This article was downloaded by: [University of Sussex Library] On: 28 October 2014, At: 11:06 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Bioscience, Biotechnology, and Biochemistry Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbbb20
Identification of catalytic residues of a very large NAD-glutamate dehydrogenase from Janthinobacterium lividum by site-directed mutagenesis a
b
Ryushi Kawakami , Haruhiko Sakuraba & Toshihisa Ohshima
c
a
Division of Environmental Symbiosis Studies, Graduate School of Integrated Arts and Sciences, The University of Tokushima, Tokushima, Japan b
Faculty of Agriculture, Department of Applied Biological Science, Kagawa University, Kita-gun, Japan c
Faculty of Engineering, Department of Biomedical Engineering, Osaka Institute of Technology, Osaka, Japan Published online: 15 Aug 2014.
To cite this article: Ryushi Kawakami, Haruhiko Sakuraba & Toshihisa Ohshima (2014): Identification of catalytic residues of a very large NAD-glutamate dehydrogenase from Janthinobacterium lividum by site-directed mutagenesis, Bioscience, Biotechnology, and Biochemistry, DOI: 10.1080/09168451.2014.946394 To link to this article: http://dx.doi.org/10.1080/09168451.2014.946394
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Bioscience, Biotechnology, and Biochemistry, 2014
Identification of catalytic residues of a very large NAD-glutamate dehydrogenase from Janthinobacterium lividum by site-directed mutagenesis Ryushi Kawakami1,*, Haruhiko Sakuraba2 and Toshihisa Ohshima3 1
Division of Environmental Symbiosis Studies, Graduate School of Integrated Arts and Sciences, The University of Tokushima, Tokushima, Japan; 2Faculty of Agriculture, Department of Applied Biological Science, Kagawa University, Kita-gun, Japan; 3Faculty of Engineering, Department of Biomedical Engineering, Osaka Institute of Technology, Osaka, Japan Received May 19, 2014; accepted July 9, 2014
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
http://dx.doi.org/10.1080/09168451.2014.946394
We previously found a very large NAD-dependent glutamate dehydrogenase with approximately 170 kDa subunit from Janthinobacterium lividum (Jl-GDH) and predicted that GDH reaction occurred in the central domain of the subunit. To gain further insights into the role of the central domain, several single point mutations were introduced. The enzyme activity was completely lost in all single mutants of R784A, K810A, K820A, D885A, and S1142A. Because, in sequence alignment analysis, these residues corresponded to the residues responsible for glutamate binding in well-known small GDH with approximately 50 kDa subunit, very large GDH and well-known small GDH may share the same catalytic mechanism. In addition, we demonstrated that C1141, one of the three cysteine residues in the central domain, was responsible for the inhibition of enzyme activity by HgCl2, and HgCl2 functioned as an activating compound for a C1141T mutant. At low concentrations, moreover, HgCl2 was found to function as an activating compound for a wild-type Jl-GDH. This suggests that the mechanism for the activation is entirely different from that for the inhibition. Key words:
very large glutamate dehydrogenase; Janthinobacterium lividum; glutamatebinding residues; inhibition by Hg2+; activation by Hg2+
Glutamate dehydrogenases (GDHs; EC 1.4.1.2–4) catalyze the reversible oxidative deamination of glutamate to α-ketoglutarate and ammonia using NAD or NADP as coenzymes. Almost all GDHs from a wide variety of organisms are hexamers with a subunit molecular mass of approximately 50 kDa. Among them, GDH from Clostridium symbiosum (Cs-GDH) is the most extensively studied regarding the relationship between function and structure.1–3) In 1992, the crystal structure of Cs-GDH was first solved in apo- and *Corresponding author. Email: [email protected] © 2014 Japan Society for Bioscience, Biotechnology, and Agrochemistry
NAD-bound forms, and a model of the active site with glutamate was constructed.2) Subsequently, Stillman et al. solved the structure of the binary complex of Cs-GDH with glutamate at 1.9 Å resolution and proposed the enzyme’s catalytic mechanism.3) On the other hand, very large GDHs with a subunit molecular mass of 170–180 kDa have been observed in several bacterial microorganisms, such as Streptomyces clavuligerus ATCC27064 (Sc-GDH), Pseudomonas aeruginosa PAO1 (Pa-GDH), and Psychrobacter sp. TAD1,4–6) and in various bacterial genomes as deduced gene. Enzyme activities of the very large GDHs observed to date are activated and inhibited in the presence of non-substrate amino acids and organic acids, respectively, unlike well-known small GDHs. Unfortunately, the crystal structure of these enzymes has not yet been determined and compared with conventional GDH, and very little structural information is available on their function. The analysis of the primary structure of the very large GDHs found to date revealed common features. First, the primary structure of very large GDH is divided into the following three domains: Nterminal, central, and C-terminal domains, and the amino acid sequences of the central domains are highly conserved among the enzymes, though those of the Nand C-terminal domains are less conserved. Second, almost all the residues responsible for glutamate interaction in Cs-GDH are highly conserved in the central domain of very large GDH.4,5) These observations strongly suggest that the central domain of very large GDH contains a core structure for GDH activity, and these highly conserved residues are involved in the enzyme reaction. However, the contribution of these residues to the catalytic activity of very large GDHs has not been experimentally examined until now. Of late, we identified and characterized a very large GDH in the psychrophilic bacterium Janthinobacterium lividum UTB1302 (Jl-GDH).7,8) The conserved residues in the central domains of very large GDHs were also found to be highly conserved in Jl-GDH. Moreover, we found that the activity of Jl-GDH was completely
2
R. Kawakami et al.
inhibited by HgCl2, a known blocking reagent for the thiol group of cysteine residues, and three cysteine residues are present in the central domain of Jl-GDH. In the present study, we investigated the role of conserved residues in the central domain of Jl-GDH. Seven mutants (R784A, K810A, K820A, D869A, D885A, V1139A, and S1142A), in which each conserved residue was substituted to alanine, were constructed to evaluate their catalytic properties. In addition, we analyzed three mutants (C825G, C872R, and C1141T) to identify the residue responsible for enzyme inhibition by HgCl2.
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
Materials and methods Site-directed mutagenesis. To investigate the catalytic residues, mutation analyses were carried out on residues R784, K810, K820, C825, D869, C872, D885, V1139, C1141, and S1142. Expression vectors for these mutants were constructed using pColdIV/JLGDH7) as a template for site-directed mutagenesis. The sequences of each primer set were completely complementary and designed to substitute R784, K810, K820, D869, D885, V1139, and S1142 for alanine, C825 for glycine, C872 for arginine, and C1141 for threonine (Table 1). The non-PCR reaction was performed using Primestar Max DNA polymerase (Takara), according to the standard protocol supplied by the manufacturer. The restriction enzyme, DpnI, was added to the reaction mixture to digest the template DNA. Following this, an aliquot of the reaction mixture was used for the transformation with TOP10 cells (Stratagene). To screen the plasmids with the correct mutation, the plasmids were extracted from the transformants, and whole gene sequencing was conducted using a genetic analyzer (Model 3130, Applied Biosystems).
Table 1.
Primer sequences used for the mutagenesis.
