RESEARCH REVIEW
Identification of TBX5 Mutations in a Series of 94 Patients With Tetralogy of Fallot Anwar Baban,1* Alex Vincent Postma,2 Monica Marini,3 Gianluca Trocchio,4 Antonella Santilli,1 Monica Pelegrini,1 Pietro Sirleto,5 Margherita Lerone,3 Sonia Bernadette Albanese,1 Phil Barnett,2 Cornelis Job Boogerd,2 Bruno Dallapiccola,5 Maria Cristina Digilio,5 Roberto Ravazzolo,3,6 and Giacomo Pongiglione1 1
Department of Pediatric Cardiology and Cardiosurgery, Bambino Gesu` Children Hospital, IRCCS, Rome, Italy
2
Department of Anatomy, Embryology and Physiology, Academic Medical Center, Amsterdam, The Netherlands Laboratory of Molecular Genetics, Gaslini Children Hospital, Genoa, Italy
3 4
Cardiovascular and Cardiosurgical Department, Gaslini Children Hospital, Genoa, Italy Unit of Medical Genetics and Cytogenetics, Bambino Gesu` Children Hospital, IRCCS, Rome, Italy 6 Department of Pediatrics and Center of Excellence for Biomedical Research (CEBR), University of Genoa, Genoa, Italy 5
Manuscript Received: 3 April 2014; Manuscript Accepted: 22 August 2014
Tetralogy of Fallot (TOF) (OMIM #187500) is the most frequent conotruncal congenital heart defect (CHD) with a range of intra- and extracardiac phenotypes. TBX5 is a transcription factor with well-defined roles in heart and forelimb development, and mutations in TBX5 are associated with Holt–Oram syndrome (HOS) (OMIM#142900). Here we report on the screening of 94 TOF patients for mutations in TBX5, NKX2.5 and GATA4 genes. We identified two heterozygous mutations in TBX5. One mutation was detected in a Moroccan patient with TOF, a large ostium secundum atrial septal defect and complete atrioventricular block, and features of HOS including bilateral triphalangeal thumbs and fifth finger clinodactyly. This patient carried a previously described de novo, stop codon mutation (p.R279X) located in exon 8 causing a premature truncated protein. In a second patient from Italy with TOF, ostium secundum atrial septal defect and progressive arrhythmic changes on ECG, we identified a maternally inherited novel mutation in exon 9, which caused a substitution of a serine with a leucine at amino acid position 372 (p.S372L, c.1115C>T). The mother’s clinical evaluation demonstrated frequent ventricular extrasystoles and an atrial septal aneurysm. Physical examination and radiographs of the hands showed no apparent skeletal defects in either child or mother. Molecular evaluation of the p.S372L mutation demonstrated a gain-of-function phenotype. We also review the literature on the co-occurrence of TOF and HOS, highlighting its relevance. This is the first systematic screening for TBX5 mutations in TOF patients which detected mutations in two of 94 (2.1%) patients. Ó 2014 Wiley Periodicals, Inc.
Key words: Tetralogy of Fallot (TOF); atrial septal defects; conduction defects; TBX5 mutations; gain-of-function mutation Ó 2014 Wiley Periodicals, Inc.
How to Cite this Article: Baban A, Postama AV, Marini M, Trocchio G, Santilli A, Pelegrini M, Sirleto P, Lerone M, Albanese SB, Barnett P, Boogerd CJ, Dallapiccola B, Digilio MC, Ravazzolo R, Pongiglione G. 2014. Identification of TBX5 mutations in a series of 94 patients with Tetralogy of Fallot. Am J Med Genet Part A 9999:1–8.
INTRODUCTION Congenital heart defects (CHD) are the most common birth defects in children, reported in almost 1% of live births and are one of the leading causes of morbidity and mortality in the pediatric age group. Tetralogy of Fallot (TOF) is the most common cyanotic CHD with an incidence of approximately 2.5–3.5/10,000 live births representing 5–7% of all CHD [Perry et al., 1993; Dolk et al., 2010; van der Linde et al., 2011]. Approximately 15% of TOF patients have a chromosome 22q11.2 deletion [Scambler, 2000; van Engelen et al., 2010], and another 7% of TOF patients have trisomy 21 Conflict of interest: None. Grant sponsor: European Union, Health-e-Child Integrated Project; Grant number: IST-2004-027749. Correspondence to: Dr. Anwar Baban, M.D., Ph.D., Department of Pediatric Cardiology and Cardiosurgery, Bambino Gesu` Children Hospital, IRCCS, Rome, Italy. E-mail: [email protected] Article first published online in Wiley Online Library (wileyonlinelibrary.com): 00 Month 2014 DOI 10.1002/ajmg.a.36783
1
2 [Rauch et al., 2010]. Mutations in the NKX2.5 (OMIM þ600584), GATA4 (OMIM þ600576), ZFPM2 (OMIM þ603693) and JAG1 (OMIM þ601920) genes have occasionally been reported in nonsyndromic TOF patients [Goldmuntz et al., 2001; Pizzuti et al., 2003; Nemer et al., 2006; Rauch et al., 2010; De Luca et al., 2011; Guida et al., 2011]. In order to assess the incidence and evaluate the genotypephenotype correlation of these potentially frequent causes of TOF, we performed karyotyping, 22q11.2 microdeletion testing, and sequencing of the TBX5, NKX2.5, and GATA4 genes in 100 unselected TOF patients. We report here on the results of our screening and describe two TBX5 mutations identified in TOF patients, characterizing the molecular effects of these mutations.
MATERIALS AND METHODS Patients Unselected TOF patients were recruited in two tertiary pediatric centers: the Bambino Gesu` Children Hospital, IRCCS in Rome and the Gaslini Children Hospital IRCCS in Genoa. One hundred patients consented to participate in the study. The study protocol was approved by the Ethical Committees of both hospitals. Written informed consent was obtained from patients’ parents and/or patients >18 years of age. A specific data collection form was used at presentation by parents and/or patients to report social situation and previous medical history (hearing, vision and speech development, frequency of infections, seizures, non-cardiac surgeries, education, profession). Psychobehavioral development was assessed from neuropediatric evaluation or special care during pre-school or school service. Information was obtained about the main clinical features including extracardiac anomalies (neurologic, otolaryngologic, gastrointestinal, urogenital, skeletal, and craniofacial). The cardiac phenotype was definedby echocardiography performed on all patients. Previous medical records and surgical reports were obtained for almost all patients. Blood samples were obtained to perform standard karyotyping, 22q11 microdeletion screening and sequencing of the three candidate genes (TBX5 (NM_000192.3), GATA4 (NM_002052.3), NKX 2.5 (NM_004387.3)).
Genetic Testing Chromosomal analysis was performed after GTG banding at a 450– 500 banding resolution (International System for Human Cytogenetic Nomenclature (ISCN) 2005) from cultured lymphocytes following standard procedures. Fluorescence in situ hybridization (FISH) analysis was performed on metaphase spreads.
DNA Extraction, PCR, and Sequencing Reactions Genomic DNA was extracted from peripheral blood samples with the Puregene Blood Kit (Gentra Systems, Qiagen, Hilden, Germany) according to the manufacturer’s procedure. Mutational analysis of TBX5, NKX2.5, and GATA4 in patients with normal karyotype was performed by direct sequencing of polymerase chain reaction (PCR) amplicons using intronic primers for all coding exons. Oligonucleotides and conditions used to amplify the TBX5
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
TABLE I. Primers Used for TBX5 Screening TBX5 EXON 2 EXON 3 EXON 4 EXON 5 EXON 6 EXON 7 EXON 8 EXON 9A EXON 9B
TTGTCCTCAGAGCAGAACCT AGAGAAGCCGAGCAGGAAAGC CTGTGTTTTGGGGGAGTTTG CCCTTTCCTTCCTTCTTCTC CCCTTAAAATGGATGGAGGC GCCTTTAGCACACAGTAGGA CAGCTACTACTCAACAACCC GAAACCCAGTGAGAAGAAGG CCCTGGCCCCTTTTCAAAAC GTCAAGCCAAGCTCGTGGAT TAAAAGCAGTCCAATGGAGGAC GCCAACCACATGTGAAGGTT TTCTGTGACTTTTCTGGTGG GTAGGAACATGTCAAGGGAA GAACTCCATAGCCCAAGGTC CTGCTGTAGGAAGGCATGCT GCTTGCATGTATGCCAGCTC GATCAGCATCCAGCGACCTT
coding sequence are described in Table I. PCR reactions were carried out in a total volume of 20 ml containing 1 PCR Buffer (Applied Biosystems, Foster City, CA; www.appliedbiosystems. com), 200 mM dNTPs mix, 1.5 mM MgCl2, 10 pmol of each oligonucleotide, 1 U of AmpliTaq Gold Polymerase (Applied Biosystems). PCR products were checked on gel. A panel of 200 normal individuals was screened as controls.
Plasmid Constructs and Transfections Constructs encoding TBX5 fused to maltose binding protein (MBP; pMAL2C-TBX5-T-box) and NKX2-5 fused to GST (pRP265nbNKX2.5) have been described in a previous study [Boogerd et al., 2008]. Constructs encoding MBP-TBX5-mutants were constructed by PCR using pcDNA-based expression plasmids mentioned below as a template. Eukaryotic expression vectors pcDNA-flagTBX5, pcDNA-flag-NKX2-5, pcDNA-myc-NKX2-5, and pcDNAmyc-GATA4, as well as the Nppa luciferase reporter construct had already been described [Habets et al., 2002; Garg et al., 2003; Postma et al., 2008]. pcDNA-Flag-TBX5-mutants were constructed using site directed mutagenesis. PCR generated constructs were fully verified by sequencing. Transfections were performed using polyethylenimine (25 kDa, linear, Brunschwick).
Nuclear Localization Immortalized rat neonatal heart derived cells (H10 cells) [Jahn et al., 1996] were seeded on cover slips in standard 12-wells plates and transfected with 500 ng wild type (WT) or mutant pcDNA-flagTBX5. Twenty-four hour post-transfection, cells were fixed in 2% paraformaldehyde, permeabilized using 0.3% Triton X-100, and incubated with mouse anti-flag (Stratagene, Santa Clara, 1:500 for 24 hr) and Alexa488-conjugatedgoat anti-mouse antibodies (Molecular Probes, New York, NY, 1:500 for 1 hr), as previously described [Postma et al., 2008].
BABAN ET AL.
