Molecular Microbiology (1992) 6(23), 3595-3602
Identification of functional c/s-acting sequences involved in regulation of narKgene expression in Escherichia coii Violaine Bonnefoy^ and John A. DeMoss* Department of Biochemistry and Molecular Biology, University of Texas tAedical School at Houston. 6431 Fannin, Houston, Texas 77030, USA. Summary Expression of the narK gene of Escherichia coli, like the narGHJI operon, is positively regulated by two frans-acting factors: Fnr, which is activated by anaerobic conditions, and NarL, which is activated by the presence of nitrate. Unlike the narGHJI opexon, the 5' untranslated region of the r^arK gene contains two putative Fnr-binding-site sequences and two putative NarL-binding-site sequences. To define the role of these putative c/s-acting regions, transcription start sites were identified and the effects of promoter region modifications on transcription were determined. Primer extension analysis identified several transcripts for the nar/C gene expressed from ptasmids. Expression from the major promoter, P I , was induced by anaerobic growth conditions and further elevated in the presence of nitrate, while that from a weaker promoter, P2, appeared to be constitutive. The position of the major transcription start site placed one of the putative Fnr-binding sites (Fnr1 box) and one of the NarL-binding sites (NarL2 box) at positions anaiogous to those previously established for the narGHJI operon promoter region, while the other two binding sites were located in the nonhomologous 150 bp sequence which separates the Fnr1 and NarL2 boxes. Based on the effects of selective 5' deletions and site-directed modifications, Fnrdependent expression was dependent only on the Fnr1 box and nitrate stimulation was dependent on the presence of the NarL2 box. In the absence of the NarL2 box, the NarLI box did not promote stimulation by nitrate. The Fnr2 box was not required for anaerobic induction of expression but its modification appeared to reduce the level of stimulation by nitrate.
Received 13 July, 1992; revised 28 August, 1992; accepted 31 August, 1992 tOn leave from: Laboratoire de Chimie Bacterienne, CNRS, Marseille, France. *For correspondence. Tel. (713) 792 5600; Fax (713) 794 4150.
Introduction The expression of respiratory nitrate reductase in Escherichia cotiis regulated at the level of transcription by two pleiotropic rrans-acting factors, Fnr and NarL (Stewart, 1982). The control of expression by these two transacting factors serves to integrate the regulation of expression of the narGHJi operon, encoding nitrate reductase, into a hierarchical control of pathways involved in energy production in E. coli Fnr, activated at low oxidationreduction potential (Unden et ai, 1990), represses the expression of several enzymes involved in oxygendependent respiration (Spiro et ai, 1989; Cotter et ai, 1990) but induces the expression of a number of enzymes, including nitrate reductase, which are involved in anaerobic respiration pathways utilizing alternate electron acceptors (Lambden and Guest, 1976; Chippaux et ai, 1981; Jones and Gunsalus, 1987). NarL, activated in the presence of nitrate, modulates the pattern of anaerobic gene expression by inducing further the Fnr-dependent expression of formate dehydrogenase N (Berg and Stewart, 1990) and nitrate reductase (Stewart, 1982; Stewart and Parales, 1988) and by repressing the expression of the gene which encodes the fermentative enzyme alcohol dehydrogenase {Kalman and Gunsalus, 1988) as well as reductases for alternative electron acceptors, such as dimethylsulphoxide and fumarate (luchi and Lin, 1987; Cotter and Gunsalus, 1989), whose reductions are characterized by tower oxidation-reduction potentials. The modulation of transcription of the narGHJi operon by two independently activated ^rans-acting factors has been shown to be dependent on distinct c/s-acting regions adjacent to the narGHJI promoter (Li and DeMoss, 1988). An Fnr box, centred at -4^ .5 bp from the transcription start site, corresponds to a consensus Fnrbinding sequence (Spiro and Guest, 1987; Eiglmeier et ai, 1989; Jayaraman etai, 1989), and through interaction with Fnr appears to replace the function of a -35 region in the initiation of transcription (Walker and DeMoss, 1992). The c/s-acting sequence required for transcription activation by NarL is located approximately 150bp further upstream from the Fnr box (Li and DeMoss, 1988) and interaction with NarL appears to activate transcription by a mechanism which can operate in the absence of Fnr (Bonnefoy et ai, 1986: Walker and