Primer
Sequence
R784A-mut1 R784A-mut2 K810A -mut1 K810A -mut2 K820A-mut1 K820A-mut2 C825G-mut1 C825G-mut2 D869A-mut1 D869A-mut2 C872R-mut1 C872R-mut2 D885A-mut1 D885A-mut2 V1139A-mut1 V1139A-mut2 C1141T-mut1 C1141T-mut2 S1142A-mut1 S1142A-mut2 JLGDH-709Fw JLGDH-1188Rv
GCCCGGTCGCCGCCGGCGGCTTGCG CGCAAGCCGCCGGCGGCGACCGGGC GGCGCAGATGGTGGCGAATGCCGTCATCG CGATGACGGCATTCGCCACCATCTGCGCC CGGCCGGCGCGGCGGGCGGTTTTG CAAAACCGCCCGCCGCGCCGGCCG GGCGGTTTTGTCGGCAAGATGATGCCGAAG CTTCGGCATCATCTTGCCGACAAAACCGCC GCCGCCAGTCGCCACCGTGTGCTTCG CGAAGCACACGGTGGCGACTGGCGGC CCAGTCGACACCGTGCGCTTCGACGACGCC GGCGTCGTCGAAGCGCACGGTGTCGACTGG GGTGGCCGCCGCCAAGGGCACGGCC GGCCGTGCCCTTGGCGGCGGCCACC CGGCCGGCGCGGATTGCTCGGACC GGTCCGAGCAATCCGCGCCGGCCG GCCGGCGTGGATACCTCGGACCATGAAGTC GACTTCATGGTCCGAGGTATCCACGCCGGC CCGGCGTGGATTGCGCGGACCATG CATGGTCCGCGCAATCCACGCCGG TGCATATGGTGAACCATGCGGACAC ACGGATCCTTACGTCTGCTGCGTGT
Note: The codons where the mutations were introduced are underlined. The sequences for the restriction enzymes are double-underlined.
Expression and purification. Each mutant plasmid was introduced into TOP10 cells, and the transformants were cultivated as described previously.7) The collected cells were suspended with the standard buffer (10 mM potassium phosphate, pH 7.0 containing 1 mM EDTA, 0.1 mM DTT, and 10% glycerol) and disrupted by sonication. Ammonium sulfate was added to the crude extract to 20% saturation. Subsequently, the enzyme solution was applied onto a Butyl-Toyopearl column previously equilibrated with a standard buffer supplemented with 20% ammonium sulfate. The column was washed with the standard buffer supplemented with 20% ammonium sulfate and eluted by a linear gradient of 20–0% ammonium sulfate. Active enzyme fractions were collected and directly applied to a DEAE Cellulofine column previously equilibrated with the standard buffer. The enzymes were eluted with a linear gradient of 0–0.5 M NaCl in the standard buffer, and the active fractions were pooled for analysis. Wild type and all the mutants were highly purified by this two-step purification process (Fig. 1). Construction of N-, C-, and NC-domains deletion mutants. To construct the expression vectors for deletion mutants of N-terminal domain (1–709 residues), C-terminal domain (1188–1575 residues), and NC-terminal domains (1–709 and 1188–1575 residues), two oligonucleotides, JLGDH-709Fw and JLGDH1188Rv were synthesized (Table 1). JLGDH-709Fw and JLGDH-Rv7) for N-deletion mutant, JLGDH-Fw7) and JLGDH-1188Rv for C-deletion mutant, and JLGDH-709Fw and JLGDH-1188Rv for NC-deletion mutant were used as primer sets for PCR. PCR products were introduced into pColdI vector, and resultant expression vectors, pColdI/JLGDH_ΔN, pColdI/ JLGDH_ΔC, and pColdI/JLGDH_ΔNC were used for protein expression analyses. As the control, pColdI/ JLGDH vector was also constructed by the same procedure of construction of pColdIV/JLGDH.7) Determination of enzyme activity and protein level. Enzyme activity was measured in terms of the rate of NADH production from the GDH reaction as
(A)
(B)
Fig. 1. SDS-PAGE of the purified enzymes. Notes: The wild type and the mutants of Jl-GDH were purified, and aliquots (2 μg) were deposited on a 10% SDS-polyacrylamide gel. From left to right; (A) marker, WT, R784A, K810A, K820A, marker, D869A, D885A, V1139A, and S1142A, and (B) marker, C825G, C872R, and C1141T. The following molecular weight markers were used; myosin (200 kDa), β-galactosidase (116 kDa), phosphorylase B (97 kDa), serum albumin (66 kDa), ovalbumin (45 kDa), and carbonic anhydrase (31 kDa).
Catalytic residues of very large GDH 7)
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
described previously. The standard reaction mixture (1 mL) contained 100 mM glycine/NaOH (pH 9.0), 50 mM glutamate, 5 mM NAD, and enzyme. The reaction was performed at 25 °C. For the kinetic analysis toward glutamate and NAD, reaction velocity was measured in triplicate with five concentrations of glutamate (1–20 mM) in the presence of a fixed concentration of NAD (5 mM) and with five concentrations of NAD (0.5–7.5 mM) in the presence of a fixed concentration of glutamate (50 mM), respectively. Reaction rates were independently calculated and apparent Vmax and Km values were analyzed with Prism 5.0 (GraphPad software) using a non-linear regression model. Goodness of fit for each data was confirmed by R2 (>0.99) (data not shown). The impact of metals on the enzyme activity was determined by adding HgCl2 or ZnSO4 to the standard reaction mixture to a final concentration of 1 mM. Table 2.
WT R784A K810A K820A D869A D885A V1139A S1142A C825G C872R C1141T
Kinetic analysis of the wild type and mutants. Glutamate Vmax (μmol/min/mg)
Km (mM)
NAD Vmax (μmol/min/mg)
Km (mM)
6.4 ± 0.13 Not detected Not detected Not detected 7.3 ± 0.099 Not detected 3.0 ± 0.092 Not detected 7.7 ± 0.083 8.3 ± 0.12 5.0 ± 0.091
6.1 ± 0.31 – – – 6.8 ± 0.23 – 7.2 ± 0.52 – 5.4 ± 0.15 5.1 ± 0.20 5.2 ± 0.25
9.0 ± 0.080 Not detected Not detected Not detected 10.5 ± 0.11 Not detected 4.6 ± 0.031 Not detected 10.9 ± 0.11 12.2 ± 0.15 9.0 ± 0.15
1.3 ± 0.037 – – – 1.5 ± 0.048 – 1.2 ± 0.027 – 1.2 ± 0.041 1.3 ± 0.051 2.1 ± 0.097
Note: Not detected: less than at least 0.0002 μmol/min/mg.
