JOURNAL OF VIROLOGY, Sept. 1991, p. 4681-4690 0022-538X/91/094681-10$02.00/0 Copyright ©D 1991, American Society for Microbiology
Vol. 65, No. 9
Identification of T- and B-Cell Epitopes of the E7 Protein of Human Papillomavirus Type 16 SARAH A. COMERFORD,lt DENNIS J. McCANCE,2* GORDON DOUGAN,1 AND JOHN P. TITE' Department of Molecular Biology, Wellcome Research Laboratories, Beckenham, Kent BR3 3BS, United Kingdom,' and Department of Microbiology and Immunology, University of Rochester, Rochester, New York 146422 Received 15 February 1991/Accepted 4 June 1991
There is strong evidence implicating human papillomavirus type 16 (HPV16) in the genesis of human genital Viral DNA has been identified in invasive carcinoma of the uterine cervix and in cell lines derived from cervical carcinomas. These sequences are actively transcribed, and translation products corresponding to the early (E)-region genes have been identffied. The most abundant viral protein is the E7 protein, which has been shown to possess transforming activit for both established and primary cells. In addition, it has been shown to bind to a cellular tumor suppressor, the retinoblastoma gene product (pRb-105). In view of these properties, we have undertaken the immunological analysis of this protein and have identified four T-cell epitopes and three B-cell epitopes by using a series of overlapping peptides spanning the entire HPV16 E7 sequence. Two of the B-cell epitopes were recognized by antisera from mice with three different murine (H-2) haplotypes (k, d, and s) immunized with two different E7 fusion proteins and from Fischer rats seeded with baby rat kidney cells transformed by HPV16 E7 and ras. A third B-cell epitope was recognized by antisera from CBA mice seeded with HPV16 E7-expressing L cells. Two regions of the protein contain common B- and T-cell epitopes, one of which appears to be particularly immunodominant.
cancer.
lar factors. The immunological approach to the prevention of HPV disease requires a thorough analysis of the viral proteins against which humoral and cellular immune responses are mounted during and after infection. At present, although there is little direct evidence for the efficacy of either humoral or cell-mediated immunity in the control of HPV infection, an important role for T-cell monitoring has been postulated because of the link between HPV disease and cellular immunodeficiency (16, 20, 27, 31, 37, 49, 55). However, the nature of this response has yet to be defined. The analysis of both human and experimental tumors for which there is a known (or strongly suspected) viral etiology indicates that T-cell surveillance mechanisms are centrally involved in limiting the emergence or effecting the regression of such tumors (2, 26, 30). Recently, Chen et al. (3) showed that mice immunized with HPV16 E7-expressing nontumorigenic fibroblast cells were protected against a challenge with tumorigenic HPV16 E7-expressing melanoma cells. This protection was E7 specific and was mediated by class I-restricted CD8+ T lymphocytes. This is the first report of an HPV-encoded protein stimulating tumor rejection and stresses the importance of studying this protein in greater detail from an immunological point of view. Anti-E7 antibodies have also been detected in the serum of approximately 20% of patients with HPV16-associated cervical lesions (17, 24), confirming stimulation of the humoral immune response upon infection with the virus. The continued expression of the E7 ORF in malignant carcinoma makes E7 a potential vaccine candidate for HPVassociated cervical disease. Investigation into the immune response mounted against this and other viral proteins is necessary before we can begin to understand the immunology of HPV infection. Here, we describe the mapping of Band T-cell epitopes of the HPV16 E7 protein and discuss the immunological factors and processes which may be involved in the response to this protein.
Human papillomaviruses (HPVs) are a group of heterogeneous viruses, some of which infect anogenital epithelia and are implicated in the etiology of cervical cancer (41). HPV DNA is present in the majority of premalignant and malignant cancers of the cervix, with HPV type 16 (HPV16) being the type most commonly identified in such lesions (9, 34, 35). Integrated copies of viral DNA are found in invasive carcinomas, while nonintegrated (episomal) copies are found in premalignant lesions such as cervical intraepithelial neoplasia (10, 18). Genetic analysis has shown that the E6 and E7 open reading frames (ORFs) of some papillomaviruses are necessary and sufficient for efficient cellular transformation. The E6 and E7 ORFs of HPV16 have been shown to possess transforming activity for mouse fibroblasts (62) and primary human keratinocytes (43, 48). The E7 gene product can also cooperate with an activated ras oncogene to fully transform and immortalize primary rodent cells (33, 42, 56), and its continued expression has been shown to be required for maintenance of this transformed phenotype (7). The E6 and E7 ORF products also bind two cellular regulatory proteins: the cellular p53 protein (60) and the retinoblastoma gene product (pRb-105) (11), respectively. Both of these proteins belong to a class of tumor suppressor proteins which appear to play an important role in suppressing the transformed phenotype (15, 22). Finally, HPV16 E7 is the most abundant viral protein in CaSki and SiHa cells (51) which contain integrated copies of HPV16 DNA and in HPV16-containing cervical carcinoma biopsy tissue (54). It is clear from human and animal studies that papillomaviruses contribute significantly to the development of many carcinomas, but we still do not have a clear understanding of the importance of other interacting viral, chemical, or cellu-
Corresponding author. t Present address: Howard Hughes Medical Institute, University of Texas, Southwestern Medical Center, Dallas, TX 75235-9050. *
4681
4682
COMERFORD ET AL.
