Biochemical and Biophysical Research Communications 445 (2014) 357–362

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Identification of possible downstream genes required for the extension of peripheral axons in primary sensory neurons Makoto Aoki, Hiroshi Segawa, Mayumi Naito, Hitoshi Okamoto ⇑ Laboratory for Developmental Gene Regulation, Brain Science Institute, Riken, Japan

a r t i c l e

i n f o

Article history: Received 24 January 2014 Available online 7 February 2014 Keywords: Islet2a Zebrafish Sensory neuron Axon extension Gene regulation

a b s t r a c t The LIM-homeodomain transcription factor Islet2a establishes neuronal identity in the developing nervous system. Our previous study showed that Islet2a function is crucial for extending peripheral axons of sensory neurons in zebrafish embryo. Overexpressing a dominant-negative form of Islet2a significantly reduced peripheral axon extension in zebrafish sensory neurons, implicating Islet2a in the gene regulation required for neurite formation or proper axon growth in developing sensory neurons. Based on this, we conducted systematic screening to isolate genes regulated by Islet2a and affecting the development of axon growth in embryonic zebrafish sensory neurons. The 26 genes selected included some encoding factors involved in neuronal differentiation, axon growth, cellular signaling, and structural integrity of neurons, as well as genes whose functions are not fully determined. We chose four representative candidates as possible Islet2a downstream functional targets (simplet, tppp, tusc5 and tmem59l) and analyzed their respective mRNA expressions in dominant-negative Islet2a-expressing embryos. They are not reported the involvement of axonal extension or their functions in neural cells. Finally, knockdown of these genes suggested their direct actual involvement in the extension of peripheral axons in sensory neurons. Ó 2014 Elsevier Inc. All rights reserved.

1. Introduction Islet2a (Isl2a) is a LIM-homeodomain (LIM-HD) transcription factor expressed in post-mitotic neurons to specify motor neuron identity in the developing spinal cord [1–3]. LIM-HD proteins contain N-terminal tandem repeats of cysteine-rich regions called the LIM domain and a DNA-binding homeodomain [4]. The LIM domains bind to Ldb-1 protein (also called the nuclear LIM interactor, NLI) [5] and Lhx-3 to form a protein complex that mediates the transcription of specific mRNA [6]. During neurogenesis, this complex synergistically induces transcription from HB9 promoters to promote motor neuron differentiation [6]. In zebrafish, Isl2a is expressed in the primary sensory neurons and subsets of the primary motor neurons [2]. In a previous study we showed that overexpressing the LIM domains of Isl2a could inhibit the binding to Ldb-1 and thus functionally repress Isl2a [7]. As a result, the peripheral axons of zebrafish primary sensory neurons did not extend normally, whereas the central axons remained intact [7]. We therefore hypothesized that factors transcribed by Isl2a signaling might be involved in the extension of peripheral axons, and Abbreviations: MO, morpholino antisense oligonucleotide; cDNA, complementary DNA. ⇑ Corresponding author. Fax: +81 484679714. E-mail address: [email protected] (H. Okamoto). http://dx.doi.org/10.1016/j.bbrc.2014.01.193 0006-291X/Ó 2014 Elsevier Inc. All rights reserved.

proposed a model whereby genes transcribed by Isl2a might determine why two axons extend and/or how the polarized growth of axons is achieved. To address our hypothesis, we needed to first identify molecules whose expression patterns are affected by functional blockage of Isl2a. Accordingly, we developed a transgenic fish model in which GFP expression is specifically activated in sensory neurons to enable their efficient identification and recovery [8,9]. The trigeminal neurons were dissected out and collected using fine glass capillary under a dissecting microscope. Next we pooled an annotated cDNA library of interest and manually selected clones thought to represent rare transcripts that had not been studied in neurons to test their expression in sensory neurons. Finally, we compared gene expression patterns between control and LIMIsl2a-overexpressing embryos. By these relatively laborious procedures, we could isolate novel genes expressed in sensory neurons and examine changes in mRNA expression induced by the functional depression of Isl2a.

