GENOMICS

11,1113-1124(1991)

Identification of Multiple Sequences in a Candidate

CpG Islands and Associated Conserved Region for the Huntington Disease Gene

BERNHARD WEBER, COLIN COLLINS, DAVID KOWBEL, OLAF RIESS, AND MICHAEL R. HAYDEN Department

of Medical

Genetics, University of British Columbia, Received

May

28, 1991;

revised

Vancouver, British Columbia,

Canada V6T 285

July 24, 1991

1987a). In recent years, intensive efforts from many groups have been undertaken in the hope of identifying closer and, more importantly, flanking markers for the disease gene (Gilliam et al., 1987b; Nakamura et al., 1988; Pohl et al., 1988; Richards et al., 1988; Smith et al., 1988; Wasmuth et al., 1988; Whaley et al., 1988; Youngman et al., 1988, 1989; MacDonald et al., 1989a; Pritchard et al., 1989, 1990; Robbins et al., 1989; Bates et aZ., 1990). In the absence of cytogenetic abnormalities two genetic approaches have been taken to refine the location of the disease gene. These include the analysis of informative recombinants in HD families (Wasmuth et al., 1988; MacDonald et al., 1989b; Robbins et al., 1989; Skraastad et al., 1989a,b; Snell et al., 198913; Bates et al., 1990) and the demonstration of nonrandom association between some DNA marker alleles in 4~16.3 and the HD gene (Snell et al., 1989a; Theilmann et al., 1989; Ikonen et al., 1990; Adam et al., 1991). However, these studies provide conflicting results regarding the possible location of the gene. Based on these data, at least three different regions distal to D4SlO can be regarded as candidate regions (Fig. 1). Region 1 is localized between DNA segments D4S95 and D4S168 (Wasmuth et al., 1988; MacDonald et al., 1989b, Snell et al., 1989a; Theilmann et al., 1989; Ikonen et al., 1990; Whaley et al., 1991), region 2 lies distal to D4Slll and proximal to D4S90 (MacDonald et al., 198913;Skraastad et aZ., 198913;Snell et al., 1989b) and region 3 extends from D4S90 to the 4p telomere (Robbins et al., 1989). Extensive study of region 3 has lead to almost complete cloning of this most telomeric segment (Doggett et al, 1989; Bates et al., 1990; Pritchard et al., 1990; Whaley et al., 1991). Thus far, however, these efforts have not provided any evidence for a possible location of the HD gene within this telomeric region (Pritchard et al., 1990). On the basis of the reported data, ‘together with additional findings from informative recombinants in HD families from our laboratory (manuscript in preparation), we focused our efforts on region 2 and initi-

The IID locus has been assigned to 4~16.3 distal to the DNA segment D4SlO. However, the precise location of this gene is still unknown. At least three regions, together encompassing more than 3.5 Mb of DNA, can still be considered as candidate regions for the HD gene. Our efforts are directed toward the cloning and the complete characterization of one of these regions. Thus far we have cloned 460 kb of DNA in contiguously overlapping cosmids distal to D4Slll and have developed a detailed long-range restriction map orienting the contig within the terminal region of 4~16.3. We characterized 15 CpG-rich islands defined by tightly clustered rare cutter restriction sites for the enzymes iVot1, BssHII, EagI, NrnI, and SocII. In addition, we show that the sequences associated with the CpG-rich islands detect cross-species conservation. The detailed genetic analysis of the 460-kb contig provides a framework for the identification of genes, which can be assessed for the characteristics expected for the HD gene. o 1991 Academic Press, Inc.

INTRODUCTION Huntington Disease (HD) is an autosomal dominant neurodegenerative disorder characterized by both behavioral and motor disturbances that usually manifest in midlife (Hayden, 1981). The pathological abnormalities are confined to the central nervous system, with the most striking changes in the basal ganglia, particularly the caudate nucleus (reviewed in Vonsattel et al., 1985). However, the biochemical defect underlying the selective neuronal degeneration in HD is unknown. In 1983, genetic linkage between HD andapolymorphic anonymous marker G8 (D4SlO) localized the defective gene to chromosome 4 (Gusella et al, 1983). Subsequently, refined mapping placed D4SlO in the proximal portion of 4~16.3 (Magenis et al., 1986; Wang et al., 1986; MacDonald et al., 1987). Multipoint linkage analysis has established that the HD gene maps about 4 CM distal to D4SlO (Gilliam et al., 1113

All

Copyright 0 1991 rights of reproduction

0888-7543/91$3.00 by Academic Press, Inc. in any form reserved.

1114

WEBER

D4SlO

D4S95

I I

(4&n,

D4S43 I

I I MacGunald et al, 199Qb Whaleyatal,lQQl

4 I-lbnen

etal, 1990

’

I

D4S98 I

I

ET

AL.

D4S168 I

I

D4Slll I

I

Ijp

Snel et al, 1999a Theilmann et al, 1989

D4S90 I

1~

1

MacDonald etal, 19SQb Skraastad etal, 19SQb MacDonald et al, 1999b

> * *

Snell etal, 19SQb

4 1~

FIG. 1. Three candidate regions for the HD gene (shaded chromosomes (arrows) and of linkage disequilibrium studies somes placing the HD gene distal to mark&s at D4Slll.

WasmuG?et al, 1998

bars) can be defined by analyzing previously published data of recombinant HD (solid lines). MacDonald et al. (1989b) reported two recombinant HD chromo-

ated a cosmid walk from D4Slll toward the telomere. In this report we present data from the cosmid walk resulting in 460 kb of contiguously overlapping clones linking two previously defined DNA segments, D4Slll and D4S133 (Cox et al., 1989). Furthermore we provide a detailed long-range restriction map spanning 1.3 Mbp of DNA and orienting the contig within the terminal region of 4~16.3. The identification and characterization of CpG-rich islands and associated conserved DNA fragments provide a first step in the effort to isolate the genes contained within this region and to assessthe possible involvement of one of these genes in the pathogenesis of HD. MATERIALS

AND

METHODS

Cosmid Libraries Three cosmid libraries were utilized in this study. A flow-sorted chromosome 4 cosmid library (cell source: UV20 HL21-27, hamster-human hybrid line containing human chromosomes 4,8,21) was kindly provided by Los Alamos National Laboratory. This library is cloned in the vector SCOS-1and is propagated in the Escherichia coli host strain HBlOl. One human placental genomic cosmid library purchased utilizes the pWE1.5 vector and host strain E. coli AGl (Stratagene). A second human genomic cosmid library was constructed in our laboratory from Mb01 partially digested DNA using the cosmid vector SCOS-1and propagated in E. coli SURE cells (Stratagene) using the supplier’s protocols.

Cosmid DNA Preparation

and Probe Isolation

Cosmid DNA was prepared by using a 30 times scale up of the alkaline lysis method described by Birnboim and Doly (1979). The probes used for chromosomal walking, Southern blot analysis, and pulsed-field electrophoreses were prepared by electroelution from agarose gels or by isolation of low-

melting-point agarose slices containing the insert DNA. 32P-labeled probe DNA was prepared by the oligonucleotide method using random hexamer primers (Feinberg and Vogelstein, 1984). Probes were routinely preannealed with 300 rg of sonicated total human DNA in TE, pH 7.5, at 65°C for 1 to 6 h prior to hybridization.