Co-Immuno-Precipitation HEK cells were transfected with a combination of pcDNA-based expression vectors, using empty pcDNA3.1 vector as input correction or negative control. Cells were harvested 48 hr posttransfection and lysed in lysis buffer (150 mM NaCl, 10 mM NaPO4, pH 7.4, 0.2% Triton X-100, 1 mM EDTA, 10% glycerol) for 30 min followed by two short sonification pulses. Cell lysates were cleared by centrifugation (16,000g, 15 min), incubated 2 hr with M2-anti-flag-beads (Sigma-Aldrich, St. Louis, MO) and washed 3 times with lysis buffer. Proteins were eluted by addition of 2 sample buffer (120 mM Tris–HCl pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, bromophenol blue). Samples were run on 12% polyacrylamide gel (SDS–PAGE) and blotted onto 0.45 mm polyvinylidene fluoride membrane (PVDF; Immobilon P, Millipore, Darmstadt, Germany). Incubations were performed in blocking buffer (2% protifar plus [Nutricia, Zoetermeer, the Netherlands], 50 mM Tris pH 7.5, 150 mM NaCl, 0.1% Tween20 [Sigma]). Immunodetection was performed using mouse anti-FLAG (M2, Stratagene), rabbit anti-myc (Sigma) or goat anti-Gata4 (E-20; Santa-Cruz, Dallas) and appropriate horse-radish peroxidase conjugated secondary antibodies (GAM-HRP, DAR-HRP, or DAG-HRP). Blots were visualized using enhanced chemiluminescence (GE Healthcare-life sciences, New York, NY), recorded with a LAS-3000 imager (Fuji Film, Tokyo, Japan) and analyzed using image analysis software (AIDA v3.44, Raytest, Straubenhardt, Germany). Results of three independent experiments were subjected to statistical analysis using two-tailed t-test.
Luciferase Assay Neonatal rat heart myocytes, immortalized with a temperaturesensitive SV40 antigen (H10 cells) [Jahn et al., 1996], grown in standard 12-wells plates in DMEM supplemented with 10% FCS (Gibco-BRL, New York, NY) and glutamine, were transfected in triplicate. Standard 700 ng Nppa-luciferase construct was co-transfected with 3 ng of phRG-TK vector, as normalization control (Promega, Madison), together with appropriate combinations of pcDNA3.1 constructs. Measurements were performed on a Glomax E9031 luminometer. Duplo transfection experiments were repeated at least three times for each condition, data were corrected for intersession variation as previously described [Ruijter et al., 2006]. Statistical analysis was performed using two-tailed t-test, P < 0.05 was considered significant.
3 screened showed a heterozygous non-synonymous mutation in TBX5. Their clinical features are reported below.
CLINICAL REPORT Patient 1: p.R279XTBX5 The proband is the second male child of healthy first degree cousins originally from Morocco. During pregnancy there was no exposure to drugs, alcohol, smoking, or infections. The child was born at fullterm after an uncomplicated pregnancy by vaginal delivery with a birth weight of 3 kg. TOF was diagnosed at age 3 months. The child came to our attention at the age of 2 years and 8 months. He had feeding difficulties, poor weight gain, pre-syncopal episodes, and cyanotic spells. Weight and height were 12.5 kg (10th centile) and 87 cm (5th centile), respectively. Echocardiography showed TOF with a severe right ventricular outflow tract obstruction in addition to a large atrial septal defect ostium secundum type. There was pulmonary valve annulus hypoplasia and mild hypoplasia of the pulmonary artery trunk and proximal branches. Electrocardiography (ECG) documented complete atrioventricular (AV) block and ventricular escape rhythm with a heart rate of 50 bpm. He underwent corrective surgery and received pace maker implantation. The patient was first seen by a geneticist at the age of 5 years. Physical examination showed bilateral asymmetric triphalangeal thumbs, bilateral fifth finger clinodactyly, and sloping shoulders. These findings were retrospectively confirmed by upper limb radiographs (Fig. 1). Subsequent organ and lower limb examinations were normal, including range of joints movements (except for the affected upper limbs), hair, nail and teeth growth, and facial features. Psychomotor development was adequate for his age and a renal ultrasound was normal. Chromosome analysis on peripheral blood leukocytes revealed normal a male karyotype (46,XY).
RESULTS To determine whether TBX5, NKX2.5, or GATA4 mutations could occur with TOF, we recruited 100 TOF patients for genetic screening. Initial FISH analysis showed a 22q11.2 deletion in 6/100 (6.0%) patients, who were excluded from the subsequent screening. No disease-related mutations of pathogenic significance were detected in either NKX2.5 or GATA4. A synonymous single nucleotide polymorphism (SNP) rs2277923 was found in NKX2.5 in 14 patients. In addition, one frequent non-synonymous SNP in the second exon of GATA4 (rs3729856) and one SNP in the 5UTR of TBX5 (rs12372585) were identified. Two of 94 (2.1%) TOF patients
FIG. 1. Patient 1 is the second child of first degree cousins. Pictures of the hand and X-rays show finger-like thumbs and clinodactyly of the fifth fingers.
4
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
TBX5 gene screening revealed a heterozygous change, c.835C>T in TBX5 in exon 8, leading to a substitution of arginine at amino acid position 279 for a premature stop codon (p.R279X). This mutation is absent from dbSNP and both the 1000G exomes and the ESP exomes (>6,000). This mutation has previously been reported to be causal for HOS [Heinritz et al., 2005]. Both parents had a normal appearance, normal ECG and echocardiography, and did not carry the disease-causing mutation. Therefore, the mutation in the proband occurred de novo.
Patient 2: p.S372L TBX5 The proband is the first male child of healthy nonconsanguineous Italian parents who has two younger healthy sisters. He was born at full-term of an uncomplicated pregnancy by vaginal delivery; during pregnancy there was no exposure to drugs, alcohol, smoking, or infections. Birth weight was 3.880 kg. At birth, a heart murmur was detected and echocardiography showed TOF, an atrial septal defect ostium secundum type, and hypoplasia of both proximal pulmonary artery branches. A preoperative ECG showed normal sinus rhythm and normal atrioventricular conduction. At the age of 10 months he underwent corrective surgery, and developed postoperative right bundle branch block on ECG. On longterm cardiologic follow-up, rhythm and conduction disturbances became more evident including left anterior hemiblock and spo-
radic episodes of junctional rhythm on Holter recording. The PRinterval was consistently at the upper normal limit, but never reached the duration first degree AV block. At the age of 8 years and 6 months, he was examined by a geneticist who noted that his weight and height were 29 kg (70th centile), and 136 cm (85th centile), respectively. Physical examination showed normal upper limbs, confirmed by upper radiography (Fig. 2). Other organ and lower limb examinations were normal including range of joints movements, hair, nail and teeth growth, and facial features. Psychomotor development was adequate for his age and renal ultrasound was normal. Chromosome analysis on peripheral blood leukocytes showed a normal male karyotype (46,XY). Screening TBX5 showed a non-synonymous variation was identified in exon 9, causing a substitution of a serine for leucine at amino acid position 372 (c.1115C>T, p.S372L) (Fig. 3). This variation has not previously been described in literature and is absent from the 1000G exome data. It is present in NHLBI Exome Sequencing Project (ESP) (>6,000 exomes) with a frequency of 2/ 6734exomes (rs143068551). The proband’s father had no signs of upper limb abnormalities and had a normal ECG and echocardiography. The father did not carry the p.S372L mutation. Conversely, the asymptomatic mother was a carrier of the p.S372L TBX5 mutation. Clinical evaluation showed an ECG in sinus rhythm with ventricular extrasystoles, and echocardiography demonstrated an atrial septal aneurysm. She had no upper limb abnormalities
FIG. 2. Patient 2. A: Hand X-rays of both the proband and mother excluded skeletal defects. B: Pedigree of the second family, both Patient 2 and his mother carry the p.S372L mutation, as indicated by þ. C: The proband’s normal metacarpophalangeal profile.
BABAN ET AL.
5
FIG. 3. A: Relative activation of the NPPA-luciferase construct by TBX5 mutants compared with WT TBX5, without and with NKX2.5 ( P < 0.05). B: Graph showing quantification of CoIP results from three separate experiments, error bars represent standard errors, P < 0.01. C: Nuclear localization of WT and mutant TBX5 transfected to H10 cells as shown by immunofluorescence. In red, all nuclei; in green, TBX5 (anti-flag). D: Evolutionary conservation of the area surround p.S372L among various species. A schematic diagram representing the TBX5 protein and its various known subdomains, NLS nuclear localization signal, NES nuclear export signal, AD activation domain.
by clinical examination or radiography) (Fig. 2). Further investigation of the molecular phenotype of the p.S372L TBX5 mutation was carried out, since the p.R279X mutant has been identified several times before and is molecularly well characterized [Porto et al., 2010; Baban et al., 2014].
Normal Subcellular Distribution of p.S372L TBX5 Since TBX5 is a transcription factor, it should be present in the nucleus. Therefore, subcellular localization of the mutant p.S372L TBX5 protein was assessed by expressing flag-tagged mutant protein in rat heart-derived cells (H10). The localization of mutant and wild type protein was visualized with anti-flag immunostaining. Figure 3C shows that both the wild type TBX5 protein as well as the mutant p.S372L TBX5 display nuclear localization, indicating that the process of nuclear import is not affected by the mutation.
p.S372L Displays a Gain-of-Function in Target Gene Activation The functionality of the mutant protein was tested in a cellular context, utilizing a reporter assay in which the proximal Nppa promoter (270 to þ1) drives luciferase reporter gene expression. This promoter contains functional T-box binding elements (TBEs)
essential for Nppa regulation during development and adult life [Hiroi et al., 2001]. p.S372L TBX5 shows significantly increased Nppa promoter activation compared to wild-type TBX5 (Fig. 3A). TBX5 synergizes with NKX2-5 in the activation of this promoter and, therefore, we tested the synergetic effect between NKX2-5 and the mutant TBX5 proteins. Indeed, wild-type TBX5 and NKX2-5 synergistically activate the reporter construct (Fig. 3A). Interestingly, the p.S372L mutant showed a strongly increased activation of the reporter in presence of NKX2-5, and notably even higher than the previously described TBX5 gain-of-function mutant p.G125R [Postma et al., 2008].
p.372L TBX5 Affects NKX2.5 Binding, But Not GATA4 To further explore binding of TBX5 mutants to NKX2-5, we tested the interaction between full length TBX5 and NKX2-5 in the context of mammalian cells using co-immunoprecipitation (CoIP). As reported in Figure 3B, the previously reported p.M74I mutant [Postma et al., 2008] and the p.S372L mutant proteins show a drastic reduction of NKX2-5 binding capacity, while p.G125R has a binding capacity comparable to the wild-type protein. GATA4, another essential partner of TBX5 during heart development, can also bind to TBX5 [Garg et al., 2003]. Therefore, we subsequently
6
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
tested the ability of TBX5 mutants to bind GATA4 using CoIP. Mutant protein p.M74I lost the capacity to interact with GATA4, as previously reported, however, p.S372L had a GATA4 binding capacity similar to the wild-type TBX5 protein in our assay.