3
The protein concentration was determined with the Bradford method using bovine serum albumin as a standard.9) Polyacrylamide gel electrophoresis. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed to confirm enzyme purity according to Leammli method.10)
Results and discussion Stillman et al. reported that the substrate glutamate interacts with several residues lying in the pocket formed by two domains of the enzyme.3) Both, the ε-amino group of K89 and the side chain hydroxyl group of S380 interact with the γ-carboxyl group of glutamate. The side chains of V377 and A163 form hydrophobic interactions with the β and γ-methylene groups of glutamate. The main chain carbonyl atom of G164 and the side chain carboxyl group of D165 interact with the α-amino group of glutamate. The side chain amino groups of Q110 and K113 interact with the α-carboxyl group of glutamate. The main chain amino group of G91, side chain carbonyl atom of Q110, and side chain amino group of K125 are thought to form hydrogen bonds with an enzyme-bound water molecule. The side chain amino group of K125 also interacts with the side chain carboxyl group of D165. Of these residues, D165 is estimated to play a role as a general base for the enzyme reaction. Based on these structural information, Dean et al. show that the specific activity of D165S mutant of Cs-GDH is decreased to 0.001% compared with that of the wild-type for oxidative deamination,11) and Wang et al. reveal that two
Fig. 2. Sequence alignment in the central domain of very large GDHs. Notes: The sequences were aligned using Clustal W.13) The conserved residues among very large GDHs are indicated by asterisk. R784, K810, K820, D885, V1139, and S1142 identified as catalytic residues in this study are highlighted in dark gray. G786, Q807, A883, and A884 strongly suggested to be catalytic residues are in light gray. Columns of C825, C872, and C1141 are shown in white letters and black backgrounds. The column showing the sequence between 890 and 1133 in Jl-GDH was omitted. Sequences used were from: Jliv, J. lividum UTB1302 (accession: AB286655); Paer, P. aeruginosa PAO1(AB286655); Cvio, Chromobium violaceum ATCC12472 (NP_902754); Patl, Pseudoalteromonas atlantica T6c (YP_661574); Scla, S. clavuligerus ATCC27064 (AF218569); Xcam; Xanthomonas campestris ATCC33913 (NP_637719); Tfus, Thermobifida fusca YX (YP_290537). The Cs-GDH sequence was indicated (Csym) at the top of the alignment.
4
R. Kawakami et al.
Table 3. Impact of HgCl2 and ZnSO4 on the enzyme activity of the wild-type and C1141T mutant. Relative activity (%)
WT C1141T
None
HgCl2
ZnSO4
100 100
0 846
209 286
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
Note: 1 mM of HgCl2 and ZnSO4 were used in the assay.
mutants of Cs-GDH, K89L and S380 V, also decreases and loses the activity toward glutamate, respectively.12) We previously reported that the aforementioned residues, except Q110, are highly conserved in the central domain of the Jl-GDH.7) The G91, K113, K125, D165, V377, and S380 residues of Cs-GDH are completely conserved in Jl-GDH as G786, K810, K820, D869, V1139, and S1142, respectively, although K89, A163, and G164 are replaced by R784, P867, and V868, respectively. Therefore, the present study tested the importance of these residues for Jl-GDH activity using site-directed mutagenesis. We first selected R784, K810, K820, D869, V1139, and S1142 as target residues because the side chains of these residues were proposed to interact with the substrate, glutamate. All mutants (R784A, K810A,
K820A, D869A, V1139A, and S1142A) and wild-type Jl-GDH (WT) were successfully purified based on SDS-PAGE (Fig. 1). None of the R784A, K810A, K820A, and S1142A mutants exhibited GDH activity, but D869A exhibited an activity comparable with WT (Table 2). We initially predicted that D869 in Jl-GDH would correspond to D165 in Cs-GDH and it would play a role in the deprotonation of the α-amino group of glutamate as a general base. On the other hand, Minambres et al. reported that the residue corresponding to D165 in Cs-GDH was D951 in the very large GDH, Sc-GDH.4) Sequence alignment indicates that D951 in Sc-GDH corresponds to D885 in Jl-GDH, but not to D869 (Fig. 2). Therefore, we constructed D885A mutant and confirmed that the mutation completely abolished the enzyme activity (Table 2). The incorrect prediction in the previous report7) may be due to a low sequence conservation and presence of many gaps in this region. Although the V1139A mutant exhibited the activity, kinetic analysis revealed that Vmax of the V1139A mutant was reduced by half compared with that of WT without affecting the Km values for glutamate and NAD (Table 2). Because V1139 corresponds to V377 in Cs-GDH, which makes hydrophobic interactions with the β and γ-methylene groups of glutamate, this
Fig. 3. Effects of HgCl2 on the enzyme activity. Notes: The enzyme activities were determined for 3 min in the presence of HgCl2 at various concentrations between 1 μM and 1 mM under the standard assay conditions. The enzyme activities without HgCl2 were shown in bold and solid lines. (A) WT enzyme was used for the assay. HgCl2 concentrations used were depicted in the figure. (B) C1141T mutant was used for the assay. The activities in the presence of HgCl2 (1 μM, 0.05 , 0.1 , 0.2 , 0.5 , and 1 ) were shown in doted lines.
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
Catalytic residues of very large GDH
mutation may not weaken interactions largely between the enzyme and glutamate. Together, the mutation analyses revealed that R784, K810, K820, D885, and S1142 are important for the catalytic activity of Jl-GDH. In particular, D885 appeared to play a role as a general base in Jl-GDH, as is the case of D165 in Cs-GDH. Therefore, the residues corresponding to A163 and G164 in Cs-GDH should be A883 and A884, respectively (Fig. 2). In our previous report, the residue corresponding to Q110 in Cs-GDH was not identified in Jl-GDH.7) Taking into account that CsGDH carries Q110 at the position 3 residue upstream from K113 (corresponding to K810 in Jl-GDH), the residue corresponding to Q110 should be Q807. Therefore, Q807 and K810 may be involved in the binding of the α-carboxyl group of glutamate to Jl-GDH. These observations strongly suggest that the catalytic mechanism of Jl-GDH is substantially similar to that of CsGDH despite the largely different molecular masses. We previously reported that Jl-GDH enzyme activity was completely inhibited by the addition of HgCl2, acting as a blocking reagent for thiol groups.7) This result supports a possible role for cysteine residues in the enzyme reaction. Nine cysteine residues have been identified in the Jl-GDH sequence, and three of them (C825, C872, and C1141) are in the central domain. Therefore, we tested the impact of these three residues and HgCl2-mediated enzyme inhibition. As shown in the sequence alignment (Fig. 2), the residue at position 825 was not conserved as the specific amino acid residue, while that at 872 was conserved as arginine rather than cysteine, and that at 1141 was conserved as threonine or cysteine. Thus, three mutants were prepared by substituting C825, C872, and C1141 with glycine, arginine, and threonine, respectively, and it was confirmed that all the mutants retained minimally altered enzyme activity (Table 2). The addition of HgCl2 only inhibited the activities of C825G and C872R mutants, indicating that HgCl2 was bound to the thiol group of C1141. As shown in the sequence alignment, the residue at position 1141 was conserved as a cysteine or threonine group in the very large GDHs (Fig. 2). Moreover, the enzyme activity of the C1141T mutant was comparable with WT (Table 2). Considering these results, and the fact that the residue corresponding to C1141 is V379 in Cs-GDH, the thiol group of C1141 is not likely to be directly involved in the catalytic activity. Because C1141 is located next to S1142, one of the residues responsible for the reaction, this residue should contribute the reaction pocket formation. Glutamate binding may be blocked by the Hg2+ ion bound to C1141, which occupies part of the reaction pocket. On the contrary, the activity of the C1141T mutant was increased to 846% by the addition of 1 mM HgCl2 (Table 3). We previously reported that the enzyme activity of Jl-GDH was increased to 224% by the addition of ZnCl2.7) When the activities of WT and C1141T were measured in the presence of ZnSO4, the activities were also increased to 209 and 286%, respectively (Table 3). Therefore, in the C1141T mutant, the Hg2+ ion functions as activator, but not as inhibitor. The activation ratios were similar with one another at the concentrations of HgCl2 from 1 μM to 1 mM (Fig. 3(B)).
