation from 10 °C to 5 °C were observed (Fig. 7). 3.4. Purification and expression of As-GK protein A 1656 bp open reading frame was obtained by digestion with restriction enzymes EcoRI and XhoI, which encoded a putative GK protein of 551 amino acids. The predicted molecular mass was about 60 kDa,

Fig. 9. (A) The expression of the As-GK protein at different developmental stages of A. sinica detected by Western blotting. The intensities of As-GK protein bands were normalized against the GAPDH protein. (B) Values are expressed as arbitrary units of relative value. The expression of As-GK protein at 0 h was used as a control, and statistically significant differences are indicated with asterisks: (**) for P b 0.01, while (*) represents 0.01 b P b 0.05.

60

C. Cheng et al. / Gene 537 (2014) 51–62

Fig. 10. (A) Expression of the As-GK protein in response to salinity stress detected by Western blotting. The intensities of As-GK protein bands were normalized against the GAPDH protein. (B) Values are expressed as arbitrary units of relative value. The expression of As-GK protein at the salinity of 28‰ was used as a control, and statistically significant differences are indicated with asterisks: (**) for P b 0.01, while (*) represents 0.01 b P b 0.05.

and the isoelectric point was 6.04. It showed no significant difference in expression quantity under the four different induction conditions (Fig. 8A), so we adopted a relative low condition of 0.25 mM IPTG at 30 °C for further research. SDS-PAGE analysis showed that the

recombinant protein existed in the insoluble fraction, expressed in an inclusion body form (Fig. 8B). After denaturation in 8 M urea, purification and dialysis, a relatively pure protein was obtained (Fig. 8C).

Fig. 11. (A) Expression of the As-GK protein in response to temperature stress detected by Western blotting. The intensities of As-GK protein bands were normalized against the GAPDH protein. (B) Values are expressed as arbitrary units of relative value. The expression of As-GK protein at 30 °C was used as a control, and statistically significant differences are indicated with asterisks: (**) for P b 0.01, while (*) represents 0.01 b P b 0.05.

C. Cheng et al. / Gene 537 (2014) 51–62

3.5. Expression pattern of As-GK tested by Western blotting in early embryo development and to stress The expression pattern of As-GK at different development stages in A. sinica showed an ascending trend at the start of development, reaching a peak at 10 h. After that, there was a downregulation until 20 h, when the nauplius hatched. A slight, but not significant, upregulation occurred at 40 h, and expression remained at a relative low level thereafter (Fig. 9). Western blotting after salinity challenge showed a significant upregulation at 100‰ salinity, after which the expression declined and showed no significant difference compared with the control group. At 50‰ salinity, there was an obvious downregulation of As-GK expression (Fig. 10). For temperature challenge assay, the highest expression occurred at 10 °C and it stayed at a high level at 15 °C. The 5 °C, 20 °C and 25 °C treatments caused no significant differences (Fig. 11). 4. Discussion In this study, a 2096 bp full-length cDNA of As-gk was obtained, containing an ORF of 1656 bp, which encoded a deduced protein of 551 amino acids. Sequence analysis revealed two highly conserved domains, FGGY_N and FGGY_C, which are important domains of GK proteins as members of the FGGY superfamily of carbohydrate enzymes. Both the N- and the C-terminal domains of the FGGY family of carbohydrate kinases adopt ribonuclease H-like folds that are structurally related to each other, which was consistent with Boyer's study (Boyer and Peterson, 2000). This domain is present in protein subunits of nuclear chromatin remodeling complexes (Boyer and Peterson, 2000). The presence and evolutionary conservation of these protein domains suggests a potential role for GK in nuclear transcriptional regulation and chromatin remodeling (Koga et al., 1998). Protein sequence analysis identified potential protein interaction and phosphorylation modification sites that may regulate GK function. Missense mutations in any of the potential phosphorylation sites may lead to glycerol kinase deficiency (GKD). Two prominent and wellconserved examples are the missense mutations T278M and W503K. The threonine at position 278 of human GK is part of a well-conserved PKC phosphorylation site at residues 273 in A. sinica (Koga et al., 1998). This residue is conserved across species and mutated in GKD patients, with the missense mutation T278M (Dipple et al., 2001). The tryptophan at position 498 of As-GK is another conserved site, being identical to human GK W503. A key glycine residue required for glucose mediated regulation of GK activity in As-GK is located at position 321 (G326 in human GK) (Pettigrew et al., 1996) and is conserved among all species. Despite its conservation, it showed definite classification consistent with its evolutionary position in the phylogenetic tree. GK has been so conserved in vertebrates, especially in mammals, that they clustered into a group. A. sinica belongs to Arthropoda, sharing a close genetic relationship with insects, which was supported by the phylogenetic tree. As-GK shared less similarity to nematodes, which is the same for other genes in A. sinica (Li et al., 2012; Wang et al., 2013). As-GK was most probably localized in the cytoplasmic, which is consistent with its role as a fundamental metabolic enzyme. According to TMHMM 2.0, the C-terminus of As-GK contains a transmembrane hydrophobic domain homologous to that present in the proapoptotic protein Bax (Ohira, 2004). This domain is relevant to a mitochondrial location (Ohira and McCabe, 2004). Multiple sequence alignment by DNAMAN revealed an identity of 69.25% among species, including A. sinica, ranging from C. elegans to H. sapiens. The two predicted sites, 142-YFSAVKLSWLLQN-154 and 373-GTICGLTHYSTSAHIARATLE-393 have been conserved in the 17 chosen sequences, and are much conserved among vertebrates. GK showed over 80% similarity in vertebrates, which further indicated its evolutionary conservation. GK has been detected in the embryo and larva during the early development of flies (Agosto and McCabe, 2006). In this study, positive

