The Plant Cell, Vol. 2, 1171-1 180, December 1990 O 1990 American Society of Plant Physiologists

ldentification of an Enhancer Element for the Endosperm-Specific Expression of High Molecular Weight Glutenin Mark S. Thomas' and Richard B. Flavel12 Department of Molecular Genetics, AFRC lnstitute of Plant Science Research, Cambridge Laboratory, Maris Lane, Trumpington, Cambridge CB2 2J6, United Kingdom

Genes encoding high molecular weight (HMW) glutenin, a wheat seed storage protein, are expressed only in the developing endosperm. It was previously demonstrated that sequences essential for endosperm-specifictranscription reside within 436 base pairs upstream of the initiation codon for HMW glutenin translation. We have further analyzed this region by testing the ability of a series of truncated HMW glutenin promoter fragments to enhance transcription from an adjacent heterologous promoter. The activity of these hybrid promoters was determined by measuring the expression of a linked 6-glucuronidase (GUS) reporter gene in transgenic tobacco plants. An HMW glutenin promoter fragment spanning nucleotides -375 to -45 relative to the transcription start site was found to stimulate GUS expression in tobacco seeds when inserted in either orientation upstream of the heterologous promoter. Furthermore, this fragment could also potentiate transcription when located 3' to the GUS reporter gene. Stimulation of GUS gene expression in transgenic tobacco seeds did not occur until9 days to 12 days after anthesis, coincident with the onset of storage protein synthesis in the developing tobacco and wheat seed, and was confined to the endosperm tissue. By testing progressively shorter promoter fragments, the enhancer element responsible for this pattern of expression was localized to a 40-base pair region some 170 base pairs upstream of the start site for HMW glutenin transcription.

INTRODUCTION Storage proteins accumulate in significant quantities during seed development and serve as a source of reduced nitrogen for early stages of seedling growth. The developing wheat grain consists predominantly of endosperm tissue, which is the site of synthesis and deposition of prolamin storage proteins. The high molecular weight (HMW) subunits of glutenin are a group of prolamins of 70 kD to 90 kD and constitute approximately 10% of the total storage protein of wheat grain (Kasarda et al., 1976). Modern wheat varieties each contain between three and five different HMW glutenin subunits, and these proteins play a major role in determining the viscoelasticity and, hence, the bread-making quality of wheat flour (Payne et al., 1984). Synthesis of seed storage proteins is subject to developmental, organ-specific, and environmental controls. Evidente suggests that the coordinate expression of cereal

'

Current address: Departmentof Biochemistry, University of Nottingham Medical School, Queen's Medical Centre, Nottingham NG7 2UH, United Kingdom. To whom correspondence should be addressed. Current address: John lnnes Institute, Colney Lane, Nowich NR7 7UH, United Kingdom.

storage protein genes is controlled primarily at the leve1 of transcription (Soave and Salamini, 1984; Bartels and Thompson, 1986; Heidecker and Messing, 1986; Kreis et al., 1986). A deletion analysis of the promoter for the HMW glutenin gene GIu-D1-2, which encodes subunit 12, has recently established that sequences necessary for endosperm-specific transcription in transgenic tobacco plants reside within 436 bp upstream from the translation initiation codon (Colot et al., 1987; Robert et al., 1989). Here we describe further experiments that have enabled us to localize these cis-acting sequences.

RESULTS Vector Construction and Analysis of Transformed Tobacco Plants The plasmid vector pB1121.5 that was used for the gene fusion experiments described in this paper, as shown in Figure 1, contains the reporter gene encoding p-glucuronidase (GUS) (Jefferson et al., 1986, 1987) under the tran-

1172

The Plant Cell

pGUS45R

pGUS45

pGUS148

pGUS163

pGUSl86

16 independent tobacco transformants for each plasmid construct tested and growing the plants simultaneously under the same glasshouse conditions. Seed samples for analysis were taken at 30 days after anthesis (DAA) except in the developmental study.