2. Materials and methods 2.1. Fish maintenance Wild-type and transgenic zebrafish were maintained in our laboratory as described elsewhere [10]. Embryos were incubated

358

M. Aoki et al. / Biochemical and Biophysical Research Communications 445 (2014) 357–362

at 28.5 °C and developmental stages were identified based on Kimmel et al. [11]. 2.2. Construction of a sensory neuron cDNA library using trigeminal ganglion GFP-expressing trigeminal neurons were dissected from Tg(SSX-isl1:GFP, rw0145) transgenic fish [8,9] embryos using a glass microcapillary. mRNAs were purified and converted into cDNAs to construct a library using the Creator™ SMART™ cDNA Library Construction Kit (Clontech). cDNA sequence was determined using an ABI PRISM 3100 genetic analyzer (Applied Biosystems) and further analyzed by a similarity search in NCBI using the BLASTX algorithm. 2.3. Injection of antisense morpholino oligonucleotides Antisense morpholino oligonucleotides (MOs) (Gene Tools) against simplet, tppp, tusc5, and tmem59l were designed to block protein translation of the respective genes. MO sequences were as follows: simplet-MO: CAACACACATCTTTGCCACGGTCCA, tpppMO: TATTTCACCCGAACCCTCAGCCATG, tusc5-MO: TCCGTATCTGTG TTTACTGCCATTG, tmem59l-MO: ACCCTGCCGCCGAACTGGAGCATCT. MOs were dissolved in double-distilled water and microinjected by air pressure into 1 to 2-cell-stage zebrafish embryos as described previously [7]. 2.4. Histological analysis of zebrafish embryos Whole-mount in situ hybridization and immunohistochemistry were carried out as described previously [7]. Axons were immunostained using an anti-acetylated a-tubulin antibody (Sigma) followed by the appropriate secondary antibody and diaminobenzidine reaction [12]. Embryos were then flat-mounted in glycerol and imaged by differential interference contrast on an Axioplan2 microscope (Zeiss) fitted with an AxioCam digital camera (Zeiss). Branching of peripheral axons was evaluated by counting the number of crossing points of the peripheral branches with the ventral edge of the spinal cord in the 8th–17th somite. Statistical differences were evaluated by using the unpaired t-test and PRISM 5 software (Graph Pad Software). 3. Results and discussion 3.1. Screening for genes transcriptionally regulated by Isl2a in zebrafish sensory neurons We conducted a systematic screen in zebrafish for molecules regulated by Isl2a (Fig. 1). First, we created a sensory neuron-derived cDNA library from transgenic fish embryos expressing GFP specifically under control of the sensory neuron-specific enhancer of islet-1 [8,9]. We determined the cDNA sequence of 3188 individual clones followed by a similarity search in NCBI using the BLASTX algorithm and identified 139 genes not present in the zebrafish EST database and not reported in any species at the time of experiment. Next, we confirmed that 44 of the 139 genes showed mRNA expression in sensory neurons using 24 h post-fertilization (hpf) zebrafish embryos. Of these, 26 genes showed changed mRNA expression with overexpression of the dominant-negative form of Isl2a (Supplementary Table 1) [7], with all but one showing reduced or diminished mRNA expression and the remaining gene showing increased expression (Supplementary Table 1). These 26 genes were therefore regarded as possible downstream targets of Isl2a.