61

signals for As-gk were detected in the early embryos (0–20 h) without tissue difference because differentiation had not yet begun. GK activity has been observed in the muscles of both vertebrates and invertebrates (Newsholme and Taylor, 1969; Montell et al., 2002). In Drosophila, GK is highly expressed in the fat body and fight muscle (Sullivan et al., 1983). When the initial differentiation occurred in A. sinica at 40 h, positive signals were detected in the cephalothorax, abdomen and appendages. These are organs with muscle tissues and are closely associated with movement in Artemia, which requires the active regulation of glycerolipid biosynthesis during activity (Strunecka et al., 1981). In mammals, GK activity is most abundant in the liver. It is expressed at low levels in every human tissue, but expressed at higher levels in the liver, kidney, small intestine, testis, ovary and lung (Rahib et al., 2009; Schnick et al., 2009). At 3–7 d, when the brine shrimps are able to obtain carbohydrates from their surroundings, distinct signals were detected in the inner side of the digestive tract. As the individual developed, mRNA positive signals could be detected in the ovary, but barely in the diapause cysts. Glycerol metabolism is essential for oogenesis in Drosophila (Agosto and McCabe, 2006), which explains the detection in the ovary. Diapause cysts accumulate high concentrations of glycerol, explaining the decrease in As-gk transcripts in the diapause cysts. In Bombyx mori eggs, diapause initiation silences the expressions of the SDH1, SDH2 and GK3 genes, strongly supporting the notion that sorbitol and glycerol accumulate at high concentrations by blocking the utilization pathways for sorbitol and glycerol through the suppression of SDH and GK activities (Kihara et al., 2009). When diapause is terminated and embryos resume development, GK is required to reduce the glycerol that accumulated in the diapause; thus, As-gk expression is upregulated during early embryo development (0–15 h). With decreasing glycerol, the transcription of As-gk declined (20 h–3 d) before the digestive system is formed. This parallels the expression pattern reported in the fruitfly, where GK expression was higher in larval stages than in adults (Municio et al., 1975). The role of glycerol in cell survival has emerged recently, with convincing evidence of its central role. In plants, GK is required for resistance against infection (Kang et al., 2003). Flies with prolonged life spans also have increased resistance to stress, and in particular, they survive extreme cold environments by increasing their levels of glycerol (Luckninbill, 1998). GK has been reported as a cold-induced enzyme in several papers (Denor and Courtright, 1974; North, 1973). At low temperatures (10 °C and 15 °C), which are much lower than A. sinica's preferred temperature (25 °C–30 °C), the expression of As-GK increased by more than three-fold at peak. The increase in GK expression mirrored the higher metabolic level required to protect against the cold. When the high metabolic rate is not sufficient for cold resistance (5 °C), the brine shrimps begin to accumulate glycerol; thus, the expression of As-GK decreased. Glycerol kinase is upregulated eight-fold during the stress response to dehydration in the nematode Steinerenema feltiae (Gal et al., 2003). Salinity of 50‰ is the optimum for Artemia to survive at which the expression of As-GK was downregulated. Instead of accumulating glycerol for salt-stress resistance in plants and yeasts, the upregulation of GK when subjected to higher salinity suggested that glycerol may not be a key solute for osmotic regulation.

Conflict of interest The authors have no conflict of interest to declare.

Acknowledgments This work was supported by a grant from the National Natural Science Foundation of China (31272644). We thank anonymous referees for their valuable comments on an earlier version of the manuscript.

