BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
Vol. 173, No. 2, 1990
Pages 561-565
December 14, 1990
IDENTIFICATION OF POINT MUTATIONS BY MISPAIRINC PCR AS EXEMPLIFIED IN MERRF DISEASE Peter Seibel 1. Frangeise Degoul 2, Norma Romero 3, Cecile Marsac 2, and Bernhard Kadenbach i 1 Fachbereich Chemie der Philipps-Universifiit Hans-Meerwein-StraBe D-3550 Marburg, FRG 2 Laboratoire de Biochimie, INSERM U. 75 Facult~ de Medecine Necker Enfants Malades 156 Rue de Vaugirard 75730 Paris Cedex 15, France 3 INSERM U. 153 17 Rue du Fer-a-Moulin 75005 Paris, France Received October 17, 1990
S u m m a r y : The point mutation in the tRNA Lys gene of mitochondrial DNA (mtDNA) from patients with m y o c l o n ic epilepsy and ragged red fibers (MERRF) was quantitatively analyzed after digestion with the restriction endonuclease Nae I of the PCR amplified DNA. Since the point mutation is not part of a restriction site for a c o m m o n l y available restriction endonuclease, the Nae I restriction site was introduced b y PCR using a rotspairing primer. The percentage of mutated mtDNA was determined in a few hairs of five members of an affected family b y counting the radioactivity of the fragments after PCR amplification with labelled dATP. ®1990 ~caa~mic Pre~s, ~no.
The prenatal
diagnosis of single gene
disorders
was
greatly
simplified by
the
application of the Polymerase Chain Reaction (PCR) followed by restriction endonuclease digestion and ethidium bromide visualization of the separated fragments on agarose gels (1). In m a n y cases, however, the mutation is not located within a c l e a v a g e site of a restriction endonuelease. In these cases, the more laborious sequencing of the PCR arr.plified fragment is required. By applying a mispairing primer we h a v e introduced a new restriction site at the mutation locus during PCR, which enabled us to differentiate by restriction endonuclease digestion b e t w e e n normal and
mutated
mitochondrial
DNA (miDNA) of five
members of a family with rnyoclonie epilepsy and ragged red fibers (MERRF). Recently the MERRF disease could be shown to be maternally inherited (2) and to be caused by a single point mutation in the tRNA ±ys gene of the mtDNA (3). We h a v e analyzed the
Abbreviations: bp, base pairs~ MERRF, myoclonic epilepsy with ragged red fibers, mtDNA, mitochondrial DNA, nt, nucleotide, PCR, Polymerase Chain Reaction.
561
0006-291X/90 $1.50 Copyright © 1990 by Academic Press, Inc. All rights of reproduction in any form reserved.
Vol. 173, No. 2, 1990
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
mtDNA from a few hairs (4) of the five individuals, a v o i d i n g a n y diagnosis.
The
mispairing
PCR, as described
in this
publication,
i n v a s i v e m e t h o d of is simple,
new
and
a p p l i c a b l e to a n y point mutation. Therefore the described m e t h o d m a y be of general use.
MATERIALS AND METHODS Patients: The F r e n c h family consisted of a healthy 42 y e a r old father (I/l), a s e v e r e l y affected 40 years old mother (I/2), a rn.ildly affected son of 18 years (II/3) a s e v e r e l y affected son of 15 years (II/2) and a s e v e r e l y affected daughter of ll years (II/l).
Isolation of mtDNA: The re.tDNA was isolated from muscle biopsies, arn.plified b y PCR and s e q u e n c e d as described b y Shoffner et. a]. (3]. DNA was extracted from 20-30 hairs of the probands a c c o r d i n g to the procedure of Higuchi el. a]. (4).
PCR amplifiGation: The primer used for PCR w e r e MERRF-For (nt 8282-8305 of the h u m a n h e a v y strand mtDNA (5)) and MERRF-Rev (see fig. 2): MERRF-For : MERRF-Rev :
CCCCTCTAGAGCCCACTGYAAAGC CG©CCATTTCACTCTAAACACCT©CCCC
Amplification of mtDNA b y PCR was performed for 35 cycles in 100 F1 reaction v o l u m e containing 10 ~_1 DlfA extract, 1 gl T4 g e n e 32 protein (Boehringer, Mannheim). 2 ~1 [ c ( - 3 2 p ] d A T P (3OOO C i / m m o l ) , 30 pmol each of the printers MERRF-For and MERRF-Rev and the reagents described in the arn.plifiealion protocol of P e r k i n - E l m e r / C e t u s . The radioactive fragments (90 bp) w e r e purified from an agarose gel by elecfroelutJon and digested with A-ae I (Boehringer, Mannheirn.). The digestion products w e r e separated on an 8 % p o ] y a c r y l a m i d e gel and detected b y auteradiography.