DISCUSSION TOF is the most common form of cyanotic CHD in humans, it has a good surgical outcome and an acceptable quality of life [Bailliard and Anderson, 2009]. Over the last two decades attention has shifted from immediate surgical outcomes to understanding the underlying etiology. As mentioned, about 10–20% of patients with TOF have a chromosomal anomaly including microdeletion of chromosome 22q11.2 [Scambler, 2000; van Engelen et al., 2010] and trisomy 21 [Rauch et al., 2010]. Recent studies also identified that mutations in genes such as TBX1, JAG1, GATA4, and NKX2.5 can cause TOF [Rauch et al., 2010; Cordell et al., 2013]. However, despite these advances, TOF remains unknown in the majority of patients. Holt–Oram syndrome is a rare autosomal dominant condition that occurs in approximately 1/100,000 individuals. It is characterized by bilateral asymmetric upper limb defects in all patients, with CHD accompanied by conduction defects in about two-thirds of cases [Holt and Oram, 1960; Basson et al., 1994]. Upper limb defects are typically radial ray defects ranging from mild carpal bone abnormalities to severe reduction defects such as phocomelia; CHD and/or conduction defects are mainly isolated ostium secun-
dum ASD or muscular ventricular septal defect [Newbury-Ecob et al., 1996; Basson et al., 1999]. Less frequently observed are complex CHD including TOF, double outlet right ventricle, total anomalous pulmonary venous return, aortic abnormalities, atrioventricular canal defects, hypoplastic left heart) [Glauser et al., 1989], mitral valve disease, pulmonary artery abnormalities, trabecular anomalies, tricuspid atresia, and truncus arteriosus [Sahn et al., 1981; Koishizawa et al., 1995; Bruneau et al., 1999; Baban et al., 2014]. Vascular abnormalities include peripheral vessel hypoplasia and coronary artery abnormalities [Holt and Oram, 1960; Wu et al., 1991]. TBX5 mutations are rarely reported in complex CHD [Basson et al., 1999; Heinritz et al., 2005]. McDermott et al. [2005] recommended TBX5 analyses for individuals who meet the clinical criteria for HOS (i.e., CHD in addition to, but not instead of, septation defects, and/or conduction defects). Indeed, both our patients with TBX5 mutations displayed ASD and conduction defects. Co-occurrence of TOF and HOS was described in 18 reports (Table II). As in the current study, ASD was noted in 3 out of 18 (16.7%) patients [Wu et al., 1991; el-Gindi and Ahmed-Nasr, 1993; Yang et al., 2000]. All 18 probands demonstrated varying degrees of upper limb defects, which were not observed in the patient with p. S372L mutation. Whereas none of the 18 probands had conduction defects, both patients presented here displayed complete AV block, and progressive left anterior hemiblock and junctional rhythm, respectively. Transmission was sporadic in six probands, familial in three, and unknown in 11. The HOS diagnosis was made on clinical
TABLE II. Summary of the Previously Reported TOF in Clinically and/or Molecularly Confirmed Holt–Oram Syndrome Patient 1 Patient 2 Patient 3
Congenital heart defects TOF þ PA hypoplasia TOF þ ASD TOF þ ASD-OS
HOS diagnosis Clinical Clinical Clinical
Inheritance Sporadic ? Sporadic
References Najjar et al. [1988] Wu et al. [1991] el-Gindi and Ahmed-Nasr [1993]
Patient 4 Patient 5
TOF TOF
Clinical Clinical
Familial Sporadic
Patient 6
TOF
Clinical
Sporadic
Patients 7–14
TOF (8 patients)
?
Patient 15
TOF þ ASD
Sporadic
Yang et al. [2000]
Patient 16 Patient 17
TOF TOF
? ?
Sajeev et al. [2005] McDermott et al. [2005]
Patient 18 Patient 1
TOF TOF, large ASD-OS, PA hypoplasia, complete AV block TOF, ASD-OS, proximal PA hypoplasia, conduction defect
No details regarding TBX5 mutations Clinical. Negative TBX5 screening Clinical TBX5 mutation: S196ter Clinical TBX5 mutation: p. R279X
Lehner et al. [1994] Newbury-Ecob et al. [1996] Newbury-Ecob et al. [1996] Bruneau et al. [1999]
Familial Sporadic
Kumar et al. [2012] Present report
Familial
Present report
Patient 2
TBX5 mutation: p. S372L
TOF, Tetralogy of Fallot; PA, pulmonary artery; ASD-OS, atrial septal defect ostium secundum; AV block, atrioventricular block.
Others 1st trimester exposure to contraception pills Absent left kidney
Vertebral defects Parents: first degree cousins Mother: ventricular extrasystoles and atrial septal aneurysm
BABAN ET AL. grounds in nine of them. Unfortunately, no mutation description is available for the eight patients described by Bruneau et al. [1999]. The only reported TBX5 mutation is p.S196X [McDermott et al., 2005]. Associated anomalies included defects of the anterior vertebral bodies [McDermott et al., 2005] and absent left kidney [Lehner et al., 1994]. Conversely, Mori and Bruneau [2004] exclude the association of TOF and HOS, suspect the TOF/HOS association is a result of misdiagnosis. We believe that an association between TBX5 mutations and TOF does exist. Thus far, more than a 100 TBX5 mutations have been published including nonsense (31), frameshift (28), splice site (15), missense mutations (34), and some large (chromosomal) rearrangements. Around 70% of these TBX5 mutations lead to a premature termination codon (stop codon) as a direct (nonsense mutation), or indirect consequence (splice site and frameshift) [Barnett and Postma, 2014]. Neither the mutation type nor the location within the T box are predictive of malformation severity in HOS [Heinritz et al., 2005; Boogerd et al., 2010]. The TBX5 mutation detection rate in HOS with strict diagnostic criteria ranges from 54% to 74% [McDermott et al., 2005; Debeer et al., 2007]. The mutation we describe in Patient 1, p.R279X, together with three other TBX5 mutations (p.S196X, p.T223M, p.R237W), are thought to be responsible for 50% of HOS [Heinritz et al., 2005]. The vast majority of TBX5 mutations lead to loss-of-function either by lack of protein or diminished DNA binding. The only exception is the p.G125R gain-of-function mutation which is associated with atypical HOS and paroxysmal atrial fibrillation [Postma et al., 2008]. The p.S372L mutation, identified in Patient 2 (and his mother) is novel. Our functional analysis of this mutant protein shows a dramatic increase in Nppa promoter activation, both in absence and presence of NKX2-5. Therefore, this mutation is the second reported gain-of-function mutation in TBX5. Consistent with the data presented for the p.G125R gain-of-function mutant, this patient’s phenotype (TOF, ASD ostium secundum, and progressive arrhythmic ECG changes) does not resemble classical HOS. This is perhaps not surprising, as TBX5 target genes are highly sensitive to TBX5 dosage, and differences in dosage might thus lead to differences in phenotypes [Mori et al., 2006]. One could speculate that gain-of-function mutations show deleterious effects on heart development, but not on the development of the upper limbs. Indeed, recently Smemo et al. [2012] showed that a mutation in TBX5 enhancer can lead to isolated CHD, effectively demonstrating that it is possible to decouple the heart and hand phenotypes of TBX5 mutations.
LIMITATION We report on the investigation of 94 unselected TOF patients for mutations in TBX5, NKX2.5, and GATA4. We acknowledge that the first case would not have been included in this series if the clinical diagnosis of Holt–Oram syndrome was made earlier. However, the hand phenotype of the proband was so mild that the pediatric cardiologists and surgeons overlooked HOS as a diagnosis at that time. This emphasizes the need for the involvement of clinical geneticists at early stages of a diagnosis, as detecting genetic syndromes by non-experts is notoriously difficult given their variable phenotype.
7
CONCLUSIONS We identified TBX5 mutations in two out of 94 (2.1%) TOF patients. One of the mutations is a previously described TBX5 mutation with a mild, but typical HOS phenotype. The second mutation, however, is a novel inherited gain-of-function mutation in patients with apparent isolated CHD. This could suggest that a TBX5 gain-of-function mutation decouples the heart and hand association in HOS. In conclusion, identification of mutations in TBX5 might be underestimated, rather than rare in TOF patients; however, further studies are needed to draw solid conclusions.
ACKNOWLEDGMENTS We thank the patients and families who cooperated in this study. We thank Aho Ilgun for his technical assistance, and the librarians at Bambino Gesu` Children Hospital for their help in gathering HOS bibliography.
REFERENCES Baban A, Pitto L, Pulignani S, Cresci M, Mariani L, Gambacciani C, Digilio MC, Pongiglione G, Albanese S. 2014. Holt–Oram syndrome with intermediate atrioventricular canal defect, and aortic coarctation: Functional characterization of a de novo TBX5 mutation. Am J Med Genet Part A 164A:1419–1424. Bailliard F, Anderson RH. 2009. Tetralogy of Fallot. Orphanet J Rare Dis 4:2. doi: 10.1186/1750-1172-4-2 Barnett P, Postma AV. 2014. Molecular genetics of Holt–Oram syndrome. In: eLS. Chichester: John Wiley & Sons, Ltd. doi: 10.1002/ 9780470015902.a0024329 Basson CT, Cowley GS, Solomon SD, Weissman B, Poznanski AK, Traill TA, Seidman JG, Seidman CE. 1994. The clinical and genetic spectrum of the Holt–Oram syndrome (heart-hand syndrome). N Engl J Med 330:885–891. Basson CT, Huang T, Lin RC, Bachinsky DR, Weremowicz S, Vaglio A, Bruzzone R, Quadrelli R, Lerone M, Romeo G, Silengo M, Pereira A, Krieger J, Mesquita SF, Kamisago M, Morton CC, Pierpont ME, Mu¨ller CW, Seidman JG, Seidman CE. 1999. Different TBX5 interactions in heart and limb defined by Holt–Oram syndrome mutations. Proc Natl Acad Sci USA 96:2919–2924. Boogerd KJ, Wong LYE, Christoffels VM, Klarenbeek M, Ruijter JM, Moorman AF, Barnett P. 2008. Msx1 and Msx2 are functional interacting partners of T-box factors in the regulation of connexin 43. Cardiovasc Res 78:485–493. Boogerd CJ, Dooijes D, Ilgun A, Mathijssen IB, Hordijk R, van de Laar IM, Rump P, Veenstra-Knol HE, Moorman AF, Barnett P, Postma AV. 2010. Functional analysis of novel TBX5 T-box mutations associated with Holt–Oram syndrome. Cardiovasc Res 88:130–139. Bruneau BG, Logan M, Davis N, Levi T, Tabin CJ, Seidman JG, Seidman CE. 1999. Chamber-specific cardiac expression of Tbx5 and heart defects in Holt–Oram syndrome. Dev Biol 211:100–108. Cordell HJ, To¨pf A, Mamasoula C, Postma AV, Bentham J, Zelenika D, Heath S, Blue G, Cosgrove C, Granados Riveron J, Darlay R, Soemedi R, Wilson IJ, Ayers KL, Rahman TJ, Hall D, Mulder BJ, Zwinderman AH, van Engelen K, Brook JD, Setchfield K, Bu’Lock FA, Thornborough C, O’Sullivan J, Stuart AG, Parsons J, Bhattacharya S, Winlaw D, Mital S, Gewillig M, Breckpot J, Devriendt K, Moorman AF, Rauch A, Lathrop GM, Keavney BD, Goodship JA. 2013. Genome-wide association study identifies loci on 12q24 and 13q32 associated with tetralogy of Fallot. Hum Mol Genet 22:1473–1481.