5
Fig. 4. SDS-PAGE of the deletion mutants. Notes: The full-length and the deletion mutants of Jl-GDH were extracted by sonication from cells. Ten mM Tris/HCl (pH 8) containing 1 mM EDTA and 4% Triton X-100 was used to extract soluble components from cell debris. After centrifugation, precipitants were collected as inclusion bodies and suspended with 10 mM Tris/HCl (pH 8). The resulting supernatant after sonication was used as the crude extracts. The crude extracts of full-length and C-deletion mutant were applied on a Ni-chelating Sepharose column. After washing the column, the proteins were eluted with 10 mM Tris/HCl (pH 8), 0.5 M NaCl, and 0.5 M imidazol. Aliquots were deposited on a 10% SDS-polyacrylamide gel. Lane 1–4; precipitant fractions of full-length, N-, C-, and NC-deletion mutants, respectively, lane 6–9; crude extracts of full-length, N-, C-, and NC-deletion mutants, respectively, lane 11 and 12; elution fractions of Ni-chelating Sepharose of full-length and C-deletion mutant, respectively, and lane 5 and 10; molecular weight markers used in Fig. 1. The positions of full-length and the deletion mutants were shown in wedges.
Interestingly, on the other hand, the activation by Hg2+ ion was also observed for the WT enzyme when 0.2 mM HgCl2 was added together with enzyme to the reaction mixture, though the reaction velocity was gradually decreased and completely lost after 90 s incubation (Fig. 3(A)). As the concentration of HgCl2 decreased (0.1 mM and 0.05 mM), activation ratio was apparently increased, whereas inhibition effect was weakened. In the presence of 1 μM HgCl2, the activation ratio of WT enzyme was almost same as that of the C1141T mutant (Fig. 3(A)). These results indicate that the HgCl2 concentration required for the enzyme inhibition is much higher than that required for activation and the mechanism for the activation may be entirely different from that for the inhibition that proceeds via a binding of Hg2+ ion with C1141 residue. We also reported that Jl-GDH activity is strongly activated by non-substrate amino acids, such as aspartate and arginine.7) These results and our present data suggest that the N- and/or C-terminal domains contribute to the activation by metal ions and amino acids because such activating mechanism is not observed in Cs-GDH. To investigate the role of N- and C-terminal domains, we constructed three deletion mutants: N- and C-deletion mutants lack the N-terminal domain (1–709 resides) and C-terminal domain (1180–1575 residues), respectively, and NC-deletion mutant lacks both N- and C-terminal domains, all of which had additional 16 residues containing His-Tag sequence at each N-terminus. The molecular masses of N-, C-, and NC-deletion
6
R. Kawakami et al.
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
mutants were estimated to be 95.7 kDa (883 residues), 130.4 kDa (1,205 residues), and 54.7 kDa (497 residues), respectively. On the basis of SDS-PAGE analysis, we could not observe the expression of N- and NCdeletion mutants in the crude extracts (Fig. 4) and the eluents of Ni-chelating Sepharose (data not shown). Moreover, NAD-dependent GDH activity of both mutants was not detected. On the other hand, full-length enzyme and C-deletion mutant were produced as the soluble proteins (Fig. 4). However, C-deletion mutant had no GDH activity even in the presence of activation compounds. At this stage, therefore, the importance of the N- and/or C-terminal domain on the activation of the GDH activity remains unclear. Now, we have endeavored to yield crystals of this enzyme. Analysis of the crystal structure of this enzyme will elucidate the detailed mechanisms of catalysis and activation.
Acknowledgments We are grateful to Masaki Oyama and Shota Shiraishi for their excellent technical assistance. We would like to thank Enago (www.enago.jp) for the English language review.
References [1] Rice DW, Baker PJ, Farrants GW, Hornby DP. The crystal structure of glutamate dehydrogenase from Clostridium symbiosum at 0.6 nm resolution. Biochem. J. 1987;242:789–795. [2] Baker PJ, Britton KL, Engel PC, Farrants GW, Lilley KS, Rice DW, Stillman TJ. Subunit assembly and active site location in the structure of glutamate dehydrogenase. Proteins. 1992;12:75–86. [3] Stillman TJ, Baker PJ, Britton KL, Rice DW. Conformational flexibility in glutamate dehydrogenase: role of water in substrate recognition and catalysis. J. Mol. Biol. 1993;234:1131–1139.
[4] Minambres B, Olivera ER, Jensen RA, Luengo JM. A new class of glutamate dehydrogenases (GDH): biochemical and genetic characterization of the first member, the AMP-requiring NADspecific GDH of Streptomyces clavuligerus. J. Biol. Chem. 2000;275:39529–39542. [5] Lu CD, Abdelal AT. The gdhB gene of Pseudomonas aeruginosa encodes an arginine-inducible NAD+-dependent glutamate dehydrogenase which is subject to allosteric regulation. J. Bacteriol. 2001;183:490–499. [6] Camardella L, Frasia RD, Antignani A, Ciardiello MA, di Prisco G, Coleman JK, Buchon L, Guespin J, Russell NJ. The Antarctic Psychrobacter sp. TAD1 has two cold-active glutamate dehydrogenases with different cofactor specificities: characterisation of the NAD+-dependent enzyme. Comp. Biochem. Physiol. A. 2002;131:559–567. [7] Kawakami R, Sakuraba H, Ohshima T. Gene cloning and characterization of the very large NAD-dependent L-glutamate dehydrogenase from the psychrophile Janthinobacterium lividum, isolated from cold soil. J. Bacteriol. 2007;189:5626–5633. [8] Kawakami R, Oyama M, Sakuraba H, Ohshima T. The unique kinetic behavior of the very large NAD-dependent glutamate dehydrogenase from Janthinobacterium lividum. Biosci. Biotechnol. Biochem. 2010;74:884–887. [9] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976;72:248–254. [10] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685. [11] Dean JL, Wang XG, Teller JK, Waugh ML, Britton KL, Baker PJ, Stillman TJ, Martin SR, Rice DW, Engel PC. The catalytic role of aspartate in the active site of glutamate dehydrogenase. Biochem. J. 1994;301:13–16. [12] Wang XG, Britton KL, Baker PJ, Martin S, Rice DW, Engel PC. Alteration of the amino acid substrate specificity of clostridial glutamate dehydrogenase by site-directed mutagenesis of an active-site lysine residue. Protein Eng. 1995;8:147–152. [13] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680.