Our screening revealed several genes already reported to function in neuronal cells. For example, clone 578 is drg11, a paired homeodomain transcription factor expressed in sensory neurons and required for the projection of cutaneous sensory afferent fibers [13], while clone 4557 is fez1, a homolog of unc-76 required for normal axon growth and fasciculation in nematode [14]. Several genes have also been implicated in maintaining the structural integrity of neuronal processes such as clone 5884, coding for map1b, which plays a role in enhancing microtubule assembly in axons and extension rate in developing neurons [15,16]. Finally, clone 4055 is beta-thymosin, an actin-binding protein that functions in axonal extension in zebrafish embryonic brain. Antisense-mediated knockdown of beta-thymosin caused a defect in midbrain–hindbrain boundary formation as well as neuronal process formation [17]. These data suggested that the phenotype observed in Isl2a functional repression could result from altered expression of genes regulating axon extension, neuronal differentiation, or neuronal survival. 3.2. simplet, tppp, tusc5, and tmem59l clones are possible Islet2a downstream genes We finally obtained 26 clones showing changes in mRNA expression in the LIMIsl2a-overexpressing embryos, with several already implicated in axon extension or the developing nervous system. This suggested that our screening could be effective to isolate genes involved in inhibiting axon extension in sensory neurons with LIMIsl2a overexpression. Next, we selected four genes from our screening that have no reported function in axon growth to identify novel genes involved in Isl2a-dependent axon extension. The first such candidate gene, simplet, is homologous to human fam53b [18]. This gene encodes no functional protein domains and its exact molecular function has not been determined. simplet was mainly expressed in the central nervous system and also in muscle cells. Knocking down of simplet caused delayed epiboly formation and reduced body size, suggesting a role in cell proliferation [18]. Another report implicated simplet in fin regeneration of zebrafish [19]. In the 24 hpf zebrafish embryo studied herein, simplet was expressed in trigeminal neurons, cranial ganglion cells, and a subset of hindbrain neurons (Fig. 2A). In spinal cord, simplet transcripts were found in Rohon Beard (RB) sensory neurons (Fig. 2B), and in Isl2a dominant-negative embryos, the mRNA expression of simplet was significantly reduced in both spinal cord and trigeminal neurons (Fig. 2E and F). The second novel gene candidate is tppp, which is homologous to human tubulin polymerization promoting protein (tppp). This protein was isolated from bovine brain [20] and later found to promote polymerization or stabilization of microtubule [21,22]. In wild-type zebrafish embryo, the tppp was expressed in trigeminal neurons (Fig. 2C), spinal neurons including RB neurons, and primary motor neurons (Fig. 2D). In non-neural tissue, the tppp transcript was found in intestine (Fig. 2D). In contrast, the Isl2a dominant-negative embryos showed no tppp expression in any tissue or cell type (Fig. 2G and H). The third gene selected for study was tusc5, a homologue of the human tumor suppressor candidate 5 protein (tusc5) gene. tusc5 expression is missing in lung cancer patients due to a chromosomal deletion [23]. This gene codes for the CD225 domain-containing protein, which has been associated with interferon-induced cell growth suppression [24]. tusc5 is expressed in adipose tissue and somatosensory neurons, it is downregulated by cold stimulation, and its expression increases with adipocyte maturation and augmented PPAR gamma signaling. [25,26]. In zebrafish embryos, the tusc5 gene was expressed in trigeminal and RB neurons as well as hindbrain neurons (Fig. 2I and J), and the Isl2a dominant-negative embryos showed slightly reduced mRNA

M. Aoki et al. / Biochemical and Biophysical Research Communications 445 (2014) 357–362

359

Fig. 1. Schematic illustration of Islet2a downstream screening procedure. (A) Collection of trigeminal ganglion neurons with glass microcapillary. We used Tg(SSX-isl1:GFP) transgenic zebrafish expressing GFP in sensory neurons to collect cells from trigeminal ganglion. Using a fine-glass capillary, trigeminal neurons were dissected and collected to construct a cDNA library. (B) Flowchart of the screening procedure. The collected neurons were subjected to mRNA extraction followed by cDNA construction. cDNA clones were sequenced and annotated using the BLAST program, and the expression patterns of selected clones were determined. Genes showing mRNA expression were further analyzed in the embryos expressing LIMIsl2a.