f

-

-t

+

J

The HMW Glutenin Promoter Contains an Upstream Enhancer Element

I

nos 3‘end pBH21.5

CaMV p35s

GUS I

-375 pGUS45D

I

45

+

1

Figure 1. Plasmid Constructs Used for HMW Glutenin Promoter Analysis. The acceptor plasmid for all the glutenin promoter fragments tested was pB1121.5, which contains a truncated CaMV 355 RNA promoter, the GUS reporter gene, and the 3’ end of the nos gene cloned into the polylinker region of pBinl9 (see text). The coordinates on the HMW glutenin promoter fragments denote the distance in base pairs of the end points from the initiation site for HMW glutenin transcription. Arrows indicate the polarity of the promoter fragments.

scriptional control of a truncated cauliflower mosaic virus (CaMV) 35s RNA promoter (Figure 1 and Methods). This promoter carries a 5’ deletion terminating 89 bp upstream from the transcription initiation site and, therefore, retains the TATA and CCAAT-like boxes but not the putative enhancer sequences (Ow et al., 1987; Fang et al., 1989). As a result, the A90 CaMV promoter directs the synthesis of Iow but measurable levels of GUS in leaves and seeds of transgenic tobacco plants (see below). Similar plasmids utilizing the A90 CaMV 35s RNA promoter fused to the chloramphenicol acetyltransferase reporter gene have been used previously for the analysis of plant gene regulatory signals (Chen et al., 1988; Poulsen and Chua, 1988). A major problem associated with the study of plant gene regulation is the wide variation in expression of transferred genes among transformed plants (Jones et al., 1985; Nagy et al., 1985; Dean et al., 1988). We have sought to reduce this problem by regenerating and analyzing an average of

It has been shown that sequences necessary for endosperm-specific transcription of the GIu-D1-2 gene reside on a 429-bp DNA fragment spanning nucleotides -436 to -8 from the translation initiation codon (Colot et al., 1987; Robert et al., 1989). This corresponds to nucleotides -375 to +54 relative to the transcription start site assuming a transcription initiation site identical to that determined for the related GIu-D1-1 gene (Sugiyama et al., 1985). A consensus TATA box sequence also resides on this fragment in the expected position, as shown in Figure 2, 30 bp upstream of the proposed transcription initiation site (Thompson et al., 1985). Although the TATA box is necessary for correct initiation of transcription by RNA polymerase II (Kovacs and Butterworth, 1986), other cis-acting sequences, usually located upstream from the TATA box, are known to be involved in the transcriptional regulation of a number of genes (for reviews, see Maniatis et al., 1987; Guarente, 1988; Jeang and Khoury, 1988). Therefore, it seemed likely that control elements necessary for regulated expression of the HMW glutenin gene may be located between the TATA box and nucleotide -375 (relative to the transcription initiation site). Accordingly, a promoter fragment spanning nucleotides -375 to -45 was inserted in the normal orientation upstream of the truncated CaMV promoter of pBI121.5 generating pGUS45 (Figure 1). GUS specific activity was then measured in tissue extracts of transgenic tobacco plants containing pB1121.5 and pGUS45. Figure 3 shows that the levels of GUS activity found in 30 DAA seeds derived from pGUS45 transformants varied considerably between plants. Such variation in expression of transferred genes in plants is well documented (Jones et al., 1985; Nagy et al., 1985; Dean et al., 1988) and could be due to rearranged sequences, methylation, so-called “position effects,” or physiological variation during seed development. The wide variation in GUS activity among individual plants transformed with the same plasmid clearly justified our decision to analyze a large number of independent transformants. Despite this variation, it is apparent that all except three pGUS45 transformants exhibited seed GUS levels significantly above any of the pBll21.5 transformants (Figure 3). Table 1 shows that seed extracts from plants harboring pGUS45 were found to contain on average eightfold to ninefold higher levels of GUS activity than the pBI121.5 transformants. However, the presence of this glutenin DNA