Bioscience, Biotechnology, and Biochemistry Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/tbbb20
Identification of catalytic residues of a very large NAD-glutamate dehydrogenase from Janthinobacterium lividum by site-directed mutagenesis a
b
Ryushi Kawakami , Haruhiko Sakuraba & Toshihisa Ohshima
c
a
Division of Environmental Symbiosis Studies, Graduate School of Integrated Arts and Sciences, The University of Tokushima, Tokushima, Japan b
Faculty of Agriculture, Department of Applied Biological Science, Kagawa University, Kita-gun, Japan c
Faculty of Engineering, Department of Biomedical Engineering, Osaka Institute of Technology, Osaka, Japan Published online: 15 Aug 2014.
To cite this article: Ryushi Kawakami, Haruhiko Sakuraba & Toshihisa Ohshima (2014): Identification of catalytic residues of a very large NAD-glutamate dehydrogenase from Janthinobacterium lividum by site-directed mutagenesis, Bioscience, Biotechnology, and Biochemistry, DOI: 10.1080/09168451.2014.946394 To link to this article: http://dx.doi.org/10.1080/09168451.2014.946394
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Bioscience, Biotechnology, and Biochemistry, 2014
Identification of catalytic residues of a very large NAD-glutamate dehydrogenase from Janthinobacterium lividum by site-directed mutagenesis Ryushi Kawakami1,*, Haruhiko Sakuraba2 and Toshihisa Ohshima3 1
Division of Environmental Symbiosis Studies, Graduate School of Integrated Arts and Sciences, The University of Tokushima, Tokushima, Japan; 2Faculty of Agriculture, Department of Applied Biological Science, Kagawa University, Kita-gun, Japan; 3Faculty of Engineering, Department of Biomedical Engineering, Osaka Institute of Technology, Osaka, Japan Received May 19, 2014; accepted July 9, 2014
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
http://dx.doi.org/10.1080/09168451.2014.946394
We previously found a very large NAD-dependent glutamate dehydrogenase with approximately 170 kDa subunit from Janthinobacterium lividum (Jl-GDH) and predicted that GDH reaction occurred in the central domain of the subunit. To gain further insights into the role of the central domain, several single point mutations were introduced. The enzyme activity was completely lost in all single mutants of R784A, K810A, K820A, D885A, and S1142A. Because, in sequence alignment analysis, these residues corresponded to the residues responsible for glutamate binding in well-known small GDH with approximately 50 kDa subunit, very large GDH and well-known small GDH may share the same catalytic mechanism. In addition, we demonstrated that C1141, one of the three cysteine residues in the central domain, was responsible for the inhibition of enzyme activity by HgCl2, and HgCl2 functioned as an activating compound for a C1141T mutant. At low concentrations, moreover, HgCl2 was found to function as an activating compound for a wild-type Jl-GDH. This suggests that the mechanism for the activation is entirely different from that for the inhibition. Key words:
very large glutamate dehydrogenase; Janthinobacterium lividum; glutamatebinding residues; inhibition by Hg2+; activation by Hg2+
Glutamate dehydrogenases (GDHs; EC 1.4.1.2–4) catalyze the reversible oxidative deamination of glutamate to α-ketoglutarate and ammonia using NAD or NADP as coenzymes. Almost all GDHs from a wide variety of organisms are hexamers with a subunit molecular mass of approximately 50 kDa. Among them, GDH from Clostridium symbiosum (Cs-GDH) is the most extensively studied regarding the relationship between function and structure.1–3) In 1992, the crystal structure of Cs-GDH was first solved in apo- and *Corresponding author. Email: [email protected] © 2014 Japan Society for Bioscience, Biotechnology, and Agrochemistry
NAD-bound forms, and a model of the active site with glutamate was constructed.2) Subsequently, Stillman et al. solved the structure of the binary complex of Cs-GDH with glutamate at 1.9 Å resolution and proposed the enzyme’s catalytic mechanism.3) On the other hand, very large GDHs with a subunit molecular mass of 170–180 kDa have been observed in several bacterial microorganisms, such as Streptomyces clavuligerus ATCC27064 (Sc-GDH), Pseudomonas aeruginosa PAO1 (Pa-GDH), and Psychrobacter sp. TAD1,4–6) and in various bacterial genomes as deduced gene. Enzyme activities of the very large GDHs observed to date are activated and inhibited in the presence of non-substrate amino acids and organic acids, respectively, unlike well-known small GDHs. Unfortunately, the crystal structure of these enzymes has not yet been determined and compared with conventional GDH, and very little structural information is available on their function. The analysis of the primary structure of the very large GDHs found to date revealed common features. First, the primary structure of very large GDH is divided into the following three domains: Nterminal, central, and C-terminal domains, and the amino acid sequences of the central domains are highly conserved among the enzymes, though those of the Nand C-terminal domains are less conserved. Second, almost all the residues responsible for glutamate interaction in Cs-GDH are highly conserved in the central domain of very large GDH.4,5) These observations strongly suggest that the central domain of very large GDH contains a core structure for GDH activity, and these highly conserved residues are involved in the enzyme reaction. However, the contribution of these residues to the catalytic activity of very large GDHs has not been experimentally examined until now. Of late, we identified and characterized a very large GDH in the psychrophilic bacterium Janthinobacterium lividum UTB1302 (Jl-GDH).7,8) The conserved residues in the central domains of very large GDHs were also found to be highly conserved in Jl-GDH. Moreover, we found that the activity of Jl-GDH was completely
2
R. Kawakami et al.
inhibited by HgCl2, a known blocking reagent for the thiol group of cysteine residues, and three cysteine residues are present in the central domain of Jl-GDH. In the present study, we investigated the role of conserved residues in the central domain of Jl-GDH. Seven mutants (R784A, K810A, K820A, D869A, D885A, V1139A, and S1142A), in which each conserved residue was substituted to alanine, were constructed to evaluate their catalytic properties. In addition, we analyzed three mutants (C825G, C872R, and C1141T) to identify the residue responsible for enzyme inhibition by HgCl2.
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
Materials and methods Site-directed mutagenesis. To investigate the catalytic residues, mutation analyses were carried out on residues R784, K810, K820, C825, D869, C872, D885, V1139, C1141, and S1142. Expression vectors for these mutants were constructed using pColdIV/JLGDH7) as a template for site-directed mutagenesis. The sequences of each primer set were completely complementary and designed to substitute R784, K810, K820, D869, D885, V1139, and S1142 for alanine, C825 for glycine, C872 for arginine, and C1141 for threonine (Table 1). The non-PCR reaction was performed using Primestar Max DNA polymerase (Takara), according to the standard protocol supplied by the manufacturer. The restriction enzyme, DpnI, was added to the reaction mixture to digest the template DNA. Following this, an aliquot of the reaction mixture was used for the transformation with TOP10 cells (Stratagene). To screen the plasmids with the correct mutation, the plasmids were extracted from the transformants, and whole gene sequencing was conducted using a genetic analyzer (Model 3130, Applied Biosystems).
Table 1.
Primer sequences used for the mutagenesis.