3596
V. Bonnefoy and J. A. DeMoss -150
NarL narG
tggggaaTACTCCTTAatacccatctgcataaaaatcttaatagtttaaataactacaggtataaaa
narK
gaaagagtTRCTCCTTAtttgccgtgtggttagtcgctttacatcggtaagggtagggattttacag NarL2 P2
narG
-100 I cgtcttaatttacagtctgttatgtggtggctgttaattatcctaaaggggtatcttaggaatttac
narK
caccgtgaaaaatctcataatttttatGaagtcactgTACTCACTAtgggtaATGATaaatATCAAt P2 2 NarLI Fnr2
narG
tttatttttcatccccatcactc^TGATcgttKICRAttcccacgctgtttcagagcgttacctCgcc
narK
qataqataaaqttatcttatcgtTTGATttacATCftAattgcctttagctacagacactaaggtggca
Fnrl
narG
cttAaacattagcaatgtcg
nar K
gacAtcgaaaegagtateag 1
PI
DeMoss. 1992). In some undetermined way. the interactions of these two frans-acting factors with their specific c/s-acting regions are integrated into the mechanism of activation of transcription of the narGHJ/operon. To explore the possible mechanisms involved in the integrated transcriptional activation by Fnr and NarL we have extended our studies to the c/s-acting regions required for expression of the narKgene, which encodes another component involved in nitrate respiration, a nitrate-nitrite antiporter (Noji et ai, 1989; DeMoss and Hsu, 1991). Expression of narK, like that of narGHJI, is positively regulated by Fnr and NarL (Stewart and Parales, 1988) and examination of the putative narK promoter region (Noji etai, 1989) reveals several interesting features. Putative Fnr and NarL boxes (Fnrl and NarL2, Fig. 1), identical to those in the narGHJI operon, are separated by a similar length of apparently unrelated sequence. Inspection of the narK sequence also reveals an additional putative Fnr box (Fnr2, Fig. 1) and an additional putative NarL box (NarLI, Fig. 1). In order to compare the activation by Fnr and NarL of the narK and narGHJ/promoters, we have characterized here the transcription start site and the function of the putative c/s-aoting elements in the activation of transcription of the narK promoter.
Results The construction of the plasmids and strains utilized in these studies is described in the Experimental Procedures. Most of the plasmids were derived from piasmid pRSIO, which contains an intact narK gene, and piasmid pMV45, which contains the pBR322 and M13 origins of
Fig. 1. Comparison of the 5' untranslated regions of the narKgene and the narGHJ/operon. The sequences were aligned with the major transcription start sites for the narGHJ/operon (Walker and DeMoss, 1991) and the narKgene (identified in this work). For the narGHJ/operon. the transcription start site (1), the oorresponding-10 and -35 sequences (P) and the Fnr and NarL box sequences are labelled above the sequence. For the narKgene, the two transcription start sites identified in this study (1 and 2) and the putative -10 and -35 sequences as well as the multiple putative Fnr and NarL box sequences are labelled below the sequence.
PI
replication and the narK gene fused in frame to the iacZ gene so that regulation of the narK promoter could be followed by assaying the levels of p-galactosidase formed. At high copy number in strain MV1190, expression of the narK-lacZ fusion on piasmid pMV45 was suppressed under aerobic conditions, induced by anaerobic conditions, and increased under both conditions by the presence of nitrate {data not shown). The expression of the fusion gene was similarly regulated (Table 1) when the piasmid was grown in strain RK66P [Mac, narKy.JniO, pcnB) to avoid possible autoregulation of narK and possible gene dosage effects, since in a pcnB background pBR322 derivatives have a copy number of two to three per cell (Lopilato etai, 1986).