Puked-Field

Gel Electrophoresis

Approximately 2 X lo7 white blood cells/ml were mixed in a 1:l ratio with 1% low-melting-point agarose and dispensed into 250~~1 slots. The agarose blocks were then sarcosyl/proteinase K treated as described (Herrmann et al., 1987) and stored for periods of more than 1 year in 0.5 M EDTA, pH 8.0, at 4°C. Prior to use, the blocks were equilibrated in an excess of the respective digestion buffer and subsequently digested with 10 U of enzyme for 4-6 h. Transverse alternating field electrophoresis was performed in a Beckman Gene Line apparatus. Vertical 0.8% agarose gels were run in 1X TAFE buffer (10X buffer contains 0.2 M Tris base, 0.01 M EDTA, and O:Oi38M Acetic acid) at 12°C at two different stages (stage 1, 30 min, 4-.s pulses, 170-mA constant current; stage 2, 18 h, 60-s pulses, 150~mA constant current). Gels were transferred to a nylon membrane as described under Southern blot analysis. Genomic fragment sizes were estimated by using Xconcatemers and the Saccharomyces cerevisiae chromosomes (Biorad) as size standards.

Oligonucleotide

Probes

Oligonucleotides pDJ34 (TGAGCCGAGATCGCGCCACTGCACTCCAGCCTGGG) (Dr. P. DeJong, Lawrence Livermore National Laboratory, personal communication), T3 (ATTAACCCTCACTAAAG), T7 (AATACGACTCACTATAG) (Stratagene), L13’ consensus (Dr. P. J. Goodfellow, Vancouver, personal communication), Ml3 (GAGGGTGGTGGATCT) (Vassart et al., 1987), Hzeta-18 (TGGGGCACAG-

COSMID

WALK

IN

A HD

GTTGTGAG), YNZ22 (CTCTGGGTGTCGTGC), Co12 (TGTATATTATTCTATATTG), My02 (GGAGGCTGGAGGAG) (referenced in Nakamura et al., 1987, P-601 (ACGAAATAGACTAGAAATA) (Simmler et aZ., 1987), (GT),,, and (CCCTAA), were synthesized on a PCR-Mate 391 DNA synthesizer (Applied Biosystems, Inc.) and purified according to the manufacturers recommendations. Labeling was carried out with T4 polynucleotide kinase and [y3’P]ATP for 30 min at 37°C as described in Sambrook et al. (1989).

DNA Preparations

and Southern

Blot Analysis

DNAs from various vertebrate species (blood samples from a killerwhale and a chinook salmon were kindly provided by M. Butchler, Stanley Park Aquarium, Vancouver) were prepared from either white blood cells or muscle tissue according to published methods (Kunkel et al, 1977). Five micrograms of each genomic DNA sample was digested to completion with the enzyme HincII (BRL) fractionated on a 0.8% agarose gel and transferred to Hybond-N membranes (Amersham) as described (Southern, 1975). All hybridizations were done in 0.5 M sodium phosphate buffer, pH 7.2, 7% sodium dodecyl sulfate (SDS) (Church and Gilbert, 1984) at 65°C except for the oligonucleotide hybridizations, which were performed at 42°C. Posthybridization washings were done at a final stringency of 1X SSC, 0.1% SDS at 65°C for the genomic probes and 1X SSC, 0.1% SDS at 42°C for the oligonucleotide primers. RESULTS

Chromosome Walking and the Organization Repeat Sequences within the Contig

of Simple

The cosmid walk was initiated by screening a flowsorted human chromosome 4 cosmid library (obtained from Los Alamos National Laboratory) with subclone 157.9 (D4Slll), a 450-bp Sau3A/PstI fragment (MacDonald et al., 1989a) isolated from a cosmid that overlaps the Not1 linking clone 157 (Pohl et al., 1988). Three cosmid clones, cl57 A, cl57 C, cl57 D, were obtained (Fig. 2) restricted in single and double digestions and fingerprinted with an Alu oligomer to establish overlapping restriction fragments (Fig. 3A). For example, three EcoRI/MluI-digested fragments from cosmids c157C and c157D hybridize to the Alu repeat (Fig. 3A). Two of the three fragments are of identical size in both cosmids (4 and 7 kb, respectively) and are also shared with cosmid c157A indicating that these two fragments are in internal locations in all three cosmids. The additional third Alu positive fragment at 12 kb in c157C and of a greater size in cl57A and

CANDIDATE

REGION

1115

c157D reflects varying extensions of these cosmids. A high density of Alu repeats as demonstrated in the c157A-D contig (Fig. 3A) was found throughout the cosmid walk (data not shown) and was a valuable tool in determining and confirming the identity of restriction fragments from successive walking cosmids. To expand the cl57 A-D contig, we isolated the T3and T7-EcoRI endfragments of cl57 A and screened the same colony filters used in the first round of screening without stripping the previous hybridization signals. The additional positive colonies were then isolated, restriction digested, and hybridized with the T3- (c157A/3.O(EM7) in Fig. 3B) or T7EcoRI endfragments of c157A, which confirmed that walking cosmids c157M and clB/clD were extensions, respectively. The results in Fig. 3B show that c157A and c157M overlap within a 16.5-EcoRI fragment and that c157M represents an extension of c157A in one direction (Fig. 2, Fig. 3B). Similar experimental procedures, which included the isolation of T3- or T7-EcoRI endfragments, the hybridization of these fragments to high-density colony filters, the isolation of additional positive colonies after second and third rounds of screening, the confirmation of overlapping restriction fragments by Alu fingerprinting, and the determination of an extension by hybridizing the endfragments or other internal fragments of the extension cosmid to the previously established contig (data not.shown), were performed for each walking step. For each walking step we isolated a minimum of eight positive cosmids. As a general observation, restriction enzyme analysis of cosmids from one walking step reflected three different situations. All of the respective cosmids wereidentical, as was the case for cosmids CllD, c13B6, and C14A, one walking step provided extensions in both directions (e.g., CGA-E), or cosmids were nested within each other. In general, the availability of independently isolated nested or overlapping cosmids made it readily possible to detect rearranged cosmid fragments and to exclude these cosmids from further analysis. Figure 2 only depicts the isolated cosmids that represent either significant walking steps or cosmids with unique insert sizes. Cosmid clones with identical inserts are not shown. Additional cosmids (c16D, clGDp, c16Q, and c16N) were initially identified with probe 281 and these were linked up to the existing contig and extended as described above. A total of 165 cosmids were actually isolated and analyzed. In an effort to minimize the potential problem of “unclonable regions” resulting from instability of certain DNA fragments in conventional E. coli strains we used two additional cosmid libraries. A pWE15 cosmid library from total genomic placental DNA was purchased from Stratagene, Inc., and provided the

1116

WEBER

-&A-

ET

AL. -157D ,pcl57C,' ,157AF

rni57MB

hz3D+clB----

t----------dD-

0

.5onm

ctsz.a(E5)

loo cl57 N1.7(E6)

Cl57 N5.5 157.9

sizi?

z

NXO(EM7)

.5DB ac6E--------------I Ic5Ep WR i@

M

A

I

1M)

t-------c68

#j zi' g$ ..: R% .y:.