Primer
Sequence
R784A-mut1 R784A-mut2 K810A -mut1 K810A -mut2 K820A-mut1 K820A-mut2 C825G-mut1 C825G-mut2 D869A-mut1 D869A-mut2 C872R-mut1 C872R-mut2 D885A-mut1 D885A-mut2 V1139A-mut1 V1139A-mut2 C1141T-mut1 C1141T-mut2 S1142A-mut1 S1142A-mut2 JLGDH-709Fw JLGDH-1188Rv
GCCCGGTCGCCGCCGGCGGCTTGCG CGCAAGCCGCCGGCGGCGACCGGGC GGCGCAGATGGTGGCGAATGCCGTCATCG CGATGACGGCATTCGCCACCATCTGCGCC CGGCCGGCGCGGCGGGCGGTTTTG CAAAACCGCCCGCCGCGCCGGCCG GGCGGTTTTGTCGGCAAGATGATGCCGAAG CTTCGGCATCATCTTGCCGACAAAACCGCC GCCGCCAGTCGCCACCGTGTGCTTCG CGAAGCACACGGTGGCGACTGGCGGC CCAGTCGACACCGTGCGCTTCGACGACGCC GGCGTCGTCGAAGCGCACGGTGTCGACTGG GGTGGCCGCCGCCAAGGGCACGGCC GGCCGTGCCCTTGGCGGCGGCCACC CGGCCGGCGCGGATTGCTCGGACC GGTCCGAGCAATCCGCGCCGGCCG GCCGGCGTGGATACCTCGGACCATGAAGTC GACTTCATGGTCCGAGGTATCCACGCCGGC CCGGCGTGGATTGCGCGGACCATG CATGGTCCGCGCAATCCACGCCGG TGCATATGGTGAACCATGCGGACAC ACGGATCCTTACGTCTGCTGCGTGT
Note: The codons where the mutations were introduced are underlined. The sequences for the restriction enzymes are double-underlined.
Expression and purification. Each mutant plasmid was introduced into TOP10 cells, and the transformants were cultivated as described previously.7) The collected cells were suspended with the standard buffer (10 mM potassium phosphate, pH 7.0 containing 1 mM EDTA, 0.1 mM DTT, and 10% glycerol) and disrupted by sonication. Ammonium sulfate was added to the crude extract to 20% saturation. Subsequently, the enzyme solution was applied onto a Butyl-Toyopearl column previously equilibrated with a standard buffer supplemented with 20% ammonium sulfate. The column was washed with the standard buffer supplemented with 20% ammonium sulfate and eluted by a linear gradient of 20–0% ammonium sulfate. Active enzyme fractions were collected and directly applied to a DEAE Cellulofine column previously equilibrated with the standard buffer. The enzymes were eluted with a linear gradient of 0–0.5 M NaCl in the standard buffer, and the active fractions were pooled for analysis. Wild type and all the mutants were highly purified by this two-step purification process (Fig. 1). Construction of N-, C-, and NC-domains deletion mutants. To construct the expression vectors for deletion mutants of N-terminal domain (1–709 residues), C-terminal domain (1188–1575 residues), and NC-terminal domains (1–709 and 1188–1575 residues), two oligonucleotides, JLGDH-709Fw and JLGDH1188Rv were synthesized (Table 1). JLGDH-709Fw and JLGDH-Rv7) for N-deletion mutant, JLGDH-Fw7) and JLGDH-1188Rv for C-deletion mutant, and JLGDH-709Fw and JLGDH-1188Rv for NC-deletion mutant were used as primer sets for PCR. PCR products were introduced into pColdI vector, and resultant expression vectors, pColdI/JLGDH_ΔN, pColdI/ JLGDH_ΔC, and pColdI/JLGDH_ΔNC were used for protein expression analyses. As the control, pColdI/ JLGDH vector was also constructed by the same procedure of construction of pColdIV/JLGDH.7) Determination of enzyme activity and protein level. Enzyme activity was measured in terms of the rate of NADH production from the GDH reaction as
(A)
(B)
Fig. 1. SDS-PAGE of the purified enzymes. Notes: The wild type and the mutants of Jl-GDH were purified, and aliquots (2 μg) were deposited on a 10% SDS-polyacrylamide gel. From left to right; (A) marker, WT, R784A, K810A, K820A, marker, D869A, D885A, V1139A, and S1142A, and (B) marker, C825G, C872R, and C1141T. The following molecular weight markers were used; myosin (200 kDa), β-galactosidase (116 kDa), phosphorylase B (97 kDa), serum albumin (66 kDa), ovalbumin (45 kDa), and carbonic anhydrase (31 kDa).
Catalytic residues of very large GDH 7)
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
described previously. The standard reaction mixture (1 mL) contained 100 mM glycine/NaOH (pH 9.0), 50 mM glutamate, 5 mM NAD, and enzyme. The reaction was performed at 25 °C. For the kinetic analysis toward glutamate and NAD, reaction velocity was measured in triplicate with five concentrations of glutamate (1–20 mM) in the presence of a fixed concentration of NAD (5 mM) and with five concentrations of NAD (0.5–7.5 mM) in the presence of a fixed concentration of glutamate (50 mM), respectively. Reaction rates were independently calculated and apparent Vmax and Km values were analyzed with Prism 5.0 (GraphPad software) using a non-linear regression model. Goodness of fit for each data was confirmed by R2 (>0.99) (data not shown). The impact of metals on the enzyme activity was determined by adding HgCl2 or ZnSO4 to the standard reaction mixture to a final concentration of 1 mM. Table 2.
WT R784A K810A K820A D869A D885A V1139A S1142A C825G C872R C1141T
Kinetic analysis of the wild type and mutants. Glutamate Vmax (μmol/min/mg)
Km (mM)
NAD Vmax (μmol/min/mg)
Km (mM)
6.4 ± 0.13 Not detected Not detected Not detected 7.3 ± 0.099 Not detected 3.0 ± 0.092 Not detected 7.7 ± 0.083 8.3 ± 0.12 5.0 ± 0.091
6.1 ± 0.31 – – – 6.8 ± 0.23 – 7.2 ± 0.52 – 5.4 ± 0.15 5.1 ± 0.20 5.2 ± 0.25
9.0 ± 0.080 Not detected Not detected Not detected 10.5 ± 0.11 Not detected 4.6 ± 0.031 Not detected 10.9 ± 0.11 12.2 ± 0.15 9.0 ± 0.15
1.3 ± 0.037 – – – 1.5 ± 0.048 – 1.2 ± 0.027 – 1.2 ± 0.041 1.3 ± 0.051 2.1 ± 0.097
Note: Not detected: less than at least 0.0002 μmol/min/mg.