8
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
De Luca A, Sarkozy A, Ferese R, Consoli F, Lepri F, Dentici ML, Vergara P, De Zorzi A, Versacci P, Digilio MC, Marino B, Dallapiccola B. 2011. New mutations in ZFPM2/FOG2gene in tetralogy of Fallot and double outlet right ventricle. Clin Genet 80:184–190.
Mori AD, Zhu Y, Vahora I, Nieman B, Koshiba-Takeuchi K, Davidson L, Pizard A, Seidman JG, Seidman CE, Chen XJ, Henkelman RM, Bruneau BG. 2006. Tbx5-dependent rheostatic control of cardiac gene expression and morphogenesis. Dev Biol 297:566–586.
Debeer P, Race V, Gewillig M, Devriendt K, Frijns JP. 2007. Novel TBX5 mutations in patients with Holt–Oram syndrome. Clin Orthop Relat Res 462:20–26.
Najjar H, Mardini M, Tabbaa R, Nyhan WL. 1988. Variability of the Holt– Oram syndrome in Saudi individuals. Am J Med Genet 29:851–855.
Dolk H, Loane M, Garne E. 2010. The prevalence of congenital anomalies in Europe. Adv Exp Med Biol 686:349–364.
Nemer G, Fadlalah F, Usta J, Nemer M, Dbaibo G, Obeid M, Bitar F. 2006. A novel mutation in the GATA4 gene in patients with Tetralogy of Fallot. Hum Mutat 27:293–294.
el-Gindi E, Ahmed-Nasr M. 1993. Hormonal versus genetic factors in limb and heart anomalies. Cardiovasc Surg 1:381–383.
Newbury-Ecob RA, Leanage R, Raeburn JA, Young ID. 1996. Holt–Oram syndrome: A clinical genetic study. J Med Genet 33:300–307.
Garg V, Kathiriya IS, Barnes R, Schluterman MK, King IN, Butler CA, Rothrock CR, Eapen RS, Hirayama-Yamada K, Joo K, Matsuoka R, Cohen JC, Srivastava D. 2003. GATA4 mutations cause human congenital heart defects and reveal an interaction with TBX5. Nature 424:443–447.
Perry LW, Neill CA, Ferencz C, EUROCAT Working Party on. 1993. Congenital Heart Disease: Perspective in Pediatric Cardiology. Epidemiology of congenital heart disease, the Baltimore-Washington Infant Study 1981–89. Armonk, NY: Futura. pp 33–62.
Glauser TA, Zackai E, Weinberg P, Clancy R. 1989. Holt–Oram syndrome associated with the hypoplastic left heart syndrome. Clin Genet 36:69–72.
Pizzuti A, Sarkozy A, Newton AL, Conti E, Flex E, Digilio MC, Amati F, Gianni D, Tandoi C, Marino B, Crossley M, Dallapiccola B. 2003. Mutations of ZFPM2/FOG2 gene in sporadic cases of tetralogy of Fallot. Hum Mutat 22:372–377.
Goldmuntz E, Geiger E, Benson DW. 2001. NKX2.5 mutations in patients with tetralogy of Fallot. Circulation 104:2565–2568. Guida V, Chiappe F, Ferese R, Usala G, Maestrale G, Iannascoli C, Bellacchio E, Mingarelli R, Digilio MC, Marino B, Uda M, De Luca A, Dallapiccola B. 2011. Novel and recurrent JAG1 mutations in patients with tetralogy of Fallot. Clin Genet 80:591–594. Habets PE, Moorman AF, Clout DE, van Roon MA, Lingbeek M, van Lohuizen M, Campione M, Christoffels VM. 2002. Cooperative action of Tbx2 and Nkx2.5 inhibits ANF expression in the atrioventricular canal: implications for cardiac chamber formation. Genes Dev 16:1234– 1246. Heinritz W, Moschik A, Kujat A, Spranger S, Heilbronner H, Demuth S, Bier A, Tihanyi M, Mundlos S, Gruenauer-Kloevekorn C, Froster UG. 2005. Identification of new mutations in the TBX5gene in patients with Holt–Oram syndrome. Heart 91:383–384. Hiroi Y, Kudoh S, Monzen K, Ikeda Y, Yazaki Y, Nagai R, Komuro I. 2001. Tbx5 associates with Nkx2-5 and synergistically promotes cardiomyocyte differentiation. Nat Genet 28:276–280. Holt M, Oram S. 1960. Familial heart disease with skeletal malformations. Br Heart J 22:236–242. Jahn L, Sadoshima J, Greene A, Parker C, Morgan KG, Izumo S. 1996. Conditional differentiation of heart- and smooth muscle-derived cells transformed by a temperature-sensitive mutant of SV40 T antigen. J Cell Sci 109:397–407. Koishizawa T, Hayashi N, Tadokoro M, Nonaka T, Fujiki T, Fujikura T, Tonari K, Sasagawa N, Honda K, Ikeda K. 1995. A case report of the radical correction of a truncus arteriosus and peripheral pulmonary stenosis in association with Holt–Oram syndrome. Kyobu Geka 48:133– 136. Kumar V, Agrawal V, Jain D, Shankar O. 2012. Tetralogy of Fallot with Holt–Oram syndrome. Indian Heart J 64:95–98. Lehner R, Wenzl R, Vanura H, Frank W, Safar P, Husslein P. 1994. Diagnosis of familial Holt–Oramsyndrome. Z Geburtshilfe Perinatol 198:143–149. McDermott DA, Bressan MC, He J, Lee JS, Aftimos S, Brueckner M, Gilbert F, Graham GE, Hannibal MC, Innis JW, Pierpont ME, Raas-Rothschild A, Shanske AL, Smith WE, Spencer RH, St John- Sutton MG, van Maldergem L, Waggoner DJ, Weber M, Basson CT. 2005. TBX5 genetic testing validates strict clinical criteria for Holt- Oram syndrome. Pediatr Res 58:981–986. Mori AD, Bruneau BG. 2004. TBX5 mutations and congenital heart disease: Holt–Oram syndrome revealed. Curr Opin Cardiol 19:211–215.
Porto MP, Vergani N, Carvalho AC, Cernach MC, Brunoni D, Perez AB. 2010. Novel mutations in the TBX5 gene in patients with Holt–Oram Syndrome. Genet Mol Biol 33:232–236. Postma AV, van de Meerakker JB, Mathijssen IB, Barnett P, Christoffels VM, Ilgun A, Lam J, Wilde AA, Lekanne Deprez RH, Moorman AF. 2008. A gain-of-function TBX5 mutation is associated with atypical Holt– Oram syndrome and paroxysmal atrial fibrillation. Circ Res 102:1433– 1442. Rauch R, Hofbeck M, Zweier C, Koch A, Zink S, Trautmann U, Hoyer J, Kaulitz R, Singer H, Rauch A. 2010. Comprehensive genotype-phenotype analysis in 230 patients with tetralogy of Fallot. J Med Genet 47:321–331. Ruijter JM, Thygesen HH, Schoneveld OJLM, Das AT, Berkhout B, Lamers WH. 2006. Factor correction as a tool to eliminate between-session variation in replicate experiments: Application to molecular biology and retrovirology. Retrovirology 3:2. Sahn DJ, Goldberg SJ, Allen HD, Canale JM. 1981. Cross-sectional echocardiographic imaging of supracardiac total anomalous pulmonary venous drainage to a vertical vein in a patient with Holt–Oram syndrome. Chest 79:113–115. Sajeev CG, Fassaludeen M, Venugopal K. 2005. Tetralogy of Fallot with absent thumb and first metacarpal. Int J Cardiol 102:349–350. Scambler PJ. 2000. The 22q11 deletion syndromes. Hum Mol Genet 16:2421–2426. Smemo S, Campos LC, Moskowitz IP, Krieger JE, Pereira AC, Nobrega MA. 2012. Regulatory variation in a TBX5 enhancer leads to isolated congenital heart disease. Hum Mol Genet 21:3255–3263. van der Linde D, Konings EE, Slager MA, Witsenburg M, Helbing WA, Takkenberg JJ, Roos-Hesselink JW. 2011. Birth prevalence of congenital heart disease worldwide: A systematic review and meta-analysis. J Am Coll Cardiol 58:2241–2247. van Engelen K, Topf A, Keavney BD, Goodship JA, van der Velde ET, Baars MJ, Snijder S, Moorman AF, Postma AV, Mulder BJ. 2010. 22q11.2 deletion syndrome is under-recognised in adult patients with tetralogy of Fallot and pulmonary atresia. Heart 96:621–624. Wu JM, Young ML, Wang TR, Lin SJ, Chang JK, Wei J, Wu J. 1991. Unusual cardiac malformations in Holt–Oram syndrome: Report of two cases. Zhonghua Min Guo Xiao Er Ke Yi Xue Hui Za Zhi 32:100–104. Yang J, Hu D, Xia J, Yang Y, Yin B, Hu J, Zhou X. 2000. TBX5 mutation in Chinese patients with Holt–Oram syndrome. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 17:233–235.