M

II

-MI

IIll

Nr

I

I

CS

MM

I

N

n 150

czO(E3Dl)

-

M I

M

M II

n

c4N11.0 (RN)

200

I

I C5E/16

V7A--

78 csc+

VlOP' I

c100-

vc6F'

tiMA---

“os-C,cllD

a-dlD------------I

Nr

NM 250

C7E(E6)

-MA--------I -cllD-l

on

cloS/14

~---------~IGD-

t---cl

v1386-

-16Dp

-Cl604 ------c17031+ -16uw -ME-

-CWDp--i B r-lS

yw)

I

N

1

i B

II

M

I

M

I

M Nr

’ 2

300 cllD1'3.9

(4&r)

me1 -

COSMID

WALK

IN

A HD

c4N and c4R cosmids. An additional SCOS-1 total genomic library was constructed in our laboratory in the E. coli SURE strain (Stratagene), which minimizes unwanted rearrangements and subsequent deletions of certain DNA segments. This library was very helpful and provided cosmids ~100, cIOS, c13B6, and c14A, which were not represented in the other two libraries. Figure 4A shows the ethidium bromide-stained EcoRI fragments of 17 cosmids that represent the minimal number of cosmids spanning the 460 kb of contiguous DNA isolated in the cosmid walk. The “contig filters” were then used to test for the presence and spatial distribution of various repeats within 460 kb of genomic DNA. We first hybridized with the dinucleotide oligomer (GT) 10 (Fig. 4B) and localized 13 regions containing the microsatellite (GT)n/ (AC)n (Figs. 4B and 4D). The distribution of these tandem dinucleotide repeats within the contig seems random (Fig. 4D), resulting on average in one microsatellite locus per 35 kb of DNA. After stripping, the filter was rehybridized to the telomeric repeat (CCCTAA), (Fig. 4C). The lO.O-kb EcoRI fragment from cosmid c16D shows a strong sequence homology to this telomeric repeat (Figs. 4C and 4D). Subsequently this contig was also tested for the presence of the Ll family of long interspersed repeats (LINES) by using a 3’-Ll consensus oligomer but no strong homology was detected (data not shown). Finally a cocktail of six VNTR oligonucleotides (Hzeta-18, YNZ 22, M13, P-601, Co12, Myo2) was hybridized to the contig filter and did not reveal specific signals but rather a faint hybridization to many restriction fragments (data not shown).

Orientation

of Cosmid Clones by PFGE

As our walking efforts were directed from locus D4Slll toward the telomere, we used PFGE to orient our initial walking clones and therefore to focus our resources on a unidirectional walk. The closest known proximal marker to 157.9 (D4Slll), probe 854 (D4S97), was hybridized to a Southern blot of chromosomal high-molecularweight DNA digested with the infrequent cutter enzymes MluI, NotI, and NruI (Fig. 5A) in order to provide a flanking proximal landmark. Probes 157.9 (D4Slll) and 854 (D4S97) reveal identical ll4luI hybridization patterns, a 190 kb and

CANDIDATE

REGION

1117

two additional partially digested fragments of 250 kb and 350 kb (Fig. 5A, Table 1). They hybridize, however, to different NotI- and NruI-digested fragments (Fig. 5A, Table 1). The endfragment c157M/2.8 (D4S226) (Fig. 2) from extension cosmid c157M is separated from probe 157.9 (D4Slll) by three Not1 and two NruI sites (Fig. 2). Hybridization of c157M/ 2.8 (D4S226) shows an identical pattern with 854 (D4S97) in the NotI, MluI, and NruI digests (Fig. 5A, Table 1) indicating that cosmid c157M is oriented toward the centromere and that marker 854 (D4S97), which hybridizes to the same 180-kb Not1 fragment as c157M/2.8, is located within a maximal distance of 180 kb from marker 157.9 (D4Slll). The orientation of the c157M-c157A contig implies that cosmid clB, which was identified by the T7EcoRI endfragment of c157A, represents the first walking step toward the telomere and allowed a unidirectional walk to proceed.

Construction of a High-Resolution Long-Range Restriction Map and Identification of Methyluted and Unmethylated Rare Cutter Sites All the cosmids isolated in this walk were digested with the rare cutters NotI, MluI, and NruI. We identified 11 NotI, 25 MZuI, and 13 NruI sites within the cloned 460 kb contig (Fig. 2). In order to test the methylation status of these rare cutters in genomic DNA we hybridized several DNA markers representing different regions within the contig to PFGE Southern blot filters (Fig. 5A). The probe names and their localization in the contig are shown in Fig. 2 and the sizes for complete and partially digested NotI, MZuI, and NruI fragments are given in Table 1. Using these data, we then constructed a long-range restriction map spanning 1300 kb (Fig. 5B). By comparing the rare cutter restriction map obtained by digesting unmethylated cloned DNA (Fig. 2) to the long-range restriction map constructed from peripheral blood DNA (Fig. 5B), we were able to determine the methylation status of the cytosines in blood DNA occuring in the recognition sites for the NotI, MluI, and NruI enzymes. Seven of 11 NotI, 22 of 25 M&I, and 7 of 13 NruI sites are methylated in blood DNA (Fig. 2, Fig. 5B) and are therefore resistant to digestion by the methylation sensitive rare cutter enzymes.

FIG. 2. Restriction map of 460 kb of contiguously overlapping DNA. The ends of the contig are oriented toward the centromere (4cen) and the telomere (Ipter) of chromosome 4 as indicated and the orientation has been confirmed by pulsed-field gel electrophoresis (see Figs. 5A and 5B). EcoRI restriction sites are marked with a vertical line, the rare cutter sites for Not1 (N), &flu1 (M), NruI (Nr), BssHII (B), EcgI (E), and Sac11 (S) are shown above the solid line. Clusters of rare cutter sites (CpG-rich islands) are boxed. Shaded boxes indicate CpG-rich islands containing unmethylated rare cutter sites in blood DNA (see also Figs. 5A and 5B). Walking cosmids are shown as horizontal lines above the map. Black boxes give the map positions of probes used for PFGE analysis (Fig. 5A), open boxes indicate probes used for zooblot studies (Fig. 7). Probes 157.9 (D4Slll) and 281 (D4S133) have been identified previously (Ref. (10)) and their map position is shown. The scale is in kilobases.

1118

WEBER

ET

AL.

A cl57A

c157c

c157D

-6

-3

-2

FIG. 3. (A) Fingerprint analysis of cosmids c157A, c157C, and c157D with Ah oligomer pDJ34. The cosmid DNA was digested with EcoRI (RI) or double digested with EcoRI plus Not1 (N), BssHII (B), EagI (E), MluI (M), and Sac11 (S). Note that many identical sized fragments are shared indicating major overlapping regions between the three cosmids. (B) Demonstration of a cosmid walking step. The T3 endprobe from cosmid c157A (c157A/3.0) is a 3.0-kb EcoRI-MluI fragment and hybridizes to a 13-kb RI/M fragment from c157M confirming an extension of at least 10 kb. There is no specific hybridization to clB or clD restriction fragments.