Table 1. Expression of narK:./acZfusion plasmids at low copy number in strain RK66P. p-Galactosidase (Miller Units)
Piasmid pMV45 pMV50 pUV53 pMV54 pMV55 pMV51 pMV52 pVBI pVB2 pVB3
aerobio + nitrate
anaerobic
anaerobic + nitrate
1 1 1 5 1 0 1
9 4 122 11 2 0 2
120 95 90 150 80 17 95
1770 1830 1390 1550 104 19 1070
6
Identification of functional c/s-acting sequences involved in regulation of narKgene expression in Escherichia coii Violaine Bonnefoy^ and John A. DeMoss* Department of Biochemistry and Molecular Biology, University of Texas tAedical School at Houston. 6431 Fannin, Houston, Texas 77030, USA. Summary Expression of the narK gene of Escherichia coli, like the narGHJI operon, is positively regulated by two frans-acting factors: Fnr, which is activated by anaerobic conditions, and NarL, which is activated by the presence of nitrate. Unlike the narGHJI opexon, the 5' untranslated region of the r^arK gene contains two putative Fnr-binding-site sequences and two putative NarL-binding-site sequences. To define the role of these putative c/s-acting regions, transcription start sites were identified and the effects of promoter region modifications on transcription were determined. Primer extension analysis identified several transcripts for the nar/C gene expressed from ptasmids. Expression from the major promoter, P I , was induced by anaerobic growth conditions and further elevated in the presence of nitrate, while that from a weaker promoter, P2, appeared to be constitutive. The position of the major transcription start site placed one of the putative Fnr-binding sites (Fnr1 box) and one of the NarL-binding sites (NarL2 box) at positions anaiogous to those previously established for the narGHJI operon promoter region, while the other two binding sites were located in the nonhomologous 150 bp sequence which separates the Fnr1 and NarL2 boxes. Based on the effects of selective 5' deletions and site-directed modifications, Fnrdependent expression was dependent only on the Fnr1 box and nitrate stimulation was dependent on the presence of the NarL2 box. In the absence of the NarL2 box, the NarLI box did not promote stimulation by nitrate. The Fnr2 box was not required for anaerobic induction of expression but its modification appeared to reduce the level of stimulation by nitrate.
Received 13 July, 1992; revised 28 August, 1992; accepted 31 August, 1992 tOn leave from: Laboratoire de Chimie Bacterienne, CNRS, Marseille, France. *For correspondence. Tel. (713) 792 5600; Fax (713) 794 4150.
Introduction The expression of respiratory nitrate reductase in Escherichia cotiis regulated at the level of transcription by two pleiotropic rrans-acting factors, Fnr and NarL (Stewart, 1982). The control of expression by these two transacting factors serves to integrate the regulation of expression of the narGHJi operon, encoding nitrate reductase, into a hierarchical control of pathways involved in energy production in E. coli Fnr, activated at low oxidationreduction potential (Unden et ai, 1990), represses the expression of several enzymes involved in oxygendependent respiration (Spiro et ai, 1989; Cotter et ai, 1990) but induces the expression of a number of enzymes, including nitrate reductase, which are involved in anaerobic respiration pathways utilizing alternate electron acceptors (Lambden and Guest, 1976; Chippaux et ai, 1981; Jones and Gunsalus, 1987). NarL, activated in the presence of nitrate, modulates the pattern of anaerobic gene expression by inducing further the Fnr-dependent expression of formate dehydrogenase N (Berg and Stewart, 1990) and nitrate reductase (Stewart, 1982; Stewart and Parales, 1988) and by repressing the expression of the gene which encodes the fermentative enzyme alcohol dehydrogenase {Kalman and Gunsalus, 1988) as well as reductases for alternative electron acceptors, such as dimethylsulphoxide and fumarate (luchi and Lin, 1987; Cotter and Gunsalus, 1989), whose reductions are characterized by tower oxidation-reduction potentials. The modulation of transcription of the narGHJi operon by two independently activated ^rans-acting factors has been shown to be dependent on distinct c/s-acting regions adjacent to the narGHJI promoter (Li and DeMoss, 1988). An Fnr box, centred at -4^ .5 bp from the transcription start site, corresponds to a consensus Fnrbinding sequence (Spiro and Guest, 1987; Eiglmeier et ai, 1989; Jayaraman etai, 1989), and through interaction with Fnr appears to replace the function of a -35 region in the initiation of transcription (Walker and DeMoss, 1992). The c/s-acting sequence required for transcription activation by NarL is located approximately 150bp further upstream from the Fnr box (Li and DeMoss, 1988) and interaction with NarL appears to activate transcription by a mechanism which can operate in the absence of Fnr (Bonnefoy et ai, 1986: Walker and