expression of tusc5 in trigeminal and RB neurons (Fig. 2M and N). Interestingly, the tusc5 expression seemed to expand ventrally in the spinal cord of Isl2a dominant-negative embryo (Fig. 2N), although we could not rule out what type of cells express tusc5 ectopically in this context. The final gene candidate is tmem59-like (tmem59l), which encodes the homolog of a gene called brain-specific membrane-anchored protein (BSMAP) [27]. There is no known functional domain in this protein, although it has been associated with a membrane protein predicted by the TMHMM membrane protein prediction program. Tmem59l mRNAs were abundant in both central and peripheral nervous system, while the trigeminal, anterior commissure, diencephalic, hindbrain, cranial, and RB neurons expressed tmem59l (Fig. 2K and L) in 24 hpf embryos. In Isl2a dominant-negative embryos, tmem59l mRNA expression was decreased in the anterior commissure, diencephalic, and RB neurons (Fig. 2O and P), but was not changed in trigeminal and cranial neurons (Fig. 2K and O). 3.3. simplet, tppp, tusc5, and tmem59l are required for the extension of peripheral axons in Rohon Beard sensory neurons RB neurons show bivalent axonal projection, whereby the central axons extend into the spinal cord and the peripheral axons extend toward the body wall of an embryo and are extensively branched to form an arbor structure (Fig. 3A and B). Axonal trajectories of RB neurons were easily visualized by the immunostaining

against acetylated tubulin. In a previous study, we showed that dominant-negative Isl2a inhibits peripheral axon extension. Herein, overexpression of the LIM domains of Isl2a in zebrafish embryo caused selective inhibition of peripheral axon extension in sensory neurons (Fig. 3C) as well as axon extension ventrally in primary motor neurons (Fig. 3D) [7]. This accorded with our expectation that genes transcriptionally regulated by Isl2a could serve in the extension of peripheral axons of sensory neurons. To confirm whether the knockdown of Isl2a downstream genes could affect axon extension in sensory neurons, we took a reverse genetic approach using morpholino antisense oligonucleotides (MO). We prepared MOs against simplet, tppp, tusc5, and tmem59l and injected them into one-cell-stage zebrafish embryos. The simplet-MOinjected embryo showed stalled extension of the peripheral axons in RB neurons and reduced branching (Fig. 3E). Extension of the central axons in RB neurons in the spinal cord did not change, while some primary motor neurons lost axons (Fig. 3F, arrow). To measure the complexity of peripheral axons of RB neurons, we then adopted the concept from the sholl-analysis used to quantitate the complexity of dendritic arbors of neurons by counting the number of crossing points along the line drawn on the ventral edge of spinal cord (see Section 2 for detail). The numbers of cross points were significantly reduced in the simplet-MO-injected embryos (Fig. 3M) (control = 28.90 ± 1.36 SEM N = 10; simpletMO = 19.13 ± 2.60 SEM N = 8; P = 0.0028, t-test, control vs. simplet-MO). The tppp-MO also reduced the extension and branching of peripheral axons in RB neurons (Fig. 3G and M), whereas the

360

M. Aoki et al. / Biochemical and Biophysical Research Communications 445 (2014) 357–362

Fig. 2. Comparison of gene expression patterns between wild-type and Islet2a dominant-negative embryos. Overexpression of dominant-negative Islet2a reduced the expression of four possible downstream genes. (A, B, E, F) simplet mRNA expression pattern in 24 hpf embryo. (C, D, G, H) tppp mRNA expression pattern in 24 hpf embryo. (I, J, M, N) tusc5 mRNA expression pattern in 24 hpf embryo. (K, L, O, P) tmem59l mRNA expression pattern in 24 hpf embryo. We compared the gene expression patterns between control embryos (Control: upper rows, A–D and I–L) and embryos overexpressing the LIM domains of Isl2a (LIMIsl2a: bottom rows, E–F and M–P). We examined the expression of four selected genes in sensory neurons. (A, C, E, G, I, K, M, O) The left lines represent the gene expression patterns in trigeminal sensory neurons. (B, D, F, H, J, L, N, P) The right lines represent the gene expression patterns in RB neurons. Dorsal view (A, C, E, G, I, K, M, O), lateral view (B, D, F, H, J, L, N, P); anterior left, dorsal top.