By comparing the fragment sizes of the two maps (Fig. 2 and Fig. 5B), four NotI, one MZuI, and three NruI sites, which are unmethylated in blood DNA, are all localized within clusters of other rare cutter enzymes (Fig. 2, shaded boxes). On the other hand, the two MZuI and the three iVru1 restriction sites, which are partially methylated in blood DNA, seem to be outside the clusters of rare cutter enzymes. Probe cllD/7.3 (D4S227) is distal to a cluster of Not1 sites (Fig. 2) and detects a 800-kb Not1 fragment, a 900-kb MZuI fragment, and a partially digested 270kb MZuI fragment (Fig. 5A, Table 1). Probe 281 (D4S133) hybridizes to Not1 and MZuI fragments of similar size (Figs. 5A and 5B) as has been demonstrated previously (Pritchard et al, 1989). In addition, estimates from PFGE analyses have placed the 281 probe about 200 kb distal to 157.9 (D4Slll) (Cox et aZ., 1989). We now show that probe 281 (D4S133) is localized exactly 315 kb distal to 157.9 (D4Slll) (Fig. 2, Fig. 5B). Defining CpG Islands

To determine the presence of CpG-rich islands we digested either the whole cosmids or isolated EcoRI fragments (Fig. 6) with restriction enzymes NotI, MZUI, ZVruI, BssHII, EagI, and S&II, which contain two CpG dinucleotides in their recognition sequences. Figure 6 shows one example of how we determined the presence of CpG-rich islands. A 4.0-kb EcoRI frag-

ment (c3A/4.0) of cosmid c3A was digested with the rare cutter enzymes, separated on an agarose gel (Fig. 6A), and transferred onto a nylon membrane. In a separate experiment, we isolated a 1.2-kb EcoRI-NotI subfragment of c3A/4.0 (c3A/4.ON1.2) and hybridized this probe back to the various restriction digests (Fig. 6B). These data allow the construction of an accurate rare cutter restriction map for the 4.0-kb EcoRI fragment and demonstrate the occurrence of six infrequent cutters within a maximum of 600 bp (Fig. SC). Since it has been estimated that 89% of all Not1 sites occur in CpG-rich islands (Bird, 1986; Lindsay and Bird, 1987), we examined all the fragments that contained a Not1 restriction site. In addition, we also tested the fragments close to the T3- or T7-EcoRI endfragments of the walking clones by hybridizing T3 or T7 oligomers to double-digested cosmid fragments (EcoRI plus each one of the rare cutter enzymes). Digestion with EcoRI separates the insert from the vector DNA but leaves the T3- or T7-bacteriophage promotor sequences attached to the insert providing a sequence target for hybridizations. Thus EcoRI endfragments containing additional rare cutter restriction sites can easily be identified by their altered fragment sizes. We identified a total of 15 CpG-rich islands within the contig (Fig. 2). These islands were defined by the presence of at least three rare cutter enzymes within a maximum of 2.5 kb of DNA. Seven of 15 CpG-rich

COSMID

WALK

IN

A HD

CANDIDATE

1119

REGION

12.0-

3.0 .2.5-

l.O-

0.5 -

regions containing (GT),/(AC),microsatelliies 0 region containing (CCCTAA),repeats FIG. 4. (A) Ethidium bromide-stained EcoRI-digested cosmid DNAs. The 17 cosmids indicated number of overlapping cosmids spanning the 460 kb of contig DNA. The gel from (A) was Southern and hybridized to the oligomer (GT),, (B) and the telomeric repeat (CCCTAA), (C). (D) Schematic from(B) and(C).

islands show an accumulation of several rare cutter enzymes within 700 bp or less (e.g., Fig. 6). The number of islands certainly represents a minimum’ estimate since, as described above, only selected fragments within the cloned DNA were tested. Searchirig for Evolutionarily Conserved Associated with CpG Islunds

Sequences

Once the CpG-rich islands were identified we isolated DNA fragments adjacent to or including these islands (Fig. 2) since many known genes have CpG dinucleotide-rich sequences surrounding their transcription start site (Bird, 1986). To test for potential exonic sequences, we choose an approach that utilizes the fact that sequences coding for functional proteins should be phylogenetically conserved. We, therefore, hybridized our probes under stringent conditions to zoo blots consisting of distantly related vertebrate species. The probes were preannealed with total genomic DNA and hybridized to Southern blots with HincIIdigested genomic DNAs from different vertebrate species including bovine, whale, cat, hamster, rat, quail, and salmon (Fig. 7). All probes tested hybridized to discrete bands in at least two distantly related

(see also Fig. 2) represent the minimum blot transferred onto a nylon membrane illustration of the hybridization results

species. In some instances (e.g., probe c2A/E489 (D4S226) in Fig. 7) the intensity of the hybridization signals in more closely related species such as rat and hamster revealed striking differences in contrast to more distantly related species such as hamster and quail. Despite extensive preannealing with total human genomic DNA some probes (e.g., &E/16 (D4S227) in Fig. 7) showed a strong background hybridization in addition to the discrete bands. DISCUSSION

We have isolated 460 kb of DNA distal to the marker D4Slll in 4~16.3 by chromosome walking using three different cosmid libraries (Fig. 2). PFGE analysis with newly isolated probes from the contig has allowed us to construct a detailed physical longrange restriction map of this region including previously established markers D4S97, D4Sll1, and D4S133 (Fig. 5B). In addition, we have characterized 15 CpG-rich islands within the cloned DNA (Fig. 2) predicting possible locations of genes within this region (Bird, 1986; Lindsay and Bird, 1987). Finally we demonstrated that sequences adjacent to or containing the CpG-rich islands show cross-species conservation (Fig. 7). The characterization of CpG-rich is-

1120

WEBER

ET

AL.

B

Nr

Nr M

ON N

1

‘31M65LM8W t

l-S-27-

-160 (NO (Ml

(Nr) I

c3NI.U

c4NH.O

c7W2.9

cllD/7.3

Nr M N

13% ci57M?2fJ li7.9 c155A11.7 G7.Q

G-cc”)

.05 :

Nr (M) NNI

(NO

046.0

:%I/29

! 35--sD---Me

Nr I

M

281

FIG. 5. (A) High-molecular-weight DNA was digested by the rare cutter enzymes MluI (M), Not1 (N), and NruI (Nr) and electrophoretitally separated by PFGE (Beckman Ins) (upper left). Fragment lengths were sized by comparison to X phage concatamers (dots represent 50-kb intervals) and standard yeast chromosomes (sizes are indicated in megabasepairs). The gel was then transferred onto a nylon membrane and subsequently hybridized to probes as indicated below the respective autoradiogram. The localization of each probe is given in Fig. 2. (B) Schematic interpretation of hybridization patterns shown in (A). The map position of each probe is shown below the solid line and their respective NotI, NruI, and MU restriction fragments are indicated by the horizontal lines. Sizes are in kilobases. Bracketed restriction sites are partially methylated.

lands and the examination of sequences containing these islands for cross-species conservation have previously led to the cloning of several genes (Monaco et TABLE

1

Summary of the MZuI-, NotI-, and NruI-Digested Fragment Sizes (in kb) Determined by PFGE Enzymes Probes

Locus

854

D4S97

MluI

Not1

NruI

(350)

180

320

180

320

n.d.

35

65 90 90

45 180 180

(250) c157M/2.8

(E5)

D4S226

190 (350)

(250) 157.9

D4Slll

190 (350)

(250) c157A/1.7 C3A/7.0 C4N/l.O c7B/2.9

(E6) (E3Dl) (ElN) (E6)

D4S227 D4S227 D4S227 D4S227

cllD/7.3

D4S227

281

D4S133

190) 55 900 (900) 270 900 (900) 270 (900) 270

90 800 800

(180) 90 n.d.