MATERIALS AND METHODS
General methods. Enzymes were purchased from Boehringer-Mannheim unless otherwise specified. Bacterial transformations were performed in Escherichia coli TG1 (la) for GST16E7 expression and in N4830-1 (63) for protein A-E7 expression by standard methods (47). Mice and immunizations. BALB/c (H-2d), B1O.S (H-2s), and CBA (H-2k) mice were bred in an animal facility (Wellcome Research Laboratories, Beckenham, Kent, England) and used between the ages of 6 and 10 weeks. Pools of five mice were immunized subcutaneously at the base of the tail with 50 to 100 ,ug of purified (or semipurified) protein emulsified in complete Freund's adjuvant (CFA) or with phosphate-buffered saline (PBS; pH 7.2) emulsified in CFA. Animals were boosted with equivalent amounts of protein in incomplete Freund's adjuvant on day 28. Polymerase chain reaction DNA amplification. Amplification of the HPV16 E7 DNA sequence was primed by two synthetic primers which hybridized to regions of the HPV16 genome containing the ATG start codon and the TAA stop codon of the E7 ORF. The 5' oligonucleotide was designed to incorporate a BamHI site, and the 3' oligonucleotide was designed to incorporate an EcoRI site for subsequent cloning into the expression vector. Oligonucleotides for use as primers were synthesized on a Milligen 7500 synthesizer (Millipore, Harrow, United Kingdom) and purified by highpressure liquid chromatography. Primers used were 5' CCCAGCTGGATCCATGCATGGAGATACACCTACATT G 3' and 5' GATAGCCATGAATTCTTATGGTTTCTG AGAACAGA TGGG 3'. All reagents used for the amplification were obtained from The Cetus Corp., Emeryville, Calif. Amplification was performed over 25 cycles by using a Techne programmable dry heating block (Scotlab, Paisley, Scotland) with the following program: 95°C for 1 min; 70°C for 2 min; 37°C for 3 min. The HPV16 E7 300-bp polymerase chain reaction product was analyzed by agarose-gel electrophoresis, and the resulting fragment was visualized by staining with ethidium bromide and examination under UV light. DNA was excised from the gel, purified by passage through an Elutip-d column (Schleicher & Schuell), and prepared for cloning by digestion with BamHI and EcoRI. Plasmids and bacterial fusion proteins. The HPV16 E7 ORF was cloned and expressed under the control of the tac promoter as a fusion protein with the 26-kDa glutathione-Stransferase (GST or Sj26) protein from the parasite Schistosoma japonicum in the plasmid pGEX2T (53). The pGEX16E7 bacterial expression plasmid was generated by in-frame cloning of the E7 ORF as a 0.3-kb BamHI-EcoRI fragment. Sequencing of the product and comparison with the published HPV16 sequence (50) confirmed the authenticity of the amplified E7 fragment. Induction of the GST16E7 fusion protein with isopropyl-p-D-thiogalactopyranoside for 4 h resulted in an insoluble protein of approximately 38.5 kDa which was sequestered within inclusion bodies. This protein reacted with a monoclonal antibody specific for HPV16 E7 (CAMVIR 3) and two rabbit anti-E7 peptide antisera in Western immunoblotting experiments and in enzyme-linked immunosorbent assays (ELISAs) (data not shown). The GST16E7 content of the inclusion bodies used for immunization was approximately 90% by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and Western blot analysis of soluble and insoluble bacterial lysate fractions. Soluble GST16E7 protein for use in ELISAs and as a positive control in T-cell proliferation assays was prepared