Identification of TBX5 Mutations in a Series of 94 Patients With Tetralogy of Fallot Anwar Baban,1* Alex Vincent Postma,2 Monica Marini,3 Gianluca Trocchio,4 Antonella Santilli,1 Monica Pelegrini,1 Pietro Sirleto,5 Margherita Lerone,3 Sonia Bernadette Albanese,1 Phil Barnett,2 Cornelis Job Boogerd,2 Bruno Dallapiccola,5 Maria Cristina Digilio,5 Roberto Ravazzolo,3,6 and Giacomo Pongiglione1 1
Department of Pediatric Cardiology and Cardiosurgery, Bambino Gesu` Children Hospital, IRCCS, Rome, Italy
2
Department of Anatomy, Embryology and Physiology, Academic Medical Center, Amsterdam, The Netherlands Laboratory of Molecular Genetics, Gaslini Children Hospital, Genoa, Italy
3 4
Cardiovascular and Cardiosurgical Department, Gaslini Children Hospital, Genoa, Italy Unit of Medical Genetics and Cytogenetics, Bambino Gesu` Children Hospital, IRCCS, Rome, Italy 6 Department of Pediatrics and Center of Excellence for Biomedical Research (CEBR), University of Genoa, Genoa, Italy 5
Manuscript Received: 3 April 2014; Manuscript Accepted: 22 August 2014
Tetralogy of Fallot (TOF) (OMIM #187500) is the most frequent conotruncal congenital heart defect (CHD) with a range of intra- and extracardiac phenotypes. TBX5 is a transcription factor with well-defined roles in heart and forelimb development, and mutations in TBX5 are associated with Holt–Oram syndrome (HOS) (OMIM#142900). Here we report on the screening of 94 TOF patients for mutations in TBX5, NKX2.5 and GATA4 genes. We identified two heterozygous mutations in TBX5. One mutation was detected in a Moroccan patient with TOF, a large ostium secundum atrial septal defect and complete atrioventricular block, and features of HOS including bilateral triphalangeal thumbs and fifth finger clinodactyly. This patient carried a previously described de novo, stop codon mutation (p.R279X) located in exon 8 causing a premature truncated protein. In a second patient from Italy with TOF, ostium secundum atrial septal defect and progressive arrhythmic changes on ECG, we identified a maternally inherited novel mutation in exon 9, which caused a substitution of a serine with a leucine at amino acid position 372 (p.S372L, c.1115C>T). The mother’s clinical evaluation demonstrated frequent ventricular extrasystoles and an atrial septal aneurysm. Physical examination and radiographs of the hands showed no apparent skeletal defects in either child or mother. Molecular evaluation of the p.S372L mutation demonstrated a gain-of-function phenotype. We also review the literature on the co-occurrence of TOF and HOS, highlighting its relevance. This is the first systematic screening for TBX5 mutations in TOF patients which detected mutations in two of 94 (2.1%) patients. Ó 2014 Wiley Periodicals, Inc.
Key words: Tetralogy of Fallot (TOF); atrial septal defects; conduction defects; TBX5 mutations; gain-of-function mutation Ó 2014 Wiley Periodicals, Inc.
How to Cite this Article: Baban A, Postama AV, Marini M, Trocchio G, Santilli A, Pelegrini M, Sirleto P, Lerone M, Albanese SB, Barnett P, Boogerd CJ, Dallapiccola B, Digilio MC, Ravazzolo R, Pongiglione G. 2014. Identification of TBX5 mutations in a series of 94 patients with Tetralogy of Fallot. Am J Med Genet Part A 9999:1–8.
INTRODUCTION Congenital heart defects (CHD) are the most common birth defects in children, reported in almost 1% of live births and are one of the leading causes of morbidity and mortality in the pediatric age group. Tetralogy of Fallot (TOF) is the most common cyanotic CHD with an incidence of approximately 2.5–3.5/10,000 live births representing 5–7% of all CHD [Perry et al., 1993; Dolk et al., 2010; van der Linde et al., 2011]. Approximately 15% of TOF patients have a chromosome 22q11.2 deletion [Scambler, 2000; van Engelen et al., 2010], and another 7% of TOF patients have trisomy 21 Conflict of interest: None. Grant sponsor: European Union, Health-e-Child Integrated Project; Grant number: IST-2004-027749. Correspondence to: Dr. Anwar Baban, M.D., Ph.D., Department of Pediatric Cardiology and Cardiosurgery, Bambino Gesu` Children Hospital, IRCCS, Rome, Italy. E-mail: [email protected] Article first published online in Wiley Online Library (wileyonlinelibrary.com): 00 Month 2014 DOI 10.1002/ajmg.a.36783
1
2 [Rauch et al., 2010]. Mutations in the NKX2.5 (OMIM þ600584), GATA4 (OMIM þ600576), ZFPM2 (OMIM þ603693) and JAG1 (OMIM þ601920) genes have occasionally been reported in nonsyndromic TOF patients [Goldmuntz et al., 2001; Pizzuti et al., 2003; Nemer et al., 2006; Rauch et al., 2010; De Luca et al., 2011; Guida et al., 2011]. In order to assess the incidence and evaluate the genotypephenotype correlation of these potentially frequent causes of TOF, we performed karyotyping, 22q11.2 microdeletion testing, and sequencing of the TBX5, NKX2.5, and GATA4 genes in 100 unselected TOF patients. We report here on the results of our screening and describe two TBX5 mutations identified in TOF patients, characterizing the molecular effects of these mutations.
MATERIALS AND METHODS Patients Unselected TOF patients were recruited in two tertiary pediatric centers: the Bambino Gesu` Children Hospital, IRCCS in Rome and the Gaslini Children Hospital IRCCS in Genoa. One hundred patients consented to participate in the study. The study protocol was approved by the Ethical Committees of both hospitals. Written informed consent was obtained from patients’ parents and/or patients >18 years of age. A specific data collection form was used at presentation by parents and/or patients to report social situation and previous medical history (hearing, vision and speech development, frequency of infections, seizures, non-cardiac surgeries, education, profession). Psychobehavioral development was assessed from neuropediatric evaluation or special care during pre-school or school service. Information was obtained about the main clinical features including extracardiac anomalies (neurologic, otolaryngologic, gastrointestinal, urogenital, skeletal, and craniofacial). The cardiac phenotype was definedby echocardiography performed on all patients. Previous medical records and surgical reports were obtained for almost all patients. Blood samples were obtained to perform standard karyotyping, 22q11 microdeletion screening and sequencing of the three candidate genes (TBX5 (NM_000192.3), GATA4 (NM_002052.3), NKX 2.5 (NM_004387.3)).
Genetic Testing Chromosomal analysis was performed after GTG banding at a 450– 500 banding resolution (International System for Human Cytogenetic Nomenclature (ISCN) 2005) from cultured lymphocytes following standard procedures. Fluorescence in situ hybridization (FISH) analysis was performed on metaphase spreads.
DNA Extraction, PCR, and Sequencing Reactions Genomic DNA was extracted from peripheral blood samples with the Puregene Blood Kit (Gentra Systems, Qiagen, Hilden, Germany) according to the manufacturer’s procedure. Mutational analysis of TBX5, NKX2.5, and GATA4 in patients with normal karyotype was performed by direct sequencing of polymerase chain reaction (PCR) amplicons using intronic primers for all coding exons. Oligonucleotides and conditions used to amplify the TBX5
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
TABLE I. Primers Used for TBX5 Screening TBX5 EXON 2 EXON 3 EXON 4 EXON 5 EXON 6 EXON 7 EXON 8 EXON 9A EXON 9B
TTGTCCTCAGAGCAGAACCT AGAGAAGCCGAGCAGGAAAGC CTGTGTTTTGGGGGAGTTTG CCCTTTCCTTCCTTCTTCTC CCCTTAAAATGGATGGAGGC GCCTTTAGCACACAGTAGGA CAGCTACTACTCAACAACCC GAAACCCAGTGAGAAGAAGG CCCTGGCCCCTTTTCAAAAC GTCAAGCCAAGCTCGTGGAT TAAAAGCAGTCCAATGGAGGAC GCCAACCACATGTGAAGGTT TTCTGTGACTTTTCTGGTGG GTAGGAACATGTCAAGGGAA GAACTCCATAGCCCAAGGTC CTGCTGTAGGAAGGCATGCT GCTTGCATGTATGCCAGCTC GATCAGCATCCAGCGACCTT
coding sequence are described in Table I. PCR reactions were carried out in a total volume of 20 ml containing 1 PCR Buffer (Applied Biosystems, Foster City, CA; www.appliedbiosystems. com), 200 mM dNTPs mix, 1.5 mM MgCl2, 10 pmol of each oligonucleotide, 1 U of AmpliTaq Gold Polymerase (Applied Biosystems). PCR products were checked on gel. A panel of 200 normal individuals was screened as controls.
Plasmid Constructs and Transfections Constructs encoding TBX5 fused to maltose binding protein (MBP; pMAL2C-TBX5-T-box) and NKX2-5 fused to GST (pRP265nbNKX2.5) have been described in a previous study [Boogerd et al., 2008]. Constructs encoding MBP-TBX5-mutants were constructed by PCR using pcDNA-based expression plasmids mentioned below as a template. Eukaryotic expression vectors pcDNA-flagTBX5, pcDNA-flag-NKX2-5, pcDNA-myc-NKX2-5, and pcDNAmyc-GATA4, as well as the Nppa luciferase reporter construct had already been described [Habets et al., 2002; Garg et al., 2003; Postma et al., 2008]. pcDNA-Flag-TBX5-mutants were constructed using site directed mutagenesis. PCR generated constructs were fully verified by sequencing. Transfections were performed using polyethylenimine (25 kDa, linear, Brunschwick).
Nuclear Localization Immortalized rat neonatal heart derived cells (H10 cells) [Jahn et al., 1996] were seeded on cover slips in standard 12-wells plates and transfected with 500 ng wild type (WT) or mutant pcDNA-flagTBX5. Twenty-four hour post-transfection, cells were fixed in 2% paraformaldehyde, permeabilized using 0.3% Triton X-100, and incubated with mouse anti-flag (Stratagene, Santa Clara, 1:500 for 24 hr) and Alexa488-conjugatedgoat anti-mouse antibodies (Molecular Probes, New York, NY, 1:500 for 1 hr), as previously described [Postma et al., 2008].
BABAN ET AL.