(320) (180) 90

Note. n.d., not detected. ated by partial cleavage.

Parentheses

indicate

fragments

gener-

al., 1986; Page et al., 1987; Sargent et al., 1989, Rommens et a1.,1989; Call et al., 1990, Viskochil et al., 1990). CpG-rich islands were originally reported to be associated with the promotor sequences of “housekeeping” genes (Melton et al., 1984; Reynolds et al., 1984). More recently, however, tissue-specific genes have also been found to be associated with these islands (Rappold et al., 1987; Abe et al., 1988), supporting the usefulness of this approach for defining a broad range of genes. Comparison of the long-range restriction map constructed from peripheral blood DNA (Fig. 5B) to the rare cutter restriction map from cloned DNA (Fig. 2) revealed a significant number of rare cutter sites apparent only in the cloned DNA. This is due to a tissue-specific methylation of cytosine residues in blood DNA that inhibits the digestion by the methylationsensitive rare cutter enzymes. Cloned DNA, however, is unmethylated and offers the advantage of defining all CpG-rich islands. In the search for the gene causing Huntington disease all CpG-rich islands must be regarded as potential sites for candidate genes as it is distinctly feasible that there might be altered methylation patterns in different tissues, which could reflect developmental regulation or genomic imprinting. As has been noted previously (Bucan et al., 1990), the region distal to marker D4SlO is extremely dense in CpG-rich islands. We have identified 15 such islands in the 460-kb contig alone, which reflects a density similar to that described in the HLA region (Sar-

COSMID

WALK

IN

A HD

B z5tmwrn

cxW4.ON1.2

C

mbp

, c3Ai4.ON1.2 FIG. 6. Analysis of a CpG-rich island. A 4.0-kb EcoRI fragment (c3A/4.0, for localization see Fig. 2) was digested with Not1 (N), MluI (M), NruI (Nr), BssHII (B), EagI (E), and Sac11 (S) and separated on a 0.8% agarose gel (A). The gel was then blotted onto a nylon membrane and hybridized with probe c3Al4.ON1.2, an EcoRI-Not1 subfragment of c3A/4.0 (B). The schematic map (C) illustrates the results obtained in (B) and shows that seven rare cutter sites are clustered within a segment of approximately 600 bp. Note that the N, M, and Nr sites have been shown to be unmethylated in blood DNA by PFGE analysis (see Fig. 5B).

gent et al., 1990), the human a-globin locus (FischelGhodsian et aZ., 1987), and a region of human chromosome 3 (Smith et al., 1987) and constitutes another “CpG island archipelago” (Bonetta et al., 1991). The high degree of conservation of sequences adjacent to the CpG-rich islands in the contig suggests that there might be a significant number of most likely small genes within the cloned DNA. The characterization of the cloned DNA with Alu, Line, and telomeric repeats has provided insights into the structural organization of DNA in this region. Korenberg and Ryowski (1988) have previously shown that AZu and Line sequences are unevenly distributed with Alu repeats seen mainly in Giemsa light or R bands, whereas Line sequences were found predominantly in Giemsa dark bands. Our results are in full agreement with these findings as the cloned DNA localized within the Giemsa light band in 4~16.3 contained a very high density of Alu repeats and no detectable hybridization to a Line consensus oligomer.

CANDIDATE

1121

REGION

It is noteworthy that one fragment in the 460-kb contig showed strong hybridization to the telomeric repeat (CCCTAA),. Laird (1990) has recently proposed a model for the genetic basis of Huntington disease based on a phenomenon known in Drosophila melanogaster as dominant position-effect variegation. Essentially, the HD mutation would be the result of a chromosome alteration that creates a novel association of euchromatic genes with centromeric, telomerit, or facultative heterochromatin that would cisinactivate a nearby structural gene. Somatic pairing of the homologous chromosomes in some cells would then tram-inactivate the wild-type HD gene on the normal homolog, resulting in complete dominance of the mutation. The presence of telomeric sequences in a candidate region for the HD gene could be seen as support of Laird’s hypothesis. However, this finding is more likely to be a chance association as the cosmid clones were derived from normal human DNA. Furthermore, telomeric repeats have now been shown to occur in internal loci of other chromosomes (Weber et aZ., 1991). Telomeric repeats have not yet been demonstrated as a causative factor in a human genetic disease. Factors predisposing to a high mutation rate for a gene are the size of the coding sequence and the DNA composition of the gene. In general, large genes are

C2lvE489

clOS/14

cl 57N5.5

cllDl3.9

cw4.Q

c26Hil

c5E/l6

Cl6DP/10.8

of conserved sequences by cross-species hyFIG. 7. Detection bridization. Genomic DNA samples from the indicated vertebrate species were digested with HincII, separated by electrophoresis, and blotted onto nylon membranes. Hybridization and washing conditions were performed under highly stringent conditions as given under Materials and Methods. The map position of each probe is shown in Fig. 2.

1122

WEBER

more likely to have higher mutation rate as has been shown for Duchenne muscular dystrophy (Koenig et al., 1987) and neurofibromatosis I (Wallace et aZ., 1990). The likely presence of many small genes in 4~16.3 and the very low mutation rate for HD (Hayden, 1981) might suggest that the coding region for the HD gene is small. How would this concept for the HD gene be reconciled with the contradictory genetic data (Fig. l)? Theoretically a small coding region of a gene can either map entirely to a small genomic fragment or encompass a large genomic distance with large introns even in the range of megabases situated between small exons. In addition these exons could be separated by other unrelated nested genes. Independant mutations in different exons of the gene could be dispersed over a large genomic region giving rise to recombinations with the observed conflicting data regarding the positioning of the gene. One might also expect to see linkage disequilibrium between the HD phenotype and genetic markers that are separated by megabases of DNA yet close to coding sequences for the HD gene. In contrast there might be no evidence for nonrandom association with markers between these exonic sequences. The occurrence of nested genes (Levinson et al., 1990; Wallace et al., 1990,) and genes with very large introns (Koenig et al., 1987) certainly have a precedent in human genetics. The region between DNA marker D4SlO and the 4p telomere has been determined by PFGE analysis to be between 5 and 6 Mbp (Bucan et cd., 1990). A more detailed regional map estimated the distance between D4Slll and D4S133 to approximately 200 kb (Cox et al., 1989; Pritchard et al., 1989). Our results now show that this distance is 315 kb, which had been significantly underestimated using PFGE. It is distinctly possible that the estimated long-range distances in other candidate regions in 4~16.3 have also been underestimated. An increase in the sizes of DNA fragments in candidate regions would have important implications and will delay the speed at which the entire region can be assessed for candidate genes. The cloning and characterization of one of the candidate regions for the HD gene have allowed us to predict possible locations of genes for further analysis. It also allows the identification of polymorphic DNA markers that might be useful for the analysis of families with known recombinants and for linkage disequilibrium studies with the goal to refine the location and eventually clone the HD gene.