RESULTS AND DISCUSSION The point mutation in the tRIfA l~y~ g e n e of the mtDNA from the muscle biopsy of a s e v e r e l y affected MERRF patient is shown in fig. 1. The re.utation is located in a region of the mitochondrial
genome where
no c o m m e r c i a l l y a v a i l a b l e restriction e n d o n u c l e a s e
will cut. Therefore, w e constructed a primer w h i c h ends with its 3' end at the n e i g h b o u r i n g nucleotide of the ro.utation and contains two mispairing nucleotides in order to g e n e r a t e a A-ae ] restriction site, as shown in fig. 2. The mlspairing primer, together with a second fully homologous
primer,
was
found
to amplify
specifically
the e x p e c t e d
fragment
of
90 bp b y PCR. The mtDNA was extracted from 20-30 hairs of each
proband
of a family
with
s e v e r e l y affected individuals with MERRF disease. The p e d i g r e e of the family is presented in fig. 3. After PCR amplification with the mispairing primer in the presence of radioactive [ ~ - 3 ~ P ] d A T P and digestion with N a e 7, the mtDNA fragments w e r e separated b y polyacrylamide
gel
etectrophoresis
and
detected
by
autoradiography
as
shown
in
fig. 4.
Whereas mtDNA from the father (I/l) g a v e o n l y a single band of 90 bp, w h i c h corresponds to w i l d - t y p e mtDNA, all other farnlly m e m b e r s s h o w e d in addition two bands of 64 and 562
Vol. 173, No. 2, 1990
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
normal mtDNA
GA
TO]
MERRF mtDNA
A---8350 C A A C C
GA
TC
A--8350 C A A
C C
A G A G---8340 A
A G A
G---8340 A
F i g u r e 1. S e q u e n c e analysis of the mutation in the mitochondrlal e n c o d e d tRNA Lye g e n e in a MERRF patient. The mtDNA of a control p r o b a n d a n d a MERRF patient is isolated from m u s c l e biopsies, amplified a n d s e q u e n c e d b y PCR. 26 b p at v a r y i n g ztDNA
in e a c h
varied
between
amounts, indicating
t h e polyre, m r p h i c o c c u r e n c e
indiviual. The percentage 0 a n d 87% (see l e g e n d
site for a c o m m e r c i a l l y
and
mutated
mtE)NA in t h e h a i r of t h e p r o b a n d s
to fig. 4.).
T h e rr'.ispairing PCR, as d e s c r i b e d cleavage
of m u t a t e d
of n o r m a l
available
in this s t u d y ,
is b a s e d
restriction endonuclease
on the introduction by including
nonpairfng
MERRF-Mutation MERRF-For
D
8350 8360 8370 ~CCAACA CCTCTTTACA GTGAAATGCCC C
I
MERRF-Rev
Polymerase Chain Reaction
Normal
ACCGGC rGGCCG
MERRF Nae I
F i g u r e 2. Strategy for the detection of point mutations u s i n g a mispairing primer for PCR, g e n e r a t i n g a restriction site at its 3' end. The s e q u e n c e of mtDNA with the point m u t a t i o n in the tRNA Lyz g e n e is s h o w n together with the synthetic primer (MERRF-Rev) b e g i n n i n g at the 5' site of the m u t a t e d nucleotide (nt 8345 of the light strand of h u m a n mtDNA (5)3. The primer includes two m i s m a t c h e s (nt 8347 a n d nt 8348) in order to g e n e r a t e a Arae ] restriction site in the mutated, but not in the normal mtDNA. The forward primer (MERRFFor) is h o m o l o g o u s to nt 8282-8305 of the h e a v y strand of the h u m a n mtDNA (5). 563
of a
V o l . 1 7 3 , N o . 2, 1 9 9 0
BIOCHEMICAL A N D BIOPHYSICAL RESEARCH C O M M U N I C A T I O N S
bp
M 11/3 11/2 II/1 I/2
I/1 I
. . . .
9o--
64-I
II
2
1
.
3
.
.
.
.
.
.