3
The protein concentration was determined with the Bradford method using bovine serum albumin as a standard.9) Polyacrylamide gel electrophoresis. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed to confirm enzyme purity according to Leammli method.10)
Results and discussion Stillman et al. reported that the substrate glutamate interacts with several residues lying in the pocket formed by two domains of the enzyme.3) Both, the ε-amino group of K89 and the side chain hydroxyl group of S380 interact with the γ-carboxyl group of glutamate. The side chains of V377 and A163 form hydrophobic interactions with the β and γ-methylene groups of glutamate. The main chain carbonyl atom of G164 and the side chain carboxyl group of D165 interact with the α-amino group of glutamate. The side chain amino groups of Q110 and K113 interact with the α-carboxyl group of glutamate. The main chain amino group of G91, side chain carbonyl atom of Q110, and side chain amino group of K125 are thought to form hydrogen bonds with an enzyme-bound water molecule. The side chain amino group of K125 also interacts with the side chain carboxyl group of D165. Of these residues, D165 is estimated to play a role as a general base for the enzyme reaction. Based on these structural information, Dean et al. show that the specific activity of D165S mutant of Cs-GDH is decreased to 0.001% compared with that of the wild-type for oxidative deamination,11) and Wang et al. reveal that two
Fig. 2. Sequence alignment in the central domain of very large GDHs. Notes: The sequences were aligned using Clustal W.13) The conserved residues among very large GDHs are indicated by asterisk. R784, K810, K820, D885, V1139, and S1142 identified as catalytic residues in this study are highlighted in dark gray. G786, Q807, A883, and A884 strongly suggested to be catalytic residues are in light gray. Columns of C825, C872, and C1141 are shown in white letters and black backgrounds. The column showing the sequence between 890 and 1133 in Jl-GDH was omitted. Sequences used were from: Jliv, J. lividum UTB1302 (accession: AB286655); Paer, P. aeruginosa PAO1(AB286655); Cvio, Chromobium violaceum ATCC12472 (NP_902754); Patl, Pseudoalteromonas atlantica T6c (YP_661574); Scla, S. clavuligerus ATCC27064 (AF218569); Xcam; Xanthomonas campestris ATCC33913 (NP_637719); Tfus, Thermobifida fusca YX (YP_290537). The Cs-GDH sequence was indicated (Csym) at the top of the alignment.
4
R. Kawakami et al.
Table 3. Impact of HgCl2 and ZnSO4 on the enzyme activity of the wild-type and C1141T mutant. Relative activity (%)
WT C1141T
None
HgCl2
ZnSO4
100 100
0 846
209 286
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
Note: 1 mM of HgCl2 and ZnSO4 were used in the assay.
mutants of Cs-GDH, K89L and S380 V, also decreases and loses the activity toward glutamate, respectively.12) We previously reported that the aforementioned residues, except Q110, are highly conserved in the central domain of the Jl-GDH.7) The G91, K113, K125, D165, V377, and S380 residues of Cs-GDH are completely conserved in Jl-GDH as G786, K810, K820, D869, V1139, and S1142, respectively, although K89, A163, and G164 are replaced by R784, P867, and V868, respectively. Therefore, the present study tested the importance of these residues for Jl-GDH activity using site-directed mutagenesis. We first selected R784, K810, K820, D869, V1139, and S1142 as target residues because the side chains of these residues were proposed to interact with the substrate, glutamate. All mutants (R784A, K810A,
K820A, D869A, V1139A, and S1142A) and wild-type Jl-GDH (WT) were successfully purified based on SDS-PAGE (Fig. 1). None of the R784A, K810A, K820A, and S1142A mutants exhibited GDH activity, but D869A exhibited an activity comparable with WT (Table 2). We initially predicted that D869 in Jl-GDH would correspond to D165 in Cs-GDH and it would play a role in the deprotonation of the α-amino group of glutamate as a general base. On the other hand, Minambres et al. reported that the residue corresponding to D165 in Cs-GDH was D951 in the very large GDH, Sc-GDH.4) Sequence alignment indicates that D951 in Sc-GDH corresponds to D885 in Jl-GDH, but not to D869 (Fig. 2). Therefore, we constructed D885A mutant and confirmed that the mutation completely abolished the enzyme activity (Table 2). The incorrect prediction in the previous report7) may be due to a low sequence conservation and presence of many gaps in this region. Although the V1139A mutant exhibited the activity, kinetic analysis revealed that Vmax of the V1139A mutant was reduced by half compared with that of WT without affecting the Km values for glutamate and NAD (Table 2). Because V1139 corresponds to V377 in Cs-GDH, which makes hydrophobic interactions with the β and γ-methylene groups of glutamate, this
Fig. 3. Effects of HgCl2 on the enzyme activity. Notes: The enzyme activities were determined for 3 min in the presence of HgCl2 at various concentrations between 1 μM and 1 mM under the standard assay conditions. The enzyme activities without HgCl2 were shown in bold and solid lines. (A) WT enzyme was used for the assay. HgCl2 concentrations used were depicted in the figure. (B) C1141T mutant was used for the assay. The activities in the presence of HgCl2 (1 μM, 0.05 , 0.1 , 0.2 , 0.5 , and 1 ) were shown in doted lines.
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
Catalytic residues of very large GDH
mutation may not weaken interactions largely between the enzyme and glutamate. Together, the mutation analyses revealed that R784, K810, K820, D885, and S1142 are important for the catalytic activity of Jl-GDH. In particular, D885 appeared to play a role as a general base in Jl-GDH, as is the case of D165 in Cs-GDH. Therefore, the residues corresponding to A163 and G164 in Cs-GDH should be A883 and A884, respectively (Fig. 2). In our previous report, the residue corresponding to Q110 in Cs-GDH was not identified in Jl-GDH.7) Taking into account that CsGDH carries Q110 at the position 3 residue upstream from K113 (corresponding to K810 in Jl-GDH), the residue corresponding to Q110 should be Q807. Therefore, Q807 and K810 may be involved in the binding of the α-carboxyl group of glutamate to Jl-GDH. These observations strongly suggest that the catalytic mechanism of Jl-GDH is substantially similar to that of CsGDH despite the largely different molecular masses. We previously reported that Jl-GDH enzyme activity was completely inhibited by the addition of HgCl2, acting as a blocking reagent for thiol groups.7) This result supports a possible role for cysteine residues in the enzyme reaction. Nine cysteine residues have been identified in the Jl-GDH sequence, and three of them (C825, C872, and C1141) are in the central domain. Therefore, we tested the impact of these three residues and HgCl2-mediated enzyme inhibition. As shown in the sequence alignment (Fig. 2), the residue at position 825 was not conserved as the specific amino acid residue, while that at 872 was conserved as arginine rather than cysteine, and that at 1141 was conserved as threonine or cysteine. Thus, three mutants were prepared by substituting C825, C872, and C1141 with glycine, arginine, and threonine, respectively, and it was confirmed that all the mutants retained minimally altered enzyme activity (Table 2). The addition of HgCl2 only inhibited the activities of C825G and C872R mutants, indicating that HgCl2 was bound to the thiol group of C1141. As shown in the sequence alignment, the residue at position 1141 was conserved as a cysteine or threonine group in the very large GDHs (Fig. 2). Moreover, the enzyme activity of the C1141T mutant was comparable with WT (Table 2). Considering these results, and the fact that the residue corresponding to C1141 is V379 in Cs-GDH, the thiol group of C1141 is not likely to be directly involved in the catalytic activity. Because C1141 is located next to S1142, one of the residues responsible for the reaction, this residue should contribute the reaction pocket formation. Glutamate binding may be blocked by the Hg2+ ion bound to C1141, which occupies part of the reaction pocket. On the contrary, the activity of the C1141T mutant was increased to 846% by the addition of 1 mM HgCl2 (Table 3). We previously reported that the enzyme activity of Jl-GDH was increased to 224% by the addition of ZnCl2.7) When the activities of WT and C1141T were measured in the presence of ZnSO4, the activities were also increased to 209 and 286%, respectively (Table 3). Therefore, in the C1141T mutant, the Hg2+ ion functions as activator, but not as inhibitor. The activation ratios were similar with one another at the concentrations of HgCl2 from 1 μM to 1 mM (Fig. 3(B)).