ET

AL. Department of Energy. We thank J. Gusella and the Huntington Disease collaborative group for the probe 157.9 and D. Cox and R. Myers for probe 281. This research is supported by grants from MRC-Canada and the Canadian Genetic Disease Network. M. R. Hayden is an established investigator of the Children’s Hospital of BC. B. Weber was supported by the Deutsche Forschungsgemeinschaft (We 1259/1-l). Colin Collins is a predoctoral scholar of the Huntington Society of Canada and 0. Riess is an MRC visiting scientist.

REFERENCES 1.

2.

3.

BATES, G. P., MACDONALD, M. E., BAXENDALE, S., SEDLACEK, Z., YOUNGMAN, S., ROMANO, D., WHALEY, W. L., ALLI?TO, B. A., POUSTKA, A., GUSELLA, J. F., AND LEHRACH, H. (1990). A yeast artificial chromosome telomere clone spanning a possible location of the Huntington’s disease gene. Am. J. Hum. Genet. 46: 762-775.

4.

BIRD, A. P. (1986). CpG-rich islands and the function of DNA methylation. Nature 321: 209-213. BIRNEIOIM, H. C., AND DOLY, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic AcidsRes.7: 1513-1523. BONETTA, L., KUEHN, S. E., HUANG, A., LAW, D. J., KALWN, L. M., DOI, M., REEVE, A. E., BROWNSTEXN, B. H., YEGER, H., WILLIAMS, B. R. G., AND FEINBERG, A. P. 0. (1991). Wilma tumor locus on 11~13 defined by multiple CpG island-associated transcripts. Science 250: 994-997.

5.

6.

7.

BUNCAN, M., ZIMMER, M., WHALEY, W. L., POUSTKA, A., YOUNGMAN, C., ALLI?TO, A., ORMANDROYD, E., SMITH, M., POHL, T. M., MACDONALD, M., BATES, G. P., RICHARDS, J., VOLINIA, S., GILLIAM, T. C., SEDLACEK, Z., COLLINS, F. S., WASMUTH, J. J., SHAW, D. J., GUSELLA, J. F., FRISCHAIJF, A. M., AND LEHRACH H. (1990). Physical maps of 4p16.3, the area expected to contain the Huntington disease mutation. Genomics 6: l-15.

8.

CALL, K. M., GLASER, TIER, J., HABER, D. LEWIS, W. H., JONES, tion and characterization the human chromosome 520. CHURCH, G. M., AND ing. Proc. Natl. Acad.

9. 10.

11.

ACKNOWLEDGMENTS The chromosome 4-specific library used in this work was constructed at the Human Genome Center, Los Alamos National Laboratory, Los Alamos, NM 87545, under the auspices of the U.S.

ABE, K., WEI, J-F., WEI, F-S., Hsu, Y-C., UEHARA, H., ARTZT, K., AND BENNETT, D. (1988). Search for coding sequences in the mammalian genome: The H-2K region of the mouse MHC is replete with genes expressed in embryos. EMBO J. 7: 3441-3449. ADAM, S., THEILMANN, J., BUETOW, K., HEDRICK, A., COLLINS, C., WEBER, B., HUGGINS, M., AND HAMEN, M. (1991). Linkage disequilibrium and modification of risk for Huntington’s disease. Am. J. Hum. Genet. 48: 595-603.

12.

T., ITO, C. Y., BUCKLER, A. J., PELLEA., ROSE, E. A., KRAL, A., YEGER, H., C., AND HOUSMAN, D. E. (1990). Isolaof a zinc finger polypeptide gene at 11 Wilma’ tumor locus. CeU 60: 509GILBERT, W. (1984). Genomic Sci. USA 81: 1991-1995.

sequenc-

Cox, D. R., MURRAY, J. C., AND BUETOW, K. H. (1989). Tenth International Workshop on Human Gene Mapping. Report of the committee of the genetic constitution of chromosome 4. Cytogenet Cell Genet. 51: 121-136. DOGGE~T, N. A., CHENG, J. F., SMITH, C. L., AND CANTOR, C. R. (1989). The Huntington disease locus is most likely within 325 kilobases of the chromosome 4p telomere. Proc. Natl. Acad. Sci. USA 86: lO,Oll-10,014. FEINBERG, technique

A. P., AND VOGELSTEIN, for radiolabelling DNA

B. (1984). restriction

Addendum: endonuclease

A

COSMID

13.

14.

15.

16.

17. 18.

19.

20.

21.

22.

23. 24. 25.

26.

WALK

IN A HD CANDIDATE

fragments to high specific activity. Anal. Biochem. 137: 266267. FISCHEL-GHODSIAN, N., NICHOLLS, R. D., HIGGS, D. R. (1987). Unusual features of CpG-rich (HTF) islands in the human cY-globin complex: Association with nonfunctional pseudogenes and presence within the 3’ portion of the { gene. Nucleic Acids Res. 15: 9215-9225. GILLIAM, T. C., TANZI, R. E., HAINES, J. L., BONNER, T. I., FARYNIAR& A. G., HOBBS, W. J., MACDONALD, M. E., CHENG, S. V., FOLSTEIN, S. E., CONNEXLY, P. M., WEXLER, N. S., AND GUSELLA, J. F. (1987a). Localization of the Huntington’s disease gene to a small segment of chromosome 4 flanked by D4SlO and the telomere. Cell 50: 565-571. GILLIAM, T. C., BUCAN, M., MACDONALD, M. E., ZIMMER, M., HAINES, J. L., CHENG, S. V., POHL, T. M., MEYERS, R. H., WHALEY, W. L., A~~rrro, B. A., FARYNIARZ, A., WASMUTH, J. J., FRISCHAUF, A-M., CONNEALLY, P. M., LEHRACH, H., AND GUSELLA, J. (198713). A DNA segment encoding two genes very tightly linked to Huntington’s disease. Science 238: 950-952. GUSELLA, J. F., WE-R, N. S., CONNEALLY, P. M., NAYLOR, S. I., ANDERSON, M. A., TANZI, R. E., WATKINS, P. C., OTTINA, K., WALLACE, M. R., SAKAGUCHI, A. Y., YOUNG, A. B., SHOULSON, I., BONILLA, E., AND MARTIN, J. B. (1983). Apolymorphic DNA marker genetically linked to Huntington’s disease. Nature (London) 306: 234-238. HAYDEN, M. R. (1981). “Huntington’s Chorea,” SpringerVerlag, New York. HERRMANN, B. G., BARLOW, D. P., AND LEHRACH, H. (1987). A large inverted duplication allows homologous recombination between chromosomes heterozygous for the proximal tcomplex inversion. Cell 48: 813-825. IKONEN, E., PALO, J., OTT, J., GUSELLA, J., SOMER, H., KARILA, L., PALOTIE, A., AND PELTONEN, L. (1990). Huntington disease in Finland: Linkage disequilibrium of chromosome 4 RFLP haplotypes and exclusion of a tight linkage between the disease and D4S43 locus. Am. J. Hum. Genet. 46: 5-11. KOENIG, M., HOFFMAN, E. P., BERTELSON, C. J., MONACO, A. P., FEENER, C., AND KUNKEL, L. M. (1987). Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell 50: 509-517. KORENEIERG,J. R., AND RYKOWSKI, M. C. (1988). Human genome organization: Alu, Lines and the molecular structure of metaphase chromosome bands. Cell 53: 391-400. KUNKEL, L. M., SMITH, K. D., BOYER, S. H., BORGAONKAR, D. S., WACHTEL, S. S., MILLER, 0. J., BREG, W. R., JONES, H. W., AND RARY, J. M. (1977). Analysis of human Y chromosome specific reiterated DNA in chromosome variants. Proc. Natl. Ad. Sci. USA 74: 1245-1249. LAIRD, C. D. (1990). Proposed genetic basis of Huntington’s disease. Trends Genet. 6: 242-247. LEVINSON, B., KENWRICK, S., LAKICH, D., HAMMONDS, G., AND GITSCHIER, J. (1990). A transcribed gene in en intron of the human factor VIII gene. Genomics ‘7: l-11. LINDSAY, S., AND BIRD, A. P. (1987). Use of restriction enzymes to detect potential gene sequences in mammalian DNA. Nature 327: 336-338. MACDONALD, M. E., ANDERSON, M. A., GILLIAM, T. C., TRANEBJAEXG, L., CARPENTER, N. J., MAGENIS, R. E., HAYDEN, M. R., HEALEY, S. T., BONNER, T. I., AND GUSELLA, J. F. (1987). A somatic cell hybrid panel for localizing DNA segments near the Huntington’s disease gene. Genomics 1: 2934.