phenotype in the central axons was subtle (Fig. 3H). Primary motor neurons showed reduced ventral axon extension (Fig. 3H) (control = 28.90 ± 1.36 SEM N = 10; tppp-MO = 12.00 ± 2.49 SEM N = 8; P < 0.0001, t-test, control vs. tppp-MO). The tusc5-MO reduced the extension of peripheral axons in RB neurons (Fig. 3I and M) (control = 28.90 ± 1.36 SEM N = 10; tusc5-MO = 7.13 ± 0.99 SEM N = 8; P < 0.0001, t-test, control vs. tusc5-MO). The central axon fascicules were loosened and the extension was slightly reduced (Fig. 3J). Finally, the tmem59l-MO also reduced the extension of peripheral axons in RB neurons as well as the branching of peripheral axons (Fig. 3K and M)) (control = 28.90 ± 1.36 SEM N = 10; tmem59l-MO = 10.40 ± 1.70 SEM N = 10; P < 0.0001, t-test, control vs. tmem59l-MO), while the central axons showed only a subtle change. Primary motor neurons extended normally (Fig. 3L). In the present study, we isolated genes whose mRNA levels are changed by Isl2a by comparing the gene expression patterns between wild-type and transgenic embryos. We isolated four novel genes not previously implicated in axon growth of neurons.

Knockdown of each of these genes disrupted peripheral axon extension in RB neurons. Unexpectedly, we found that simplet is required for axonal extension in RB neurons. Simplet binds to 14–3-3 adaptor protein and Ski-interacting protein (SKIIP), which are involved in signaling pathways regulating cell proliferation [18]. Thus, Simplet might use different binding partners to execute axon growth in neurons or induce the SKIIP-dependent transcription of genes related to axon growth. Injection of tppp-MO decreased axon growth in the expressing neurons. Tppp promotes tubulin polymerization, thus knockdown of Tppp caused decreased polymerization of tubulin polymer that is crucial for proper axon growth [28]. We found that tusc5 is also required for axon extension in RB neurons. tusc5 expression was previously localized to somatosensory neurons (trigeminal ganglia and dorsal root ganglion) and may play a role in adipocyte maturation in adult animals. In developing embryo, somatosensory neurons require tusc5 expression to build proper neural networks. Finally, we found that tmem59l is also required for axon extension in RB neurons. This

M. Aoki et al. / Biochemical and Biophysical Research Communications 445 (2014) 357–362

361

Fig. 3. Knock down of possible Islet2a downstream genes inhibits the extension of peripheral axons in Rohon–Beard neurons. Axons of neurons in spinal cord of 24 hpf zebrafish embryos were stained with anti-acetylated tubulin antibody. (A) The peripheral axons of RB neurons extended to form branched structures. (B) The central axon extended along the longitudinal axis (B, arrowhead), while the axons of primary motor neurons extended ventrally (asterisk). (C) In the embryo overexpressing LIMIsl2a, the peripheral axon extension was disrupted. (D) The central axon extended normally while primary motor neurons could not extend ventral processes. (E) simplet-MO reduced the extension of peripheral axons in RB neurons. (F) The central axons were intact in simplet-MO-injected embryos and some primary motor neurons did not extend axons ventrally (F, arrow). (G) tppp-MO reduced the peripheral axon extension in RB neurons. (H) The central axons showed axon extension, whereas primary motor neuron showed reduced axon extension. (I) tusc5-MO reduced the peripheral axon extension in RB neurons. (J) While the central axon extended, primary motor neurons lost their axon extension. (K) tmem59l-MO disrupted the extension of peripheral axons in RB neurons. (L) Both central axon and primary motor neurons extended axons normally in the embryos injected with tmem59l-MO. (M) Quantitative summary of the MO and Isl2a dominant-negative embryos. The peripheral axons were analyzed by counting the cross points along the line drawn on the ventral edge of spinal cord (see Section 2 for detail). (A–L) Lateral view, anterior left, dorsal top. Statistical analysis was carried out by t-test. ⁄⁄⁄⁄ P < 0.0001, ⁄⁄P = 0.0028.

is the first report describing a functional role of tmem59l, although the brain-specific expression of this gene is known. In addition, the deduced protein sequence for expressed tmem59l reveals no information regarding functional domains except that it encodes a transmembrane protein. We are currently pursuing the molecular function of this novel Isl2a-associated gene.