Regulation of Storage Protein Gene Expression

mdIII

AAGCTTTTAGTGACCGCAGATTTGCAAAAGCAATGGCTAACAGACACCC -375 pGUS2 a 3

1

AAACCCCAAGAAGCATAACCACTTCPCTTAGATAAAAATTAGCAGATCGA

-326

pGUS2 3 4

1

TATACAAACGTCTACACTTCTGCAAACAATACCCAGAAGCCAGAATTAG -277 pGUS186

1

GATTGAACCGATTACGTGGCTTTAGCAGACCGTCCAAAAATCTGTTTTG -228 pGUS 163 PGUS148

1173

highest leve1 in the control plants (Figure 3, Table 1). Again, there was no significant stimulation of GUS transcription from the CaMV promoter in the leaves of pGUS45R and pGUS45D transformants (Table 1). Therefore, the promoter element carried on this 330-bp fragment possesses enhancer-like properties in that it can function in both orientations and is able to exert an effect over a relatively large distance (approximately 2 kb). lnsertion of two copies of this fragment upstream of the CaMV promoter (pGUS45T) did not result in any significant increase in seed (or leaf) GUS activity relative to the levels found in pGUS45 transformants. However, we note that one of the pGUS45T transformants expressed the highest levels of seed GUS activity measured among the total transformants used for this analysis (Figure 3, Table 1). Glutenin Enhancer Directs both Spatial and Temporal Programs of Gene Expression

The HMW glutenin promoter directs transcription of a linked CAT reporter gene in only (or predominantly only) the endosperm of transgenic tobacco seeds (Robert et al., CG AGCACCACAAAATAGAGATCAATPCACTGACAGTCCACCGAGEEGC 1989). Therefore, seeds from tobacco plants transformed +18 Figure 2. Nucleotide Sequence of the GIu-D1-2 Promoter Region from the Allele Encoding Subunit 12 Showing Deletion End Points Used To Construct the Hybrid Prornoters. The TATA element is boxed and the presumed transcription initiationsite is indicated by a horizontalarrow. Potential regulatory sequence motifs referred to in the text are also indicated. The Gh-D1-2 promoter for the allele encoding subunit 1O from which pGUS148, pGUSl86, pGUS234, and pGUS283 were derived differs at only two nucleotide positions within the region shown (C instead of T at -70, and A insteadof G at -1 14, A. Goldsbrough, O.Schnick, L. Robert, and R. Flavell, manuscript submitted) and, therefore, does not affect the interpretationof the results.

9.0

-

8.0

0

I

7.0 m

$ &

6.0

3

I

-

-.B* 'E

5.0

*

4.0

.

E

fragment upstream of the CaMV promoter was found not to affect GUS gene expression in leaves of transgenic plants (Table 1). Therefore, sequences are present on this DNA fragment that can stimulate transcription from a heterologous promoter in an organ-specific manner. To determine whether or not the function of this control element is dependent upon its position relative to the TATA box, the fragment was inserted upstream of the CaMV promoter in the reverse orientation (pGUS45R),and downstream from the GUS reporter gene (pGUS45D) (Figure 1). The GUS activities measured in seed extracts from plants transformed with pGUS45R were very similar to those found in pGUS45 transformants (Figure 3, Table 1). When the fragment was located 3' to the GUS gene, however, the levels of GUS activity were much lower, but approximately one-quarter of the plants had levels higher than the

$ J

3.0

2.0

i 1.o

. .. . .- .

:

. .

. .

O

Figure 3. Seed GUS Activitiesof IndividualTobacco Plants Transformed with pGUS Plasmids. Each point represents the specific GUS activity in extracts derived from 100 seeds collected at stage 30 DAA from a single independently transformed plant. All assays were performed as a single batch. All plants tested were grown to maturity in the glasshouse at the same time to reduce physiological variation.