5
Fig. 4. SDS-PAGE of the deletion mutants. Notes: The full-length and the deletion mutants of Jl-GDH were extracted by sonication from cells. Ten mM Tris/HCl (pH 8) containing 1 mM EDTA and 4% Triton X-100 was used to extract soluble components from cell debris. After centrifugation, precipitants were collected as inclusion bodies and suspended with 10 mM Tris/HCl (pH 8). The resulting supernatant after sonication was used as the crude extracts. The crude extracts of full-length and C-deletion mutant were applied on a Ni-chelating Sepharose column. After washing the column, the proteins were eluted with 10 mM Tris/HCl (pH 8), 0.5 M NaCl, and 0.5 M imidazol. Aliquots were deposited on a 10% SDS-polyacrylamide gel. Lane 1–4; precipitant fractions of full-length, N-, C-, and NC-deletion mutants, respectively, lane 6–9; crude extracts of full-length, N-, C-, and NC-deletion mutants, respectively, lane 11 and 12; elution fractions of Ni-chelating Sepharose of full-length and C-deletion mutant, respectively, and lane 5 and 10; molecular weight markers used in Fig. 1. The positions of full-length and the deletion mutants were shown in wedges.
Interestingly, on the other hand, the activation by Hg2+ ion was also observed for the WT enzyme when 0.2 mM HgCl2 was added together with enzyme to the reaction mixture, though the reaction velocity was gradually decreased and completely lost after 90 s incubation (Fig. 3(A)). As the concentration of HgCl2 decreased (0.1 mM and 0.05 mM), activation ratio was apparently increased, whereas inhibition effect was weakened. In the presence of 1 μM HgCl2, the activation ratio of WT enzyme was almost same as that of the C1141T mutant (Fig. 3(A)). These results indicate that the HgCl2 concentration required for the enzyme inhibition is much higher than that required for activation and the mechanism for the activation may be entirely different from that for the inhibition that proceeds via a binding of Hg2+ ion with C1141 residue. We also reported that Jl-GDH activity is strongly activated by non-substrate amino acids, such as aspartate and arginine.7) These results and our present data suggest that the N- and/or C-terminal domains contribute to the activation by metal ions and amino acids because such activating mechanism is not observed in Cs-GDH. To investigate the role of N- and C-terminal domains, we constructed three deletion mutants: N- and C-deletion mutants lack the N-terminal domain (1–709 resides) and C-terminal domain (1180–1575 residues), respectively, and NC-deletion mutant lacks both N- and C-terminal domains, all of which had additional 16 residues containing His-Tag sequence at each N-terminus. The molecular masses of N-, C-, and NC-deletion
6
R. Kawakami et al.
Downloaded by [University of Sussex Library] at 11:06 28 October 2014
mutants were estimated to be 95.7 kDa (883 residues), 130.4 kDa (1,205 residues), and 54.7 kDa (497 residues), respectively. On the basis of SDS-PAGE analysis, we could not observe the expression of N- and NCdeletion mutants in the crude extracts (Fig. 4) and the eluents of Ni-chelating Sepharose (data not shown). Moreover, NAD-dependent GDH activity of both mutants was not detected. On the other hand, full-length enzyme and C-deletion mutant were produced as the soluble proteins (Fig. 4). However, C-deletion mutant had no GDH activity even in the presence of activation compounds. At this stage, therefore, the importance of the N- and/or C-terminal domain on the activation of the GDH activity remains unclear. Now, we have endeavored to yield crystals of this enzyme. Analysis of the crystal structure of this enzyme will elucidate the detailed mechanisms of catalysis and activation.
Acknowledgments We are grateful to Masaki Oyama and Shota Shiraishi for their excellent technical assistance. We would like to thank Enago (www.enago.jp) for the English language review.
References [1] Rice DW, Baker PJ, Farrants GW, Hornby DP. The crystal structure of glutamate dehydrogenase from Clostridium symbiosum at 0.6 nm resolution. Biochem. J. 1987;242:789–795. [2] Baker PJ, Britton KL, Engel PC, Farrants GW, Lilley KS, Rice DW, Stillman TJ. Subunit assembly and active site location in the structure of glutamate dehydrogenase. Proteins. 1992;12:75–86. [3] Stillman TJ, Baker PJ, Britton KL, Rice DW. Conformational flexibility in glutamate dehydrogenase: role of water in substrate recognition and catalysis. J. Mol. Biol. 1993;234:1131–1139.
[4] Minambres B, Olivera ER, Jensen RA, Luengo JM. A new class of glutamate dehydrogenases (GDH): biochemical and genetic characterization of the first member, the AMP-requiring NADspecific GDH of Streptomyces clavuligerus. J. Biol. Chem. 2000;275:39529–39542. [5] Lu CD, Abdelal AT. The gdhB gene of Pseudomonas aeruginosa encodes an arginine-inducible NAD+-dependent glutamate dehydrogenase which is subject to allosteric regulation. J. Bacteriol. 2001;183:490–499. [6] Camardella L, Frasia RD, Antignani A, Ciardiello MA, di Prisco G, Coleman JK, Buchon L, Guespin J, Russell NJ. The Antarctic Psychrobacter sp. TAD1 has two cold-active glutamate dehydrogenases with different cofactor specificities: characterisation of the NAD+-dependent enzyme. Comp. Biochem. Physiol. A. 2002;131:559–567. [7] Kawakami R, Sakuraba H, Ohshima T. Gene cloning and characterization of the very large NAD-dependent L-glutamate dehydrogenase from the psychrophile Janthinobacterium lividum, isolated from cold soil. J. Bacteriol. 2007;189:5626–5633. [8] Kawakami R, Oyama M, Sakuraba H, Ohshima T. The unique kinetic behavior of the very large NAD-dependent glutamate dehydrogenase from Janthinobacterium lividum. Biosci. Biotechnol. Biochem. 2010;74:884–887. [9] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976;72:248–254. [10] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685. [11] Dean JL, Wang XG, Teller JK, Waugh ML, Britton KL, Baker PJ, Stillman TJ, Martin SR, Rice DW, Engel PC. The catalytic role of aspartate in the active site of glutamate dehydrogenase. Biochem. J. 1994;301:13–16. [12] Wang XG, Britton KL, Baker PJ, Martin S, Rice DW, Engel PC. Alteration of the amino acid substrate specificity of clostridial glutamate dehydrogenase by site-directed mutagenesis of an active-site lysine residue. Protein Eng. 1995;8:147–152. [13] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22:4673–4680.