REGION

1123

27. MACDONALD, M. E., CHEN, S. V., ZIMMER, M., HAINE.S, J. S., POUSTKA, A. M., ALLITTO, B. A., SMITH, B., WHALEY, W. L., ROMANO, D., JAGADEESH, J., LEHRACH, H., WASMIJTH, J. J., FRISCHAUF, A-M., AND GUSELLA, J. F. (1989a). Clustering of multi-allelic DNA markers near the Huntington’s disease gene. J. Clin. Invest. 84: 1013-1015. 28. MACDONALD, M. E., HAINES, J. L., ZIMMER, M., CHENG, S. V., YOUNGMAN, S., WHALEY, W. L., WEXLF.R, N., BUCAN, M., ALLI?TO, B. A., SMITH, B., LEAVE, J., POUSTKA, A., HARPER, P., LEHRACH, H., WASMUTH, J. J., FRISCHAUF, A-M., AND GUSELLA, J. F. (1989b). Recombination events suggest potential sites for the Huntington’s disease gene. Neuron 3: 183-190. 29. MAGENIS, R. E., GUSELLA, J., WELIKY, K., OLSON, S., HAIGHT, G., TOTH-FEJEL, S., AND SI-IEXHY, R. (1986). Huntington disease-linked restriction fragment length polymorphism localized within band ~16.1 of chromosome 4 by in situ hybridization. Am. J. Hum. Genet. 39: 383-391. 30. MELTON, D. W., KONECKI, D. S., BENNAND, J., AND CASKEY, C. T. (1984). Structure, expression, and mutation of the hypoxanthine phosphoribosyltransferase gene. Proc. Natl. Acad. Sci. USA 81: 2147-2151. 31. MONACO, A. P., NEVE, R. L., COL~I-FENNER, C., BERTELSON, C. J., KURNIT, D. M., AND KIJNKEL, L. M. (1986). Isolation of candidate cDNAs for portions of the Duchenne muscular dystrophy gene. Nature 323: 636-650. 32. NAKAMUFZA, Y., LEPPERT, M., O’CONNELL, P., WOLFF, R., HOLM, T., CULVER, M., MARTIN, C., F~JIMOTO, E., How, M., KUMLIN, E., AND WHITE, R. (1987). Variable number of tandem repeat (VNTR) markers for human gene mapping. Science 235: 1616-1622. 33. NAKAMURA, Y., CULVER, M., O’CONNELL, P. O., LEPPERT, M., LATHROP, G. M., LALOUEL, J-M., AND WHITE, R. (1988). Isolation and mapping of a polymorphic DNA sequence (pYNZ32) on chromosome 4p (D4S125). Nucleic Acids Res. 16: 4186. 34. PAGE, D. C., MOSHER, R., SIMPSON, E. M., FISHER, E. M. C., MARDON, G., POLLACK, J., MCGILLNRAY, B., DE LA CHAPELLE, A., AND BROWN, L. G. (1987). The sex-determining region of the human Y chromosome encodes a finger protein. Cell 51: 1091-1104. 35. POHL, T. M., ZIMMER, M., MACDONALD, M. E., SMITH, B., BUCAN, M., POUSTKA, A., VOLINIA, S., SEARLE, S., ZEHETNER, G., WASMUTH, J. J., GUSELLA, J., LEHRACH, H., AND FRISCHAUF, A-M. (1988). Construction of a Not1 linking library and isolation of new markers close to the Huntington’s disease gene. Nucleic Acids Res. 16: 9185-9198. 36. PRITCHARD, C. A., CASHER, D., UGLUM, E., Cox, D. R., AND MYERS, R. M. (1989). Isolation and field inversion gel electrophoresis analysis of DNA markers located close to the Huntington’s disease gene. Genomics 4: 408418. 37. PRITCHARD, C. A., CASHER, D., BULL, L., Cox, D. R., AND MYERS, R. M. (1990). A cloned DNA segment from the telomerit region of human chromosome 4p is not detectably rearranged in Huntington disease patients. Proc. Natl. Acad. Sci. USA 87: 7309-7313. 38. RAPPOLD, G. A., STUBBS, L., LABEIT, S., CRKVENJAKOV, R. B., ANII LEHRACH, H. (1987). Identification of a testis-specific gene from the mouse t-complex next to a CpG-rich island. EMBO J. 6: 1975-1980. 39. REYNOLDS, G. A., BASU, S. K., OSBORNE, T. F., CHIN, D. J., GIL, G., BROWN, M. S., GOLDSTEIN, J. L., AND LUSKEY, K. L. (1984). HMG CoA reductase: A negatively regulated gene with unusual promoter and 5’ untranslated regions. Cell 38: 275-285.