26--
F i g u r e ,3,. Pedigree of a family with MERRF disease. From: the parents (I/1. I/2) only the mother was affected. From the children two had severe symptoms of MERRF disease and/or Ramsay Hunt syndrome (II/1 and II/2), whereas patient II/3 was only mildly affected (cardiomyopathy). F i g u r e 4, Identification and quantification of the point mutation in patients with MERRF disease by restriction analysis. The autcradiogram shows the mtDNA fragments of the five probands, who were presented in fig. 3. M: Amplified DNA of another MERRF patient with severe symptoms. The numbers on top of the lanes correspond to the probartds presented in fig. 3. Quantification of the radioactive fragments by counting the excised bands allowed the following estimation of the percentage of mutated mtDNA M = 95 %, I/l = O %, I/2 -- 87 %, II/1 = 85 %, II/2 = 72 % and II/3 = 63%. n u c l e o t i d e s in o n e prirr'.el w h i c h b i n d s wdth its 3' e n d to the n e i g h b o u r i n g n u c l e o t i d e of the point mutation. With .he primer s h o w n in fig. 2 the m u t a t e d n u c l e o t i d e ot the mtDNA frore~ the MERRF patients (nt 8354: C) t h e n b e c o m e s part of a n e w A:ae f, w h i c h allows the
restriction site for
.~leavage of the fragment. The a m p l i f i e d w i l d - t y p e
(nt 8344 A) is not recogr~ized b y the A~ae I restriction e n d o n u c l e a s e . The 3
sequence
n u c l e o t i d e of
the rz'.ispairing primer, hcv~ever, must b e ihe correct n u c l e o t i d e a n d p r e f e r a b l y a C or C in order
to e n s u r e
the
:;~imer
function
for the
start of the
DNA
polymerase
during
amplification. We h a v e a p p l i e d this m i s p a i r i n g PCR in the analysis of a point m u t a t i o n in the mtDiqA of patients, using a few hairs as a n a l y t i c probe. The m e t h o d , h o w e v e r , c a n be a p p l f e d to the analysis of a n y k n o w n point mutation, i n c l u d i n g the p r e n a t a l diagnosis of c h r o m o s o m a l point mutations (e. g. Cystic Fibrosis) 46). Because the m e t h o d also i n c l u d e s lhe q u a n t i t a t i v e d e t e r m i n a t i o n of the m u t a t e d g e n e as c o m p a r e d to the w i l d - t y p e
gene
(see l e g e n d to fig. 43, it is also a p p l i c i a b l e to the analysis of alleiie mutations in h e a l t h y individuals, u s i n g a n o n i n v a s i v e m e t h o d of s a m p l i n g of the diagnostic probe.
ACKNOWLEDGMENTS This s t u d y was s u p p o r t e d b y the Thyssen-Stiftung, the D e u t s c h e F o r s c h u n g s g e m e i n s c h a f t , the F e n d s der C h e m i s c h e n Industrie a n d the AFM (Association Fran0aise c e n t r e les Myopathies). P. S. a c k n o w l e d g e s a f e l l o w s h i p of the Boehringer I n g e i h e i r n Fends. 564
Vol. 173, No. 2, 1990
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
REFERENCES 1. Kazazian, Jr, H. H. in: PCR Technology. Principles a n d Applications for DNA Amplification. (ed. Erlich, H. A.) 153-169 (Stockton Press, New York, 1989). 2. Wallace, D. C., Zheng, X. Loft, M. I., Shoffner, J. M., [-lodge, J. A., Kelly, R. I., Epstein, C. M. a n d Hopkins, L. C. (t988) Cell 55, 601-610. 3. Shoffner, ]. M., Lott, M. T., Lezza, A. M. S,, Seihel, P., Ballinger, S. W. and Wallace, D. C. (1990) Cell 61, 931-937. 4. Higuchi, R., v o n Beroldingen, C. H., Sensabaugh, G. F. a n d Erlieh, t-t. A. (1988) Nature 332, 543-546. 5. Anderson, S., Bankier, A. T., Barrell, B. G., DeBrmjn, M. H. L., Coulson, A. R., Drouin, ]., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. ]. H., Staden, R. a n d Young, I. G. (1981) Iqature 290, 457-465. 6. Dean, M., White, M. B., Amos, J., Gerrard, B., Stewart, C . Khaw, K.-T. a n d Leppert. M. (19903 Cell 61, 863-870.