Co-Immuno-Precipitation HEK cells were transfected with a combination of pcDNA-based expression vectors, using empty pcDNA3.1 vector as input correction or negative control. Cells were harvested 48 hr posttransfection and lysed in lysis buffer (150 mM NaCl, 10 mM NaPO4, pH 7.4, 0.2% Triton X-100, 1 mM EDTA, 10% glycerol) for 30 min followed by two short sonification pulses. Cell lysates were cleared by centrifugation (16,000g, 15 min), incubated 2 hr with M2-anti-flag-beads (Sigma-Aldrich, St. Louis, MO) and washed 3 times with lysis buffer. Proteins were eluted by addition of 2 sample buffer (120 mM Tris–HCl pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, bromophenol blue). Samples were run on 12% polyacrylamide gel (SDS–PAGE) and blotted onto 0.45 mm polyvinylidene fluoride membrane (PVDF; Immobilon P, Millipore, Darmstadt, Germany). Incubations were performed in blocking buffer (2% protifar plus [Nutricia, Zoetermeer, the Netherlands], 50 mM Tris pH 7.5, 150 mM NaCl, 0.1% Tween20 [Sigma]). Immunodetection was performed using mouse anti-FLAG (M2, Stratagene), rabbit anti-myc (Sigma) or goat anti-Gata4 (E-20; Santa-Cruz, Dallas) and appropriate horse-radish peroxidase conjugated secondary antibodies (GAM-HRP, DAR-HRP, or DAG-HRP). Blots were visualized using enhanced chemiluminescence (GE Healthcare-life sciences, New York, NY), recorded with a LAS-3000 imager (Fuji Film, Tokyo, Japan) and analyzed using image analysis software (AIDA v3.44, Raytest, Straubenhardt, Germany). Results of three independent experiments were subjected to statistical analysis using two-tailed t-test.
Luciferase Assay Neonatal rat heart myocytes, immortalized with a temperaturesensitive SV40 antigen (H10 cells) [Jahn et al., 1996], grown in standard 12-wells plates in DMEM supplemented with 10% FCS (Gibco-BRL, New York, NY) and glutamine, were transfected in triplicate. Standard 700 ng Nppa-luciferase construct was co-transfected with 3 ng of phRG-TK vector, as normalization control (Promega, Madison), together with appropriate combinations of pcDNA3.1 constructs. Measurements were performed on a Glomax E9031 luminometer. Duplo transfection experiments were repeated at least three times for each condition, data were corrected for intersession variation as previously described [Ruijter et al., 2006]. Statistical analysis was performed using two-tailed t-test, P < 0.05 was considered significant.
3 screened showed a heterozygous non-synonymous mutation in TBX5. Their clinical features are reported below.
CLINICAL REPORT Patient 1: p.R279XTBX5 The proband is the second male child of healthy first degree cousins originally from Morocco. During pregnancy there was no exposure to drugs, alcohol, smoking, or infections. The child was born at fullterm after an uncomplicated pregnancy by vaginal delivery with a birth weight of 3 kg. TOF was diagnosed at age 3 months. The child came to our attention at the age of 2 years and 8 months. He had feeding difficulties, poor weight gain, pre-syncopal episodes, and cyanotic spells. Weight and height were 12.5 kg (10th centile) and 87 cm (5th centile), respectively. Echocardiography showed TOF with a severe right ventricular outflow tract obstruction in addition to a large atrial septal defect ostium secundum type. There was pulmonary valve annulus hypoplasia and mild hypoplasia of the pulmonary artery trunk and proximal branches. Electrocardiography (ECG) documented complete atrioventricular (AV) block and ventricular escape rhythm with a heart rate of 50 bpm. He underwent corrective surgery and received pace maker implantation. The patient was first seen by a geneticist at the age of 5 years. Physical examination showed bilateral asymmetric triphalangeal thumbs, bilateral fifth finger clinodactyly, and sloping shoulders. These findings were retrospectively confirmed by upper limb radiographs (Fig. 1). Subsequent organ and lower limb examinations were normal, including range of joints movements (except for the affected upper limbs), hair, nail and teeth growth, and facial features. Psychomotor development was adequate for his age and a renal ultrasound was normal. Chromosome analysis on peripheral blood leukocytes revealed normal a male karyotype (46,XY).
RESULTS To determine whether TBX5, NKX2.5, or GATA4 mutations could occur with TOF, we recruited 100 TOF patients for genetic screening. Initial FISH analysis showed a 22q11.2 deletion in 6/100 (6.0%) patients, who were excluded from the subsequent screening. No disease-related mutations of pathogenic significance were detected in either NKX2.5 or GATA4. A synonymous single nucleotide polymorphism (SNP) rs2277923 was found in NKX2.5 in 14 patients. In addition, one frequent non-synonymous SNP in the second exon of GATA4 (rs3729856) and one SNP in the 5UTR of TBX5 (rs12372585) were identified. Two of 94 (2.1%) TOF patients
FIG. 1. Patient 1 is the second child of first degree cousins. Pictures of the hand and X-rays show finger-like thumbs and clinodactyly of the fifth fingers.
4
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
TBX5 gene screening revealed a heterozygous change, c.835C>T in TBX5 in exon 8, leading to a substitution of arginine at amino acid position 279 for a premature stop codon (p.R279X). This mutation is absent from dbSNP and both the 1000G exomes and the ESP exomes (>6,000). This mutation has previously been reported to be causal for HOS [Heinritz et al., 2005]. Both parents had a normal appearance, normal ECG and echocardiography, and did not carry the disease-causing mutation. Therefore, the mutation in the proband occurred de novo.
Patient 2: p.S372L TBX5 The proband is the first male child of healthy nonconsanguineous Italian parents who has two younger healthy sisters. He was born at full-term of an uncomplicated pregnancy by vaginal delivery; during pregnancy there was no exposure to drugs, alcohol, smoking, or infections. Birth weight was 3.880 kg. At birth, a heart murmur was detected and echocardiography showed TOF, an atrial septal defect ostium secundum type, and hypoplasia of both proximal pulmonary artery branches. A preoperative ECG showed normal sinus rhythm and normal atrioventricular conduction. At the age of 10 months he underwent corrective surgery, and developed postoperative right bundle branch block on ECG. On longterm cardiologic follow-up, rhythm and conduction disturbances became more evident including left anterior hemiblock and spo-
radic episodes of junctional rhythm on Holter recording. The PRinterval was consistently at the upper normal limit, but never reached the duration first degree AV block. At the age of 8 years and 6 months, he was examined by a geneticist who noted that his weight and height were 29 kg (70th centile), and 136 cm (85th centile), respectively. Physical examination showed normal upper limbs, confirmed by upper radiography (Fig. 2). Other organ and lower limb examinations were normal including range of joints movements, hair, nail and teeth growth, and facial features. Psychomotor development was adequate for his age and renal ultrasound was normal. Chromosome analysis on peripheral blood leukocytes showed a normal male karyotype (46,XY). Screening TBX5 showed a non-synonymous variation was identified in exon 9, causing a substitution of a serine for leucine at amino acid position 372 (c.1115C>T, p.S372L) (Fig. 3). This variation has not previously been described in literature and is absent from the 1000G exome data. It is present in NHLBI Exome Sequencing Project (ESP) (>6,000 exomes) with a frequency of 2/ 6734exomes (rs143068551). The proband’s father had no signs of upper limb abnormalities and had a normal ECG and echocardiography. The father did not carry the p.S372L mutation. Conversely, the asymptomatic mother was a carrier of the p.S372L TBX5 mutation. Clinical evaluation showed an ECG in sinus rhythm with ventricular extrasystoles, and echocardiography demonstrated an atrial septal aneurysm. She had no upper limb abnormalities
FIG. 2. Patient 2. A: Hand X-rays of both the proband and mother excluded skeletal defects. B: Pedigree of the second family, both Patient 2 and his mother carry the p.S372L mutation, as indicated by þ. C: The proband’s normal metacarpophalangeal profile.
BABAN ET AL.
5
FIG. 3. A: Relative activation of the NPPA-luciferase construct by TBX5 mutants compared with WT TBX5, without and with NKX2.5 ( P < 0.05). B: Graph showing quantification of CoIP results from three separate experiments, error bars represent standard errors, P < 0.01. C: Nuclear localization of WT and mutant TBX5 transfected to H10 cells as shown by immunofluorescence. In red, all nuclei; in green, TBX5 (anti-flag). D: Evolutionary conservation of the area surround p.S372L among various species. A schematic diagram representing the TBX5 protein and its various known subdomains, NLS nuclear localization signal, NES nuclear export signal, AD activation domain.
by clinical examination or radiography) (Fig. 2). Further investigation of the molecular phenotype of the p.S372L TBX5 mutation was carried out, since the p.R279X mutant has been identified several times before and is molecularly well characterized [Porto et al., 2010; Baban et al., 2014].
Normal Subcellular Distribution of p.S372L TBX5 Since TBX5 is a transcription factor, it should be present in the nucleus. Therefore, subcellular localization of the mutant p.S372L TBX5 protein was assessed by expressing flag-tagged mutant protein in rat heart-derived cells (H10). The localization of mutant and wild type protein was visualized with anti-flag immunostaining. Figure 3C shows that both the wild type TBX5 protein as well as the mutant p.S372L TBX5 display nuclear localization, indicating that the process of nuclear import is not affected by the mutation.
p.S372L Displays a Gain-of-Function in Target Gene Activation The functionality of the mutant protein was tested in a cellular context, utilizing a reporter assay in which the proximal Nppa promoter (270 to þ1) drives luciferase reporter gene expression. This promoter contains functional T-box binding elements (TBEs)
essential for Nppa regulation during development and adult life [Hiroi et al., 2001]. p.S372L TBX5 shows significantly increased Nppa promoter activation compared to wild-type TBX5 (Fig. 3A). TBX5 synergizes with NKX2-5 in the activation of this promoter and, therefore, we tested the synergetic effect between NKX2-5 and the mutant TBX5 proteins. Indeed, wild-type TBX5 and NKX2-5 synergistically activate the reporter construct (Fig. 3A). Interestingly, the p.S372L mutant showed a strongly increased activation of the reporter in presence of NKX2-5, and notably even higher than the previously described TBX5 gain-of-function mutant p.G125R [Postma et al., 2008].
p.372L TBX5 Affects NKX2.5 Binding, But Not GATA4 To further explore binding of TBX5 mutants to NKX2-5, we tested the interaction between full length TBX5 and NKX2-5 in the context of mammalian cells using co-immunoprecipitation (CoIP). As reported in Figure 3B, the previously reported p.M74I mutant [Postma et al., 2008] and the p.S372L mutant proteins show a drastic reduction of NKX2-5 binding capacity, while p.G125R has a binding capacity comparable to the wild-type protein. GATA4, another essential partner of TBX5 during heart development, can also bind to TBX5 [Garg et al., 2003]. Therefore, we subsequently
6
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
tested the ability of TBX5 mutants to bind GATA4 using CoIP. Mutant protein p.M74I lost the capacity to interact with GATA4, as previously reported, however, p.S372L had a GATA4 binding capacity similar to the wild-type TBX5 protein in our assay.