Acknowledgments We thank all members of the Okamoto laboratory for their technical assistance, fish care, and helpful discussions. We are grateful to the Support Unit for Bio-material Analysis, and RIKEN BSI Research Resources Center for help with DNA sequencing analysis.

362

M. Aoki et al. / Biochemical and Biophysical Research Communications 445 (2014) 357–362

This work was supported in part by a Grant-in-Aid from the Ministry of Education, Culture, Sport, Science and Technology of Japan. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.bbrc.2014.01.193.

[14]

[15]

[16] [17]

References [1] S. Thor, S.G. Andersson, A. Tomlinson, J.B. Thomas, A LIM-homeodomain combinatorial code for motor-neuron pathway selection, Nature 397 (1999) 76–80. [2] M. Tokumoto, Z. Gong, T. Tsubokawa, C.L. Hew, K. Uyemura, Y. Hotta, H. Okamoto, Molecular heterogeneity among primary motoneurons and within myotomes revealed by the differential mRNA expression of novel islet-1 homologs in embryonic zebrafish, Dev. Biol. 171 (1995) 578–589. [3] S.A. Hutchinson, J.S. Eisen, Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity, Development 133 (2006) 2137–2147. [4] I.B. Dawid, J.J. Breen, R. Toyama, LIM domains: multiple roles as adapters and functional modifiers in protein interactions, Trends Genet. 14 (1998) 156–162. [5] A.D. Agulnick, M. Taira, J.J. Breen, T. Tanaka, I.B. Dawid, H. Westphal, Interactions of the LIM-domain-binding factor Ldb1 with LIM homeodomain proteins, Nature 384 (1996) 270–272. [6] S.K. Lee, S.L. Pfaff, Synchronization of neurogenesis and motor neuron specification by direct coupling of bHLH and homeodomain transcription factors, Neuron 38 (2003) 731–745. [7] H. Segawa, T. Miyashita, Y. Hirate, S. Higashijima, N. Chino, K. Uyemura, Y. Kikuchi, H. Okamoto, Functional repression of Islet-2 by disruption of complex with Ldb impairs peripheral axonal outgrowth in embryonic zebrafish, Neuron 30 (2001) 423–436. [8] O. Uemura, Y. Okada, H. Ando, M. Guedj, S. Higashijima, T. Shimazaki, N. Chino, H. Okano, H. Okamoto, Comparative functional genomics revealed conservation and diversification of three enhancers of the isl1 gene for motor and sensory neuron-specific expression, Dev. Biol. 278 (2005) 587–606. [9] S. Higashijima, Y. Hotta, H. Okamoto, Visualization of cranial motor neurons in live transgenic zebrafish expressing green fluorescent protein under the control of the islet-1 promoter/enhancer, J. Neurosci. 20 (2000) 206–218. [10] M. Westerfield, The Zebrafish Book, 2000. [11] C.B. Kimmel, W.W. Ballard, S.R. Kimmel, B. Ullmann, T.F. Schilling, Stages of embryonic development of the zebrafish, Dev. Dyn. 203 (1995) 253–310. [12] A.B. Chitnis, J.Y. Kuwada, Axonogenesis in the brain of zebrafish embryos, J. Neurosci. 10 (1990) 1892–1905. [13] Z.F. Chen, S. Rebelo, F. White, A.B. Malmberg, H. Baba, D. Lima, C.J. Woolf, A.I. Basbaum, D.J. Anderson, The paired homeodomain protein DRG11 is required