62

C. Cheng et al. / Gene 537 (2014) 51–62

References Abatzopoulos, T.J., Beardmore, J.A., Clegg, J.S., Sorgeloos, P., 2002. Artemia: Basic and Applied Biology. Kluwer Academic, Dordrecht, the Netherlands. Agosto, J.A.M., McCabe, E.R.B., 2006. Conserved family of glycerol kinase loci in Drosophila melanogaster. Mol. Genet. Metab. 88, 334–345. Aragon, C.C., Ferreira-Dias, S., Gattás, E.A.L., Peres, M.F.S., 2008. Characterization of glycerol kinase from baker's yeast: response surface modeling of the enzymatic reaction. J. Mol. Catal. B Enzym. 52–53, 113–120. Bork, P., Sander, C., Valencia, A., 1992. An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp70 heat shock proteins. Proc. Natl. Acad. Sci. U. S. A. 89, 7290–7294. Boyer, L.A., Peterson, C.L., 2000. Actin-related proteins (Arps): conformational switches for chromatin-remodeling machines. Bioessays 22, 666–672. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Denor, P., Courtright, J.B., 1974. Requirement for specific carbon sources in the low temperature induction of glycerol kinase in Neurospora crassa. FEBS Lett. 48, 314–316. Dipple, K.M., et al., 2001. Glycerol kinase deficiency: evidence for complexity in a single gene disorder. Hum. Genet. 109, 55–62. Feese1, M.D., Faber, H.R., Bystrom, C.E., Pettigrew, D.W., Emington, S.J., 1998. Glycerol kinase from Escherichia coli and an Ala65 → Thr mutant: the crystal structures reveal conformational changes with implications for allosteric regulation. Structure 15, 1407–1418. Gal, T.Z., Glazer, I., Koltai, H., 2003. Differential gene expression during dessication stress in the insect-killing nematode Steinerenema feltiae. J. Parasitol. 89, 761–766. Holmes, K.C., Sander, C., Valencia, A., 1993. A new ATP-binding fold in actin, hexokinase, and hsc70. Trends Cell Biol. 3, 53–59. Huang, H.S., et al., 1998. Thermostable glycerol kinase from Thermus flaÍusflavus: cloning, sequencing and expression of the enzyme gene. Biochim. Biophys. Acta 1382, 186–190. Kang, L., et al., 2003. Interplay of the Arabidopsis nonhost resistance gene NHO1 with bacterial virulence. Proc. Natl. Acad. Sci. U. S. A. 100, 3519–3524. Kihara, F., Itoh, K., Iwasaka, M., Niimi, T., Yamashita, O., Yaginuma, T., 2009. Glycerol kinase activity and glycerol kinase-3 gene are up-regulated by acclimation to 5 °C in diapause eggs of the silkworm, Bombyx mori. Insect Biochem. Mol. Biol. 39, 763–769. Koga, Y., et al., 1998. Thermostable glycerol kinase from a hyperthermophilic archaeon: gene cloning and characterization of the recombinant enzyme. Protein Eng. 11, 1219–1227. Li, Q.Y., et al., 2012. Molecular characterization and expression of As-nurp1 gene from Artemia sinica during development and in response to salinity and temperature stress. Biol. Bull. 222, 182–191. Li, Z.R., et al., 2013. Molecular cloning, characterization and expression analysis of ubiquitin protein ligase gene (As-ubpl) from Artemia sinica. Comp. Biochem. Physiol. B 165, 90–98. Lin, E.C., 1976. Glycerol dissimilation and its regulation in bacteria. Annu. Rev. Microbiol. 30, 535–578. LovaÂ, I.K., Rigden, D.J., Opperdoes, F.R., Michels, P.A.M., 2000. Glycerol kinase of Trypanosoma brucei cloning, molecular characterization and mutagenesis. Eur. J. Biochem. 267, 2323–2333. Luckninbill, L.S., 1998. Selection for longevity confers resistance to low temperature stress in Drosophila melanogaster. J. Gerontol. Ser. A Biol. Sci. Med. Sci. 53, B147–B153. MacRae, T.H., 2010. Gene expression, metabolic regulation and stress tolerance during diapause. Cell. Mol. Life Sci. 67, 2405–2424.