1124

WEBER

40. RICHARDS, J. E., GILLIAM, C. T., COLE, J. L., DRUMM, M. L., WASMUTH, J. J., GUSELLA, J. F., AND COLLINS, F. S. (1988). Chromosome jumping from D4SlO (G8) towards the Huntington disease gene. Proc. Natl. Acad. Sci. USA 85: 64376441. 41. ROBBINS, C., THEILMANN, J., YOUNGMAN, S., HAINES, J., ALTHERR, M. J., HARPER, P. S., PAYNE, C., JUNKER, A., WASMUTH, J., AND HAYDEN, M. R. (1989). Evidence from family studies that the gene causing Huntington’s disease is telomerit to D4S95 and D4S90. Am. J. Hum. Genet. 44: 422-425. 42. ROMMENS, J. M., IANNUZZI, M. C., KEREM, B-S., DRUMM, M. L., MELMER, G., DEAN, M., ROZMAHEL, R., COLE, J. L., KENNEDY, D., HIDAKA, N., ZSIGA, M., BUCHWALD, M., RIORDAN, J. R., TSUI, L-C., AND COLLINS, F. S. (1989). Identification of the cystic fibrosis gene: Chromosome walking and jumping. Science 245: 1059-1065. 43. SAMBROOK, J., FRITSCH, E. F., AND MANIATIS, T. (1989). “Molecular Cloning: A Laboratory Manual,” 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 44. SARGENT, C. A., DUNHAM, I., AND CAMPBELL, R. D. (1989). Identification of multiple HTF-island associated genes in the human major histocompatability complex class III region. EMBO J. 8: 2305-2312. 45. SIMMLER, M. C., JOHNSSON, C., PETIT, C., ROUYER, F., VERGNAUD, G., AND WEISSENBACH, J. (1987). Two highly polymorphic minisatellites from the pseudoautosomal region of the human sex chromosomes. EMBO J. 6: 963-969. 46. SKRAASTAD, M. I., BAKKER, E., DE LANGE, L. K., VEGTER VAN DER VLIS, M., KLEIN-BRETELER, E. G., VAN OMMEN, G. J. E., AND PEARSON, P. L. (1989a). Mapping of recombinants near the Huntington disease locus and newly isolated markers in the D4SlO region. Am. J. Hum. Genet. 44: 560566. 47. SKRAASTAD, M. I., VERWEST, A., DE ROOLJ, K. E., VEGTER VAN DER VLIS, M., BAKKER, E., GUSELLA, J. F., COLLINS, F. S., WASMUTH, J. J., HARPER, P. S., FRISCHAUF, A-M., NAKAMURA, Y., VAN OMMEN, G. J. B., AND PEARSON, P. L. (1989b). Order of DNA markers near the Huntington locus by multipoint recombination mapping [A2637]. Cytogenet. Cell Genet. 51: 1081. 48. SMITH, B., SKARECKY, D., BENGTSSON, U., MAGENIS, R. E., CARPENTER, N., AND WASMUTH, J. J. (1988). Isolation of DNA markers in the direction of the Huntington disease gene from the G8 locus. Am. J. Hum. Genet. 42: 335-344. 49. SMITH, D. I., GOLEMBIESKI, W., GILBERT, J. D., KIZYMA, L., AND MILLER, 0. J. (1987). Overabundance of rare-cutting restriction endonuclease sites in the human genome. Nucleic Acids Res. 15: 1173-1184. 50. SNELL, R. E., LAZAROUS, L., YOUNGMAN, S., QUARRELL, 0. W. J., WASMUTH, J. J., SHAW, D. J., AND HARPER, P. S. (1989a). Linkage disequilibrium in Huntington’s disease: an improved localization for the gene. J. Med. Genet. 28: 673675. 51. SNELL, R. G., YOUNGMAN, S., LEHRACH, H., SARFARAZI, M., HARPER, P. S., AND SHAW, D. J. (198913). A new probe (2R3) in the region of Huntington’s disease gene [A2621]. Cytogenet. Cell Genet. 51: 1083. 52. SOUTHERN, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 9s: 503-517. 53. THEILMANN, J., KANANI, S., SHIANG, R., ROBBINS, C.,

ET AL.

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

QUARRELL, O., HUGGINS, M., HEDRICK, A., WEBER, B., COLLINS, C., WASMUTH, J., BUETOW, K. H., MURRAY, J. C., AND HAYDEN, M. R. (1989). Non random association between alleles detected at D4S95 and D4S98 and the Huntington’s disease gene. J. Med. Genet. 26: 676-681. VASSART, G., GEORGES, M., MONSIEUR, R., BROCAS, H., LEQUARRE, A. S., AND CHRISTOPHE, D. (1987). A sequence in Ml3 phage detects hypervariable minisatellites in human and animal DNA. Science 235: 683-684. VISKOCHIL, D., BUCHBERG, A. M., Xv, G., CAWTHON, R. M., STEVENS, J., WOLFF, R. K., CULVER, M., CAREY, J. C., COPELAND, N. G., JENKINS, N. A., WHITE, R., AND O’CONNELL, P. (1990). Deletions and a translocation interrupt a cloned gene at the neurofibromatosis type 1 locus. Cell 62: 187-192. VONSA~EL, J-P., MYERS, R. H., STEVEN, T. J., FERRANTE, R. J., BIRD, E. D., AND RICHARDSON, E. P. (1985). Neuropathological classification of Huntington’s disease. J. Neuropathol. Exp. Neural. 44: 559-577. WALLACE, M. R., MARCHUK, B. A., ANDERSON, C. B., LETCHER, R., ODEH, H. M., SAULINE, A. M., FOUNTAIN, J. W., BRERETON, A., NICHOLSON, J., MITCHELL, A. L., BROWNSTEIN, B. N., AND COLLINS, F. S. (1990). Type 1 neurofibromatosis gene: Identification of a large transcript disrupted in three NFl patients. Science 249: 181-186. WANG, H. S., GREENBERG, C. R., HERMIT, J., KALOUSEK, D., AND HAYDEN, M. R. (1986). Subregional assignment of the linked marker G8 (D4SlO) for Huntington’s disease to chromosome 4~16.1-16.3. Am. J. Hum. Genet. 3: 392-396. WASMUTH, J. J., HEWI~, J., SMITH, B., ALLARD, D., HAINES, J. L., SKARECKY, D., PARTLOW, E., AND HAYDEN, M. R. (1988). A highly polymorphic locus very tightly linked to the Huntington’s disease gene. Nature 322: 734-736. WEBER, B., ALLEN, L., MAGENIS, R. E., GOODFELLOW, P. J., SMITH, L., AND HAYDEN, M. R. (1991). Intrachromosomal location of the telomeric repeat (TTAGGG),. Mammalian Genome, 1: 211-216. WHALEY, W. L., MICHIELS, F., MACDONALD, M. E., R.OMANO, D., ZIMMER, M., SMITH, B., LEAVITT, J., BUCAN, M., HAINES, J., GILLIAM, T. C., ZEHETNER, G., SMITH, C., CANTOR, C. R., FRISCHAUF, A. M., WASMUTH, J. J., LEHRACH, H., AND GuSELLA, J. F. (1988). Mapping of D4S98/S114/S113 confines the Huntington’s defect to a reduced physical region at the telomere of chromosome 4. Nucleic Acids Res. 16: 1176911780. WHALEY, W. L., BATES, G. P., NOVELLEKKO, A., SH)LACEK, Z., CHENG, S., ROMANO, D., ORMONDROYD, E., A~~rrro, B., LIN, C., YOUNGMAN, S., BAXENDALE, S., BUCAN, M., ALTHERR, M., WASMUTH, J., WEXLER, N. S., FRONTALI, M., FFUSCHAUF, A. M., LEHRACH, H., MACDONALD, M. E., ANLI GuSELLA, J. F. (1991). Mapping of cosmid clones in Huntington’s disease region of chromosome 4. J. Cell Mol. Genet. 17: 83-91. YOUNGMAN, S., SHAW, D. J., GUSELLA, J. F., MACDONALD, M. E., STANBRIDGE, E. J., WASMUTH, J. J., AND HARPER, P. S. (1988). A DNA probe, D5 (D4S90), mapping to human chromosome 4~16.3. Nucleic Acids Res. 16: 1648. YOUNGMAN, S., SARF~I, M., BUCAN, M., MACDONALD, M., SMITH, B., ZIMMER, M., GILLIAM, C., FTUSCHAIJF,A-M., WASMUTH, J. J., GUSELLA, J. F., LEHRACH, H., HARP% P., AND SHAW, D. (1989). A new DNA marker [D4S90] is located terminally on the short arm of chromosome 4, close to the Huntington’s disease gene. Genomics 5: 892-809.