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

for the projection of cutaneous sensory afferent fibers to the dorsal spinal cord, Neuron 31 (2001) 59–73. L. Bloom, H.R. Horvitz, The Caenorhabditis elegans gene unc-76 and its human homologs define a new gene family involved in axonal outgrowth and fasciculation, Proc Natl Acad Sci U.S.A. 94 (1997) 3414–3419. S.R. Tymanskyj, T.M. Scales, P.R. Gordon-Weeks, MAP1B enhances microtubule assembly rates and axon extension rates in developing neurons, Mol. Cell Neurosci. 49 (2012) 110–119. P.R. Gordon-Weeks, I. Fischer, MAP1B expression and microtubule stability in growing and regenerating axons, Microsc. Res. Tech. 48 (2000) 63–74. L.W. Roth, P. Bormann, A. Bonnet, E. Reinhard, Beta-thymosin is required for axonal tract formation in developing zebrafish brain, Development 126 (1999) 1365–1374. V. Thermes, E. Candal, A. Alunni, G. Serin, F. Bourrat, J.S. Joly, Medaka simplet (FAM53B) belongs to a family of novel vertebrate genes controlling cell proliferation, Development 133 (2006) 1881–1890. C. Kizil, G.W. Otto, R. Geisler, C. Nusslein-Volhard, C.L. Antos, Simplet controls cell proliferation and gene transcription during zebrafish caudal fin regeneration, Dev. Biol. 325 (2009) 329–340. M. Takahashi, K. Tomizawa, K. Ishiguro, K. Sato, A. Omori, S. Sato, A. Shiratsuchi, T. Uchida, K. Imahori, A novel brain-specific 25 kDa protein (p25) is phosphorylated by a Ser/Thr-Pro kinase (TPK II) from tau protein kinase fractions, FEBS Lett. 289 (1991) 37–43. L. Tirian, E. Hlavanda, J. Olah, I. Horvath, F. Orosz, B. Szabo, J. Kovacs, J. Szabad, J. Ovadi, TPPP/p25 promotes tubulin assemblies and blocks mitotic spindle formation, Proc. Natl. Acad. Sci. U.S.A. 100 (2003) 13976–13981. N. Tokesi, A. Lehotzky, I. Horvath, B. Szabo, J. Olah, P. Lau, J. Ovadi, TPPP/p25 promotes tubulin acetylation by inhibiting histone deacetylase 6, J. Biol. Chem. 285 (2010) 17896–17906. H. Konishi, M. Sugiyama, K. Mizuno, H. Saito, Y. Yatabe, T. Takahashi, H. Osada, T. Takahashi, Detailed characterization of a homozygously deleted region corresponding to a candidate tumor suppressor locus at distal 17p13.3 in human lung cancer, Oncogene 22 (2003) 1892–1905. G.A. Deblandre, O.P. Marinx, S.S. Evans, S. Majjaj, O. Leo, D. Caput, G.A. Huez, M.G. Wathelet, Expression cloning of an interferon-inducible 17-kDa membrane protein implicated in the control of cell growth, J. Biol. Chem. 270 (1995) 23860–23866. H. Koide, T. Shibata, N. Yamada, T. Asaki, T. Nagao, T. Yoshida, Y. Noguchi, T. Tanaka, Y. Saito, I. Tatsuno, Tumor suppressor candidate 5 (TUSC5) is expressed in brown adipocytes, Biochem. Biophys. Res. Commun. 360 (2007) 139–145. P.J. Oort, C.H. Warden, T.K. Baumann, T.A. Knotts, S.H. Adams, Characterization of Tusc5, an adipocyte gene co-expressed in peripheral neurons, Mol. Cell Endocrinol. 276 (2007) 24–35. G.C. Elson, A.B. de Coignac, J.P. Aubry, Y. Delneste, G. Magistrelli, J. Holzwarth, J.Y. Bonnefoy, J.F. Gauchat, BSMAP, a novel protein expressed specifically in the brain whose gene is localized on chromosome 19p12, Biochem. Biophys. Res. Commun. 264 (1999) 55–62. A. Sakakibara, R. Ando, T. Sapir, T. Tanaka, Microtubule dynamics in neuronal morphogenesis, Open Biol. 3 (2013) 130061.