Mao, C., Ozer, Z., Zhou, M., Uckun, F.M., 1999. X-ray structure of glycerol kinase complexed with an ATP analog implies a novel mechanism for the ATP-dependent glycerol phosphorylation by glycerol kinase. Biochem. Biophys. Res. Commun. 259, 640–644. Michaud, M.R., Denlinger, D.L., 2007. Shifts in the carbohydrate, polyol, and amino acid pools during rapid cold-hardening and diapause-associated cold-hardening in Xesh Xies (Sarcophaga crassipalpis): a metabolomic comparison. J. Comp. Physiol. B. 177, 753–763. Montell, E., Lerín, C., Newgard, C.B., Gómez-Foix, A.M., 2002. Effects of modulation of glycerol kinase expression on lipid and carbohydrate metabolism in human muscle cells. J. Biol. Chem. 277, 2682–2686. Municio, A.M., Odriozola, J.M., Perez-Albarsanz, M.A., 1975. Biochemistry of development in insects. Incorporation of fatty acids into different lipid classes. Eur. J. Biochem. 60, 123–128. Newsholme, E.A., Taylor, K., 1969. Glycerol kinase activities in muscles from vertebrates and invertebrates. Biochem. J. 112, 465–474. North, M.J., 1973. Cold-induced increase of glycerol kinase in Neurospora crassa. FEBS Lett. 35, 67–70. Novotny, M.J., Frederickson, W.L., Waygood, E.B., Saier, M.H., 1985. Allosteric regulation of glycerol kinase by enzyme IIIglc of the phosphotransferase system in Escherichia coli and Salmonella typhimurium. J. Bacteriol. 162, 810–816. Ohira, R.H., 2004. Expression of ARX and GK, Two Genes in Xp22–p21 (UCLA dissertation). Ohira, R.H., McCabe, E.R.B., 2004. Function of two alternatively spliced mRNAs from the Xp21 glycerol kinase (GK) gene. Am. J. Hum. Genet. S332, 1798. Pawlyk, A.C., Pettigrew, D.W., 2001. Subcloning, expression, purification, and characterization of Haemophilus influenzae glycerol kinase. Protein Expr. Purif. 22, 52–59. Pettigrew, D.W., Liu, W.Z., Holmes, C., Meadow, N.D., Roseman, S., 1996. A single amino acid change in Escherichia coli glycerol kinase abolishes glucose control of glycerol utilization in vivo. J. Bacteriol. 178, 2846–2852. Qiu, Z.J., MacRae, T.H., 2007. Developmentally regulated synthesis of p8, a stressassociated transcription cofactor, in diapause-destined embryos of Artemia franciscana. Cell Stress Chaperones 12, 255–264. Rahib, L., Sriram, G., Harada, M.K., Liao, J.C., Dipple, K.M., 2009. Transcriptomic and network component analysis of glycerol kinase in skeletal muscle using a mouse model of glycerol kinase deficiency. Mol. Genet. Metab. 96, 106–112. Riel, J.K., Paulus, H., 1978. Subunit dissociation in the allosteric regulation of glycerol kinase from Escherichia coli. 2. Physical evidence. Biochemistry 17, 5141–5146. Schnick, C., et al., 2009. Structure and non-essential function of glycerol kinase in Plasmodium falciparum blood stages. Mol. Microbiol. 71, 533–545. Strunecka, A., Sula, J., Myskova, H., Kubista, V., 1981. The inXuence of Xight on the phospholipid metabolism in insect Xight muscle. Physiol. Bohemoslov. 30, 411–416. Sullivan, D.T., Donovan, F.A., Skuse, G., 1983. Developmental regulation of glycerol-3phosphate dehydrogenase synthesis in Drosophila. Biochem. Genet. 21, 49–62. Thorner, J.W., Paulus, H., 1971. Composition and subunit structure of glycerol kinase from Escherichia coli. J. Biol. Chem. 246, 3885–3894. Thorner, J.W., Paulus, H., 1973. Catalytic and allosteric properties of glycerol kinase from Escherichia coli. J. Biol. Chem. 248, 3922–3932. Wang, T., et al., 2013. Cloning and expression of the sorbitol dehydrogenase gene during embryonic development and temperature stress in Artemia sinica. Gene 521, 296–302. Wu, Q.Y., Li, F., Zhu, W.J., Wang, X.Y., 2007. Cloning, expression, purification, and characterization of arginine kinase from Locusta migratoria manilensis. Comp. Biochem. Physiol. B 148, 355–362. Yeh, J.I., et al., 2009. Structural characterizations of glycerol kinase: unraveling phosphorylation-induced long-range activation. Biochemistry 48, 346–356. Zhang, Q.Z., et al., 2013. Expression patterns of As-ClC gene of Artemia sinica in early development and under salinity stress. Mol. Biol. Rep. 40, 3655–3664.