565
Vol. 173, No. 2, 1990
Pages 561-565
December 14, 1990
IDENTIFICATION OF POINT MUTATIONS BY MISPAIRINC PCR AS EXEMPLIFIED IN MERRF DISEASE Peter Seibel 1. Frangeise Degoul 2, Norma Romero 3, Cecile Marsac 2, and Bernhard Kadenbach i 1 Fachbereich Chemie der Philipps-Universifiit Hans-Meerwein-StraBe D-3550 Marburg, FRG 2 Laboratoire de Biochimie, INSERM U. 75 Facult~ de Medecine Necker Enfants Malades 156 Rue de Vaugirard 75730 Paris Cedex 15, France 3 INSERM U. 153 17 Rue du Fer-a-Moulin 75005 Paris, France Received October 17, 1990
S u m m a r y : The point mutation in the tRNA Lys gene of mitochondrial DNA (mtDNA) from patients with m y o c l o n ic epilepsy and ragged red fibers (MERRF) was quantitatively analyzed after digestion with the restriction endonuclease Nae I of the PCR amplified DNA. Since the point mutation is not part of a restriction site for a c o m m o n l y available restriction endonuclease, the Nae I restriction site was introduced b y PCR using a rotspairing primer. The percentage of mutated mtDNA was determined in a few hairs of five members of an affected family b y counting the radioactivity of the fragments after PCR amplification with labelled dATP. ®1990 ~caa~mic Pre~s, ~no.
The prenatal
diagnosis of single gene
disorders
was
greatly
simplified by
the
application of the Polymerase Chain Reaction (PCR) followed by restriction endonuclease digestion and ethidium bromide visualization of the separated fragments on agarose gels (1). In m a n y cases, however, the mutation is not located within a c l e a v a g e site of a restriction endonuelease. In these cases, the more laborious sequencing of the PCR arr.plified fragment is required. By applying a mispairing primer we h a v e introduced a new restriction site at the mutation locus during PCR, which enabled us to differentiate by restriction endonuclease digestion b e t w e e n normal and
mutated
mitochondrial
DNA (miDNA) of five
members of a family with rnyoclonie epilepsy and ragged red fibers (MERRF). Recently the MERRF disease could be shown to be maternally inherited (2) and to be caused by a single point mutation in the tRNA ±ys gene of the mtDNA (3). We h a v e analyzed the
Abbreviations: bp, base pairs~ MERRF, myoclonic epilepsy with ragged red fibers, mtDNA, mitochondrial DNA, nt, nucleotide, PCR, Polymerase Chain Reaction.
561
0006-291X/90 $1.50 Copyright © 1990 by Academic Press, Inc. All rights of reproduction in any form reserved.
Vol. 173, No. 2, 1990
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
mtDNA from a few hairs (4) of the five individuals, a v o i d i n g a n y diagnosis.
The
mispairing
PCR, as described
in this
publication,
i n v a s i v e m e t h o d of is simple,
new
and
a p p l i c a b l e to a n y point mutation. Therefore the described m e t h o d m a y be of general use.
MATERIALS AND METHODS Patients: The F r e n c h family consisted of a healthy 42 y e a r old father (I/l), a s e v e r e l y affected 40 years old mother (I/2), a rn.ildly affected son of 18 years (II/3) a s e v e r e l y affected son of 15 years (II/2) and a s e v e r e l y affected daughter of ll years (II/l).
Isolation of mtDNA: The re.tDNA was isolated from muscle biopsies, arn.plified b y PCR and s e q u e n c e d as described b y Shoffner et. a]. (3]. DNA was extracted from 20-30 hairs of the probands a c c o r d i n g to the procedure of Higuchi el. a]. (4).
PCR amplifiGation: The primer used for PCR w e r e MERRF-For (nt 8282-8305 of the h u m a n h e a v y strand mtDNA (5)) and MERRF-Rev (see fig. 2): MERRF-For : MERRF-Rev :
CCCCTCTAGAGCCCACTGYAAAGC CG©CCATTTCACTCTAAACACCT©CCCC
Amplification of mtDNA b y PCR was performed for 35 cycles in 100 F1 reaction v o l u m e containing 10 ~_1 DlfA extract, 1 gl T4 g e n e 32 protein (Boehringer, Mannheim). 2 ~1 [ c ( - 3 2 p ] d A T P (3OOO C i / m m o l ) , 30 pmol each of the printers MERRF-For and MERRF-Rev and the reagents described in the arn.plifiealion protocol of P e r k i n - E l m e r / C e t u s . The radioactive fragments (90 bp) w e r e purified from an agarose gel by elecfroelutJon and digested with A-ae I (Boehringer, Mannheirn.). The digestion products w e r e separated on an 8 % p o ] y a c r y l a m i d e gel and detected b y auteradiography.