DISCUSSION TOF is the most common form of cyanotic CHD in humans, it has a good surgical outcome and an acceptable quality of life [Bailliard and Anderson, 2009]. Over the last two decades attention has shifted from immediate surgical outcomes to understanding the underlying etiology. As mentioned, about 10–20% of patients with TOF have a chromosomal anomaly including microdeletion of chromosome 22q11.2 [Scambler, 2000; van Engelen et al., 2010] and trisomy 21 [Rauch et al., 2010]. Recent studies also identified that mutations in genes such as TBX1, JAG1, GATA4, and NKX2.5 can cause TOF [Rauch et al., 2010; Cordell et al., 2013]. However, despite these advances, TOF remains unknown in the majority of patients. Holt–Oram syndrome is a rare autosomal dominant condition that occurs in approximately 1/100,000 individuals. It is characterized by bilateral asymmetric upper limb defects in all patients, with CHD accompanied by conduction defects in about two-thirds of cases [Holt and Oram, 1960; Basson et al., 1994]. Upper limb defects are typically radial ray defects ranging from mild carpal bone abnormalities to severe reduction defects such as phocomelia; CHD and/or conduction defects are mainly isolated ostium secun-
dum ASD or muscular ventricular septal defect [Newbury-Ecob et al., 1996; Basson et al., 1999]. Less frequently observed are complex CHD including TOF, double outlet right ventricle, total anomalous pulmonary venous return, aortic abnormalities, atrioventricular canal defects, hypoplastic left heart) [Glauser et al., 1989], mitral valve disease, pulmonary artery abnormalities, trabecular anomalies, tricuspid atresia, and truncus arteriosus [Sahn et al., 1981; Koishizawa et al., 1995; Bruneau et al., 1999; Baban et al., 2014]. Vascular abnormalities include peripheral vessel hypoplasia and coronary artery abnormalities [Holt and Oram, 1960; Wu et al., 1991]. TBX5 mutations are rarely reported in complex CHD [Basson et al., 1999; Heinritz et al., 2005]. McDermott et al. [2005] recommended TBX5 analyses for individuals who meet the clinical criteria for HOS (i.e., CHD in addition to, but not instead of, septation defects, and/or conduction defects). Indeed, both our patients with TBX5 mutations displayed ASD and conduction defects. Co-occurrence of TOF and HOS was described in 18 reports (Table II). As in the current study, ASD was noted in 3 out of 18 (16.7%) patients [Wu et al., 1991; el-Gindi and Ahmed-Nasr, 1993; Yang et al., 2000]. All 18 probands demonstrated varying degrees of upper limb defects, which were not observed in the patient with p. S372L mutation. Whereas none of the 18 probands had conduction defects, both patients presented here displayed complete AV block, and progressive left anterior hemiblock and junctional rhythm, respectively. Transmission was sporadic in six probands, familial in three, and unknown in 11. The HOS diagnosis was made on clinical
TABLE II. Summary of the Previously Reported TOF in Clinically and/or Molecularly Confirmed Holt–Oram Syndrome Patient 1 Patient 2 Patient 3
Congenital heart defects TOF þ PA hypoplasia TOF þ ASD TOF þ ASD-OS
HOS diagnosis Clinical Clinical Clinical
Inheritance Sporadic ? Sporadic
References Najjar et al. [1988] Wu et al. [1991] el-Gindi and Ahmed-Nasr [1993]
Patient 4 Patient 5
TOF TOF
Clinical Clinical
Familial Sporadic
Patient 6
TOF
Clinical
Sporadic
Patients 7–14
TOF (8 patients)
?
Patient 15
TOF þ ASD
Sporadic
Yang et al. [2000]
Patient 16 Patient 17
TOF TOF
? ?
Sajeev et al. [2005] McDermott et al. [2005]
Patient 18 Patient 1
TOF TOF, large ASD-OS, PA hypoplasia, complete AV block TOF, ASD-OS, proximal PA hypoplasia, conduction defect
No details regarding TBX5 mutations Clinical. Negative TBX5 screening Clinical TBX5 mutation: S196ter Clinical TBX5 mutation: p. R279X
Lehner et al. [1994] Newbury-Ecob et al. [1996] Newbury-Ecob et al. [1996] Bruneau et al. [1999]
Familial Sporadic
Kumar et al. [2012] Present report
Familial
Present report
Patient 2
TBX5 mutation: p. S372L
TOF, Tetralogy of Fallot; PA, pulmonary artery; ASD-OS, atrial septal defect ostium secundum; AV block, atrioventricular block.
Others 1st trimester exposure to contraception pills Absent left kidney
Vertebral defects Parents: first degree cousins Mother: ventricular extrasystoles and atrial septal aneurysm
BABAN ET AL. grounds in nine of them. Unfortunately, no mutation description is available for the eight patients described by Bruneau et al. [1999]. The only reported TBX5 mutation is p.S196X [McDermott et al., 2005]. Associated anomalies included defects of the anterior vertebral bodies [McDermott et al., 2005] and absent left kidney [Lehner et al., 1994]. Conversely, Mori and Bruneau [2004] exclude the association of TOF and HOS, suspect the TOF/HOS association is a result of misdiagnosis. We believe that an association between TBX5 mutations and TOF does exist. Thus far, more than a 100 TBX5 mutations have been published including nonsense (31), frameshift (28), splice site (15), missense mutations (34), and some large (chromosomal) rearrangements. Around 70% of these TBX5 mutations lead to a premature termination codon (stop codon) as a direct (nonsense mutation), or indirect consequence (splice site and frameshift) [Barnett and Postma, 2014]. Neither the mutation type nor the location within the T box are predictive of malformation severity in HOS [Heinritz et al., 2005; Boogerd et al., 2010]. The TBX5 mutation detection rate in HOS with strict diagnostic criteria ranges from 54% to 74% [McDermott et al., 2005; Debeer et al., 2007]. The mutation we describe in Patient 1, p.R279X, together with three other TBX5 mutations (p.S196X, p.T223M, p.R237W), are thought to be responsible for 50% of HOS [Heinritz et al., 2005]. The vast majority of TBX5 mutations lead to loss-of-function either by lack of protein or diminished DNA binding. The only exception is the p.G125R gain-of-function mutation which is associated with atypical HOS and paroxysmal atrial fibrillation [Postma et al., 2008]. The p.S372L mutation, identified in Patient 2 (and his mother) is novel. Our functional analysis of this mutant protein shows a dramatic increase in Nppa promoter activation, both in absence and presence of NKX2-5. Therefore, this mutation is the second reported gain-of-function mutation in TBX5. Consistent with the data presented for the p.G125R gain-of-function mutant, this patient’s phenotype (TOF, ASD ostium secundum, and progressive arrhythmic ECG changes) does not resemble classical HOS. This is perhaps not surprising, as TBX5 target genes are highly sensitive to TBX5 dosage, and differences in dosage might thus lead to differences in phenotypes [Mori et al., 2006]. One could speculate that gain-of-function mutations show deleterious effects on heart development, but not on the development of the upper limbs. Indeed, recently Smemo et al. [2012] showed that a mutation in TBX5 enhancer can lead to isolated CHD, effectively demonstrating that it is possible to decouple the heart and hand phenotypes of TBX5 mutations.
LIMITATION We report on the investigation of 94 unselected TOF patients for mutations in TBX5, NKX2.5, and GATA4. We acknowledge that the first case would not have been included in this series if the clinical diagnosis of Holt–Oram syndrome was made earlier. However, the hand phenotype of the proband was so mild that the pediatric cardiologists and surgeons overlooked HOS as a diagnosis at that time. This emphasizes the need for the involvement of clinical geneticists at early stages of a diagnosis, as detecting genetic syndromes by non-experts is notoriously difficult given their variable phenotype.
7
CONCLUSIONS We identified TBX5 mutations in two out of 94 (2.1%) TOF patients. One of the mutations is a previously described TBX5 mutation with a mild, but typical HOS phenotype. The second mutation, however, is a novel inherited gain-of-function mutation in patients with apparent isolated CHD. This could suggest that a TBX5 gain-of-function mutation decouples the heart and hand association in HOS. In conclusion, identification of mutations in TBX5 might be underestimated, rather than rare in TOF patients; however, further studies are needed to draw solid conclusions.
ACKNOWLEDGMENTS We thank the patients and families who cooperated in this study. We thank Aho Ilgun for his technical assistance, and the librarians at Bambino Gesu` Children Hospital for their help in gathering HOS bibliography.
REFERENCES Baban A, Pitto L, Pulignani S, Cresci M, Mariani L, Gambacciani C, Digilio MC, Pongiglione G, Albanese S. 2014. Holt–Oram syndrome with intermediate atrioventricular canal defect, and aortic coarctation: Functional characterization of a de novo TBX5 mutation. Am J Med Genet Part A 164A:1419–1424. Bailliard F, Anderson RH. 2009. Tetralogy of Fallot. Orphanet J Rare Dis 4:2. doi: 10.1186/1750-1172-4-2 Barnett P, Postma AV. 2014. Molecular genetics of Holt–Oram syndrome. In: eLS. Chichester: John Wiley & Sons, Ltd. doi: 10.1002/ 9780470015902.a0024329 Basson CT, Cowley GS, Solomon SD, Weissman B, Poznanski AK, Traill TA, Seidman JG, Seidman CE. 1994. The clinical and genetic spectrum of the Holt–Oram syndrome (heart-hand syndrome). N Engl J Med 330:885–891. Basson CT, Huang T, Lin RC, Bachinsky DR, Weremowicz S, Vaglio A, Bruzzone R, Quadrelli R, Lerone M, Romeo G, Silengo M, Pereira A, Krieger J, Mesquita SF, Kamisago M, Morton CC, Pierpont ME, Mu¨ller CW, Seidman JG, Seidman CE. 1999. Different TBX5 interactions in heart and limb defined by Holt–Oram syndrome mutations. Proc Natl Acad Sci USA 96:2919–2924. Boogerd KJ, Wong LYE, Christoffels VM, Klarenbeek M, Ruijter JM, Moorman AF, Barnett P. 2008. Msx1 and Msx2 are functional interacting partners of T-box factors in the regulation of connexin 43. Cardiovasc Res 78:485–493. Boogerd CJ, Dooijes D, Ilgun A, Mathijssen IB, Hordijk R, van de Laar IM, Rump P, Veenstra-Knol HE, Moorman AF, Barnett P, Postma AV. 2010. Functional analysis of novel TBX5 T-box mutations associated with Holt–Oram syndrome. Cardiovasc Res 88:130–139. Bruneau BG, Logan M, Davis N, Levi T, Tabin CJ, Seidman JG, Seidman CE. 1999. Chamber-specific cardiac expression of Tbx5 and heart defects in Holt–Oram syndrome. Dev Biol 211:100–108. Cordell HJ, To¨pf A, Mamasoula C, Postma AV, Bentham J, Zelenika D, Heath S, Blue G, Cosgrove C, Granados Riveron J, Darlay R, Soemedi R, Wilson IJ, Ayers KL, Rahman TJ, Hall D, Mulder BJ, Zwinderman AH, van Engelen K, Brook JD, Setchfield K, Bu’Lock FA, Thornborough C, O’Sullivan J, Stuart AG, Parsons J, Bhattacharya S, Winlaw D, Mital S, Gewillig M, Breckpot J, Devriendt K, Moorman AF, Rauch A, Lathrop GM, Keavney BD, Goodship JA. 2013. Genome-wide association study identifies loci on 12q24 and 13q32 associated with tetralogy of Fallot. Hum Mol Genet 22:1473–1481.