3596
V. Bonnefoy and J. A. DeMoss -150
NarL narG
tggggaaTACTCCTTAatacccatctgcataaaaatcttaatagtttaaataactacaggtataaaa
narK
gaaagagtTRCTCCTTAtttgccgtgtggttagtcgctttacatcggtaagggtagggattttacag NarL2 P2
narG
-100 I cgtcttaatttacagtctgttatgtggtggctgttaattatcctaaaggggtatcttaggaatttac
narK
caccgtgaaaaatctcataatttttatGaagtcactgTACTCACTAtgggtaATGATaaatATCAAt P2 2 NarLI Fnr2
narG
tttatttttcatccccatcactc^TGATcgttKICRAttcccacgctgtttcagagcgttacctCgcc
narK
qataqataaaqttatcttatcgtTTGATttacATCftAattgcctttagctacagacactaaggtggca
Fnrl
narG
cttAaacattagcaatgtcg
nar K
gacAtcgaaaegagtateag 1
PI
DeMoss. 1992). In some undetermined way. the interactions of these two frans-acting factors with their specific c/s-acting regions are integrated into the mechanism of activation of transcription of the narGHJ/operon. To explore the possible mechanisms involved in the integrated transcriptional activation by Fnr and NarL we have extended our studies to the c/s-acting regions required for expression of the narKgene, which encodes another component involved in nitrate respiration, a nitrate-nitrite antiporter (Noji et ai, 1989; DeMoss and Hsu, 1991). Expression of narK, like that of narGHJI, is positively regulated by Fnr and NarL (Stewart and Parales, 1988) and examination of the putative narK promoter region (Noji etai, 1989) reveals several interesting features. Putative Fnr and NarL boxes (Fnrl and NarL2, Fig. 1), identical to those in the narGHJI operon, are separated by a similar length of apparently unrelated sequence. Inspection of the narK sequence also reveals an additional putative Fnr box (Fnr2, Fig. 1) and an additional putative NarL box (NarLI, Fig. 1). In order to compare the activation by Fnr and NarL of the narK and narGHJ/promoters, we have characterized here the transcription start site and the function of the putative c/s-aoting elements in the activation of transcription of the narK promoter.
Results The construction of the plasmids and strains utilized in these studies is described in the Experimental Procedures. Most of the plasmids were derived from piasmid pRSIO, which contains an intact narK gene, and piasmid pMV45, which contains the pBR322 and M13 origins of
Fig. 1. Comparison of the 5' untranslated regions of the narKgene and the narGHJ/operon. The sequences were aligned with the major transcription start sites for the narGHJ/operon (Walker and DeMoss, 1991) and the narKgene (identified in this work). For the narGHJ/operon. the transcription start site (1), the oorresponding-10 and -35 sequences (P) and the Fnr and NarL box sequences are labelled above the sequence. For the narKgene, the two transcription start sites identified in this study (1 and 2) and the putative -10 and -35 sequences as well as the multiple putative Fnr and NarL box sequences are labelled below the sequence.
PI
replication and the narK gene fused in frame to the iacZ gene so that regulation of the narK promoter could be followed by assaying the levels of p-galactosidase formed. At high copy number in strain MV1190, expression of the narK-lacZ fusion on piasmid pMV45 was suppressed under aerobic conditions, induced by anaerobic conditions, and increased under both conditions by the presence of nitrate {data not shown). The expression of the fusion gene was similarly regulated (Table 1) when the piasmid was grown in strain RK66P [Mac, narKy.JniO, pcnB) to avoid possible autoregulation of narK and possible gene dosage effects, since in a pcnB background pBR322 derivatives have a copy number of two to three per cell (Lopilato etai, 1986).
Table 1. Expression of narK:./acZfusion plasmids at low copy number in strain RK66P. p-Galactosidase (Miller Units)
Piasmid pMV45 pMV50 pUV53 pMV54 pMV55 pMV51 pMV52 pVBI pVB2 pVB3
aerobio + nitrate
anaerobic
anaerobic + nitrate
1 1 1 5 1 0 1
9 4 122 11 2 0 2
120 95 90 150 80 17 95
1770 1830 1390 1550 104 19 1070
6