RESULTS AND DISCUSSION The point mutation in the tRIfA l~y~ g e n e of the mtDNA from the muscle biopsy of a s e v e r e l y affected MERRF patient is shown in fig. 1. The re.utation is located in a region of the mitochondrial
genome where
no c o m m e r c i a l l y a v a i l a b l e restriction e n d o n u c l e a s e
will cut. Therefore, w e constructed a primer w h i c h ends with its 3' end at the n e i g h b o u r i n g nucleotide of the ro.utation and contains two mispairing nucleotides in order to g e n e r a t e a A-ae ] restriction site, as shown in fig. 2. The mlspairing primer, together with a second fully homologous
primer,
was
found
to amplify
specifically
the e x p e c t e d
fragment
of
90 bp b y PCR. The mtDNA was extracted from 20-30 hairs of each
proband
of a family
with
s e v e r e l y affected individuals with MERRF disease. The p e d i g r e e of the family is presented in fig. 3. After PCR amplification with the mispairing primer in the presence of radioactive [ ~ - 3 ~ P ] d A T P and digestion with N a e 7, the mtDNA fragments w e r e separated b y polyacrylamide
gel
etectrophoresis
and
detected
by
autoradiography
as
shown
in
fig. 4.
Whereas mtDNA from the father (I/l) g a v e o n l y a single band of 90 bp, w h i c h corresponds to w i l d - t y p e mtDNA, all other farnlly m e m b e r s s h o w e d in addition two bands of 64 and 562
Vol. 173, No. 2, 1990
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
normal mtDNA
GA
TO]
MERRF mtDNA
A---8350 C A A C C
GA
TC
A--8350 C A A
C C
A G A G---8340 A
A G A
G---8340 A
F i g u r e 1. S e q u e n c e analysis of the mutation in the mitochondrlal e n c o d e d tRNA Lye g e n e in a MERRF patient. The mtDNA of a control p r o b a n d a n d a MERRF patient is isolated from m u s c l e biopsies, amplified a n d s e q u e n c e d b y PCR. 26 b p at v a r y i n g ztDNA
in e a c h
varied
between
amounts, indicating
t h e polyre, m r p h i c o c c u r e n c e
indiviual. The percentage 0 a n d 87% (see l e g e n d
site for a c o m m e r c i a l l y
and
mutated
mtE)NA in t h e h a i r of t h e p r o b a n d s
to fig. 4.).
T h e rr'.ispairing PCR, as d e s c r i b e d cleavage
of m u t a t e d
of n o r m a l
available
in this s t u d y ,
is b a s e d
restriction endonuclease
on the introduction by including
nonpairfng
MERRF-Mutation MERRF-For
D
8350 8360 8370 ~CCAACA CCTCTTTACA GTGAAATGCCC C
I
MERRF-Rev
Polymerase Chain Reaction
Normal
ACCGGC rGGCCG
MERRF Nae I
F i g u r e 2. Strategy for the detection of point mutations u s i n g a mispairing primer for PCR, g e n e r a t i n g a restriction site at its 3' end. The s e q u e n c e of mtDNA with the point m u t a t i o n in the tRNA Lyz g e n e is s h o w n together with the synthetic primer (MERRF-Rev) b e g i n n i n g at the 5' site of the m u t a t e d nucleotide (nt 8345 of the light strand of h u m a n mtDNA (5)3. The primer includes two m i s m a t c h e s (nt 8347 a n d nt 8348) in order to g e n e r a t e a Arae ] restriction site in the mutated, but not in the normal mtDNA. The forward primer (MERRFFor) is h o m o l o g o u s to nt 8282-8305 of the h e a v y strand of the h u m a n mtDNA (5). 563
of a
V o l . 1 7 3 , N o . 2, 1 9 9 0
BIOCHEMICAL A N D BIOPHYSICAL RESEARCH C O M M U N I C A T I O N S
bp
M 11/3 11/2 II/1 I/2
I/1 I
. . . .
9o--
64-I
II
2
1
.
3
.
.
.
.
.
.