8
AMERICAN JOURNAL OF MEDICAL GENETICS PART A
De Luca A, Sarkozy A, Ferese R, Consoli F, Lepri F, Dentici ML, Vergara P, De Zorzi A, Versacci P, Digilio MC, Marino B, Dallapiccola B. 2011. New mutations in ZFPM2/FOG2gene in tetralogy of Fallot and double outlet right ventricle. Clin Genet 80:184–190.
Mori AD, Zhu Y, Vahora I, Nieman B, Koshiba-Takeuchi K, Davidson L, Pizard A, Seidman JG, Seidman CE, Chen XJ, Henkelman RM, Bruneau BG. 2006. Tbx5-dependent rheostatic control of cardiac gene expression and morphogenesis. Dev Biol 297:566–586.
Debeer P, Race V, Gewillig M, Devriendt K, Frijns JP. 2007. Novel TBX5 mutations in patients with Holt–Oram syndrome. Clin Orthop Relat Res 462:20–26.
Najjar H, Mardini M, Tabbaa R, Nyhan WL. 1988. Variability of the Holt– Oram syndrome in Saudi individuals. Am J Med Genet 29:851–855.
Dolk H, Loane M, Garne E. 2010. The prevalence of congenital anomalies in Europe. Adv Exp Med Biol 686:349–364.
Nemer G, Fadlalah F, Usta J, Nemer M, Dbaibo G, Obeid M, Bitar F. 2006. A novel mutation in the GATA4 gene in patients with Tetralogy of Fallot. Hum Mutat 27:293–294.
el-Gindi E, Ahmed-Nasr M. 1993. Hormonal versus genetic factors in limb and heart anomalies. Cardiovasc Surg 1:381–383.
Newbury-Ecob RA, Leanage R, Raeburn JA, Young ID. 1996. Holt–Oram syndrome: A clinical genetic study. J Med Genet 33:300–307.
Garg V, Kathiriya IS, Barnes R, Schluterman MK, King IN, Butler CA, Rothrock CR, Eapen RS, Hirayama-Yamada K, Joo K, Matsuoka R, Cohen JC, Srivastava D. 2003. GATA4 mutations cause human congenital heart defects and reveal an interaction with TBX5. Nature 424:443–447.
Perry LW, Neill CA, Ferencz C, EUROCAT Working Party on. 1993. Congenital Heart Disease: Perspective in Pediatric Cardiology. Epidemiology of congenital heart disease, the Baltimore-Washington Infant Study 1981–89. Armonk, NY: Futura. pp 33–62.
Glauser TA, Zackai E, Weinberg P, Clancy R. 1989. Holt–Oram syndrome associated with the hypoplastic left heart syndrome. Clin Genet 36:69–72.
Pizzuti A, Sarkozy A, Newton AL, Conti E, Flex E, Digilio MC, Amati F, Gianni D, Tandoi C, Marino B, Crossley M, Dallapiccola B. 2003. Mutations of ZFPM2/FOG2 gene in sporadic cases of tetralogy of Fallot. Hum Mutat 22:372–377.
Goldmuntz E, Geiger E, Benson DW. 2001. NKX2.5 mutations in patients with tetralogy of Fallot. Circulation 104:2565–2568. Guida V, Chiappe F, Ferese R, Usala G, Maestrale G, Iannascoli C, Bellacchio E, Mingarelli R, Digilio MC, Marino B, Uda M, De Luca A, Dallapiccola B. 2011. Novel and recurrent JAG1 mutations in patients with tetralogy of Fallot. Clin Genet 80:591–594. Habets PE, Moorman AF, Clout DE, van Roon MA, Lingbeek M, van Lohuizen M, Campione M, Christoffels VM. 2002. Cooperative action of Tbx2 and Nkx2.5 inhibits ANF expression in the atrioventricular canal: implications for cardiac chamber formation. Genes Dev 16:1234– 1246. Heinritz W, Moschik A, Kujat A, Spranger S, Heilbronner H, Demuth S, Bier A, Tihanyi M, Mundlos S, Gruenauer-Kloevekorn C, Froster UG. 2005. Identification of new mutations in the TBX5gene in patients with Holt–Oram syndrome. Heart 91:383–384. Hiroi Y, Kudoh S, Monzen K, Ikeda Y, Yazaki Y, Nagai R, Komuro I. 2001. Tbx5 associates with Nkx2-5 and synergistically promotes cardiomyocyte differentiation. Nat Genet 28:276–280. Holt M, Oram S. 1960. Familial heart disease with skeletal malformations. Br Heart J 22:236–242. Jahn L, Sadoshima J, Greene A, Parker C, Morgan KG, Izumo S. 1996. Conditional differentiation of heart- and smooth muscle-derived cells transformed by a temperature-sensitive mutant of SV40 T antigen. J Cell Sci 109:397–407. Koishizawa T, Hayashi N, Tadokoro M, Nonaka T, Fujiki T, Fujikura T, Tonari K, Sasagawa N, Honda K, Ikeda K. 1995. A case report of the radical correction of a truncus arteriosus and peripheral pulmonary stenosis in association with Holt–Oram syndrome. Kyobu Geka 48:133– 136. Kumar V, Agrawal V, Jain D, Shankar O. 2012. Tetralogy of Fallot with Holt–Oram syndrome. Indian Heart J 64:95–98. Lehner R, Wenzl R, Vanura H, Frank W, Safar P, Husslein P. 1994. Diagnosis of familial Holt–Oramsyndrome. Z Geburtshilfe Perinatol 198:143–149. McDermott DA, Bressan MC, He J, Lee JS, Aftimos S, Brueckner M, Gilbert F, Graham GE, Hannibal MC, Innis JW, Pierpont ME, Raas-Rothschild A, Shanske AL, Smith WE, Spencer RH, St John- Sutton MG, van Maldergem L, Waggoner DJ, Weber M, Basson CT. 2005. TBX5 genetic testing validates strict clinical criteria for Holt- Oram syndrome. Pediatr Res 58:981–986. Mori AD, Bruneau BG. 2004. TBX5 mutations and congenital heart disease: Holt–Oram syndrome revealed. Curr Opin Cardiol 19:211–215.
Porto MP, Vergani N, Carvalho AC, Cernach MC, Brunoni D, Perez AB. 2010. Novel mutations in the TBX5 gene in patients with Holt–Oram Syndrome. Genet Mol Biol 33:232–236. Postma AV, van de Meerakker JB, Mathijssen IB, Barnett P, Christoffels VM, Ilgun A, Lam J, Wilde AA, Lekanne Deprez RH, Moorman AF. 2008. A gain-of-function TBX5 mutation is associated with atypical Holt– Oram syndrome and paroxysmal atrial fibrillation. Circ Res 102:1433– 1442. Rauch R, Hofbeck M, Zweier C, Koch A, Zink S, Trautmann U, Hoyer J, Kaulitz R, Singer H, Rauch A. 2010. Comprehensive genotype-phenotype analysis in 230 patients with tetralogy of Fallot. J Med Genet 47:321–331. Ruijter JM, Thygesen HH, Schoneveld OJLM, Das AT, Berkhout B, Lamers WH. 2006. Factor correction as a tool to eliminate between-session variation in replicate experiments: Application to molecular biology and retrovirology. Retrovirology 3:2. Sahn DJ, Goldberg SJ, Allen HD, Canale JM. 1981. Cross-sectional echocardiographic imaging of supracardiac total anomalous pulmonary venous drainage to a vertical vein in a patient with Holt–Oram syndrome. Chest 79:113–115. Sajeev CG, Fassaludeen M, Venugopal K. 2005. Tetralogy of Fallot with absent thumb and first metacarpal. Int J Cardiol 102:349–350. Scambler PJ. 2000. The 22q11 deletion syndromes. Hum Mol Genet 16:2421–2426. Smemo S, Campos LC, Moskowitz IP, Krieger JE, Pereira AC, Nobrega MA. 2012. Regulatory variation in a TBX5 enhancer leads to isolated congenital heart disease. Hum Mol Genet 21:3255–3263. van der Linde D, Konings EE, Slager MA, Witsenburg M, Helbing WA, Takkenberg JJ, Roos-Hesselink JW. 2011. Birth prevalence of congenital heart disease worldwide: A systematic review and meta-analysis. J Am Coll Cardiol 58:2241–2247. van Engelen K, Topf A, Keavney BD, Goodship JA, van der Velde ET, Baars MJ, Snijder S, Moorman AF, Postma AV, Mulder BJ. 2010. 22q11.2 deletion syndrome is under-recognised in adult patients with tetralogy of Fallot and pulmonary atresia. Heart 96:621–624. Wu JM, Young ML, Wang TR, Lin SJ, Chang JK, Wei J, Wu J. 1991. Unusual cardiac malformations in Holt–Oram syndrome: Report of two cases. Zhonghua Min Guo Xiao Er Ke Yi Xue Hui Za Zhi 32:100–104. Yang J, Hu D, Xia J, Yang Y, Yin B, Hu J, Zhou X. 2000. TBX5 mutation in Chinese patients with Holt–Oram syndrome. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 17:233–235.