J. VIROL.
by solubilization of the inclusion bodies in 8 M urea dissolved in PBS (pH 7.2) and dialysis at a low protein concentration (
Vol. 65, No. 9
Identification of T- and B-Cell Epitopes of the E7 Protein of Human Papillomavirus Type 16 SARAH A. COMERFORD,lt DENNIS J. McCANCE,2* GORDON DOUGAN,1 AND JOHN P. TITE' Department of Molecular Biology, Wellcome Research Laboratories, Beckenham, Kent BR3 3BS, United Kingdom,' and Department of Microbiology and Immunology, University of Rochester, Rochester, New York 146422 Received 15 February 1991/Accepted 4 June 1991
There is strong evidence implicating human papillomavirus type 16 (HPV16) in the genesis of human genital Viral DNA has been identified in invasive carcinoma of the uterine cervix and in cell lines derived from cervical carcinomas. These sequences are actively transcribed, and translation products corresponding to the early (E)-region genes have been identffied. The most abundant viral protein is the E7 protein, which has been shown to possess transforming activit for both established and primary cells. In addition, it has been shown to bind to a cellular tumor suppressor, the retinoblastoma gene product (pRb-105). In view of these properties, we have undertaken the immunological analysis of this protein and have identified four T-cell epitopes and three B-cell epitopes by using a series of overlapping peptides spanning the entire HPV16 E7 sequence. Two of the B-cell epitopes were recognized by antisera from mice with three different murine (H-2) haplotypes (k, d, and s) immunized with two different E7 fusion proteins and from Fischer rats seeded with baby rat kidney cells transformed by HPV16 E7 and ras. A third B-cell epitope was recognized by antisera from CBA mice seeded with HPV16 E7-expressing L cells. Two regions of the protein contain common B- and T-cell epitopes, one of which appears to be particularly immunodominant.
cancer.
lar factors. The immunological approach to the prevention of HPV disease requires a thorough analysis of the viral proteins against which humoral and cellular immune responses are mounted during and after infection. At present, although there is little direct evidence for the efficacy of either humoral or cell-mediated immunity in the control of HPV infection, an important role for T-cell monitoring has been postulated because of the link between HPV disease and cellular immunodeficiency (16, 20, 27, 31, 37, 49, 55). However, the nature of this response has yet to be defined. The analysis of both human and experimental tumors for which there is a known (or strongly suspected) viral etiology indicates that T-cell surveillance mechanisms are centrally involved in limiting the emergence or effecting the regression of such tumors (2, 26, 30). Recently, Chen et al. (3) showed that mice immunized with HPV16 E7-expressing nontumorigenic fibroblast cells were protected against a challenge with tumorigenic HPV16 E7-expressing melanoma cells. This protection was E7 specific and was mediated by class I-restricted CD8+ T lymphocytes. This is the first report of an HPV-encoded protein stimulating tumor rejection and stresses the importance of studying this protein in greater detail from an immunological point of view. Anti-E7 antibodies have also been detected in the serum of approximately 20% of patients with HPV16-associated cervical lesions (17, 24), confirming stimulation of the humoral immune response upon infection with the virus. The continued expression of the E7 ORF in malignant carcinoma makes E7 a potential vaccine candidate for HPVassociated cervical disease. Investigation into the immune response mounted against this and other viral proteins is necessary before we can begin to understand the immunology of HPV infection. Here, we describe the mapping of Band T-cell epitopes of the HPV16 E7 protein and discuss the immunological factors and processes which may be involved in the response to this protein.
Human papillomaviruses (HPVs) are a group of heterogeneous viruses, some of which infect anogenital epithelia and are implicated in the etiology of cervical cancer (41). HPV DNA is present in the majority of premalignant and malignant cancers of the cervix, with HPV type 16 (HPV16) being the type most commonly identified in such lesions (9, 34, 35). Integrated copies of viral DNA are found in invasive carcinomas, while nonintegrated (episomal) copies are found in premalignant lesions such as cervical intraepithelial neoplasia (10, 18). Genetic analysis has shown that the E6 and E7 open reading frames (ORFs) of some papillomaviruses are necessary and sufficient for efficient cellular transformation. The E6 and E7 ORFs of HPV16 have been shown to possess transforming activity for mouse fibroblasts (62) and primary human keratinocytes (43, 48). The E7 gene product can also cooperate with an activated ras oncogene to fully transform and immortalize primary rodent cells (33, 42, 56), and its continued expression has been shown to be required for maintenance of this transformed phenotype (7). The E6 and E7 ORF products also bind two cellular regulatory proteins: the cellular p53 protein (60) and the retinoblastoma gene product (pRb-105) (11), respectively. Both of these proteins belong to a class of tumor suppressor proteins which appear to play an important role in suppressing the transformed phenotype (15, 22). Finally, HPV16 E7 is the most abundant viral protein in CaSki and SiHa cells (51) which contain integrated copies of HPV16 DNA and in HPV16-containing cervical carcinoma biopsy tissue (54). It is clear from human and animal studies that papillomaviruses contribute significantly to the development of many carcinomas, but we still do not have a clear understanding of the importance of other interacting viral, chemical, or cellu-
Corresponding author. t Present address: Howard Hughes Medical Institute, University of Texas, Southwestern Medical Center, Dallas, TX 75235-9050. *
4681
4682
COMERFORD ET AL.