26--
F i g u r e ,3,. Pedigree of a family with MERRF disease. From: the parents (I/1. I/2) only the mother was affected. From the children two had severe symptoms of MERRF disease and/or Ramsay Hunt syndrome (II/1 and II/2), whereas patient II/3 was only mildly affected (cardiomyopathy). F i g u r e 4, Identification and quantification of the point mutation in patients with MERRF disease by restriction analysis. The autcradiogram shows the mtDNA fragments of the five probands, who were presented in fig. 3. M: Amplified DNA of another MERRF patient with severe symptoms. The numbers on top of the lanes correspond to the probartds presented in fig. 3. Quantification of the radioactive fragments by counting the excised bands allowed the following estimation of the percentage of mutated mtDNA M = 95 %, I/l = O %, I/2 -- 87 %, II/1 = 85 %, II/2 = 72 % and II/3 = 63%. n u c l e o t i d e s in o n e prirr'.el w h i c h b i n d s wdth its 3' e n d to the n e i g h b o u r i n g n u c l e o t i d e of the point mutation. With .he primer s h o w n in fig. 2 the m u t a t e d n u c l e o t i d e ot the mtDNA frore~ the MERRF patients (nt 8354: C) t h e n b e c o m e s part of a n e w A:ae f, w h i c h allows the
restriction site for
.~leavage of the fragment. The a m p l i f i e d w i l d - t y p e
(nt 8344 A) is not recogr~ized b y the A~ae I restriction e n d o n u c l e a s e . The 3
sequence
n u c l e o t i d e of
the rz'.ispairing primer, hcv~ever, must b e ihe correct n u c l e o t i d e a n d p r e f e r a b l y a C or C in order
to e n s u r e
the
:;~imer
function
for the
start of the
DNA
polymerase
during
amplification. We h a v e a p p l i e d this m i s p a i r i n g PCR in the analysis of a point m u t a t i o n in the mtDiqA of patients, using a few hairs as a n a l y t i c probe. The m e t h o d , h o w e v e r , c a n be a p p l f e d to the analysis of a n y k n o w n point mutation, i n c l u d i n g the p r e n a t a l diagnosis of c h r o m o s o m a l point mutations (e. g. Cystic Fibrosis) 46). Because the m e t h o d also i n c l u d e s lhe q u a n t i t a t i v e d e t e r m i n a t i o n of the m u t a t e d g e n e as c o m p a r e d to the w i l d - t y p e
gene
(see l e g e n d to fig. 43, it is also a p p l i c i a b l e to the analysis of alleiie mutations in h e a l t h y individuals, u s i n g a n o n i n v a s i v e m e t h o d of s a m p l i n g of the diagnostic probe.
ACKNOWLEDGMENTS This s t u d y was s u p p o r t e d b y the Thyssen-Stiftung, the D e u t s c h e F o r s c h u n g s g e m e i n s c h a f t , the F e n d s der C h e m i s c h e n Industrie a n d the AFM (Association Fran0aise c e n t r e les Myopathies). P. S. a c k n o w l e d g e s a f e l l o w s h i p of the Boehringer I n g e i h e i r n Fends. 564
Vol. 173, No. 2, 1990
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
REFERENCES 1. Kazazian, Jr, H. H. in: PCR Technology. Principles a n d Applications for DNA Amplification. (ed. Erlich, H. A.) 153-169 (Stockton Press, New York, 1989). 2. Wallace, D. C., Zheng, X. Loft, M. I., Shoffner, J. M., [-lodge, J. A., Kelly, R. I., Epstein, C. M. a n d Hopkins, L. C. (t988) Cell 55, 601-610. 3. Shoffner, ]. M., Lott, M. T., Lezza, A. M. S,, Seihel, P., Ballinger, S. W. and Wallace, D. C. (1990) Cell 61, 931-937. 4. Higuchi, R., v o n Beroldingen, C. H., Sensabaugh, G. F. a n d Erlieh, t-t. A. (1988) Nature 332, 543-546. 5. Anderson, S., Bankier, A. T., Barrell, B. G., DeBrmjn, M. H. L., Coulson, A. R., Drouin, ]., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. ]. H., Staden, R. a n d Young, I. G. (1981) Iqature 290, 457-465. 6. Dean, M., White, M. B., Amos, J., Gerrard, B., Stewart, C . Khaw, K.-T. a n d Leppert. M. (19903 Cell 61, 863-870.
565