MATERIALS AND METHODS
General methods. Enzymes were purchased from Boehringer-Mannheim unless otherwise specified. Bacterial transformations were performed in Escherichia coli TG1 (la) for GST16E7 expression and in N4830-1 (63) for protein A-E7 expression by standard methods (47). Mice and immunizations. BALB/c (H-2d), B1O.S (H-2s), and CBA (H-2k) mice were bred in an animal facility (Wellcome Research Laboratories, Beckenham, Kent, England) and used between the ages of 6 and 10 weeks. Pools of five mice were immunized subcutaneously at the base of the tail with 50 to 100 ,ug of purified (or semipurified) protein emulsified in complete Freund's adjuvant (CFA) or with phosphate-buffered saline (PBS; pH 7.2) emulsified in CFA. Animals were boosted with equivalent amounts of protein in incomplete Freund's adjuvant on day 28. Polymerase chain reaction DNA amplification. Amplification of the HPV16 E7 DNA sequence was primed by two synthetic primers which hybridized to regions of the HPV16 genome containing the ATG start codon and the TAA stop codon of the E7 ORF. The 5' oligonucleotide was designed to incorporate a BamHI site, and the 3' oligonucleotide was designed to incorporate an EcoRI site for subsequent cloning into the expression vector. Oligonucleotides for use as primers were synthesized on a Milligen 7500 synthesizer (Millipore, Harrow, United Kingdom) and purified by highpressure liquid chromatography. Primers used were 5' CCCAGCTGGATCCATGCATGGAGATACACCTACATT G 3' and 5' GATAGCCATGAATTCTTATGGTTTCTG AGAACAGA TGGG 3'. All reagents used for the amplification were obtained from The Cetus Corp., Emeryville, Calif. Amplification was performed over 25 cycles by using a Techne programmable dry heating block (Scotlab, Paisley, Scotland) with the following program: 95°C for 1 min; 70°C for 2 min; 37°C for 3 min. The HPV16 E7 300-bp polymerase chain reaction product was analyzed by agarose-gel electrophoresis, and the resulting fragment was visualized by staining with ethidium bromide and examination under UV light. DNA was excised from the gel, purified by passage through an Elutip-d column (Schleicher & Schuell), and prepared for cloning by digestion with BamHI and EcoRI. Plasmids and bacterial fusion proteins. The HPV16 E7 ORF was cloned and expressed under the control of the tac promoter as a fusion protein with the 26-kDa glutathione-Stransferase (GST or Sj26) protein from the parasite Schistosoma japonicum in the plasmid pGEX2T (53). The pGEX16E7 bacterial expression plasmid was generated by in-frame cloning of the E7 ORF as a 0.3-kb BamHI-EcoRI fragment. Sequencing of the product and comparison with the published HPV16 sequence (50) confirmed the authenticity of the amplified E7 fragment. Induction of the GST16E7 fusion protein with isopropyl-p-D-thiogalactopyranoside for 4 h resulted in an insoluble protein of approximately 38.5 kDa which was sequestered within inclusion bodies. This protein reacted with a monoclonal antibody specific for HPV16 E7 (CAMVIR 3) and two rabbit anti-E7 peptide antisera in Western immunoblotting experiments and in enzyme-linked immunosorbent assays (ELISAs) (data not shown). The GST16E7 content of the inclusion bodies used for immunization was approximately 90% by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and Western blot analysis of soluble and insoluble bacterial lysate fractions. Soluble GST16E7 protein for use in ELISAs and as a positive control in T-cell proliferation assays was prepared
J. VIROL.
by solubilization of the inclusion bodies in 8 M urea dissolved in PBS (pH 7.2) and dialysis at a low protein concentration (