1174

The Plant Cell

Table 1. GUS Activity in Seeds and Leaves of Transgenic Tobacco Plants

GUS Specific Activitya

Endosperm-Specific Expression

Construct

Seedsb

Leaves

pB1121.5 pGUS45 pGUSl48 pGUS163 pGUS186 pGUS234 pGUS283 pGUS45R pGUS45D pGUS45T

0.32 f 0.12 (7) 2.74 f 1.59 (14) 3.56 f 2.25 (14) 1.51 f 1.O0(10) 0.51 f 0.31 (15) 0.26 f 0.22 (18) 0.34 f 0.16 (9) 2.36 f 1.76 (1O) 0.66 f 0.58 (9) 3.35 f 2.05 (13)

0.10 f 0.02 (3) 0.10 f 0.12 (6) 0.15 f 0.09 (1O) 0.12 f 0.1O (8) 0.19 f 0.15 (12) 0.12 f 0.10 (5) 0.13 f 0.07 (9) 0.13 f 0.09 (6) -

0.13 f 0.07 (7)

-

+ + + -

+ + +

GUS activities are expressed as picomoles of 4-methylumbelliferone per minute per microgram of protein and represent the mean and standard errors for plants expressing GUS at higher than background(untransformed)levels (0.06 and 0.00 pmol of 4-methylumbelliferone/ min/Ng of protein for seed and leaf, respectively).All plants were grown at the same time in the glasshouse and tissue samples taken and assayed together. Values in parenthesesare the number of plants used in the calculations of means and standard errors. - denotes leaf assays done in only two plants; therefore, means and standard deviation not calculated. Seeds were harvested at 30 DAA. Seed GUS activities of individual plants are shown in Figure 3.

with our hybrid promoter-GUS fusions were analyzed histochemically to identify the site of GUS expression. Histochemical staining, shown in Figure 4A, revealed that GUS activity was restricted to the endosperm tissue of seeds from plants containing pGUS45, pGUS45R, pGUS45D, and pGUS45T (Figure4A, Table 1). Prolonged incubation (overnight) did not result in staining of the embryo tissue. This pattern of expression was not observed for pBI121.5transformed seeds. On the contrary, GUS activity, but a lower level, was localized to discrete parts of the embryo, usually the radicle end, as shown in Figure 4B. Occasionally, staining of isolated clusters of endosperm cells was also observed. During wheat endosperm development, HMW glutenin mRNAs are first detected around 1O DAA and the amounts increase until the mid-developmental phase (about 20 DAA), after which time the levels decline (Bartels and Thompson, 1986). To determine whether this element directs an equivalent temporal program of GUS expression in transgenic tobacco, GUS activity was measured in seeds harvested at various stages of development. For plants transformed with pGUS45, pGUS45R, pGUS45D, and pGUS45T, stimulation of GUS synthesis was first detected between 9 DAA and 12 DAA, coincident with the time of appearance of glutenin mRNA in developing wheat grain. From Figure 5, it can be seen that between 15 DAA and 18 DAA a rapid accumulation of GUS activity occurred, reaching a maximum at 21 DAA, after which time the activity diminished. This profile mimics the normal time course of glutenin gene expression in the developing wheat grain. Seeds from plants transformed with pB1121.5, however, showed only a slight increase in GUS activity during

the middle stages of seed development, which again declined during the latter stages of seed maturation (Figure 5). Therefore, the enhancer sequences present on the 330-bp promoter fragment are able to specify both the spatial and temporal programs of HMW glutenin gene transcription in transgenic tobacco.

Delineation of Enhancer Element by Deletion Analysis

To determine the minimum amount of upstream glutenin DNA required for regulated expression, we tested successively shorter fragments for their ability to modulate transcription from the A90 CaMV promoter. These fragments extend from the Hindlll site at -375 toward the TATA box and terminate at various points upstream of -45. lnsertion of these fragments upstream of the CaMV promoter of pB1121.5 (in the normal orientation relative to the TATA box) gave rise to pGUS148, pGUS163, pGUS186, pGUS234, and pGUS283 (Figures 1 and 2). Analysis of tobacco plants transformed with these plasmids showed that removal of 103 bp from the 3' end of the 330-bp promoter fragment (pGUS148) caused no significant change in the overall levels of seed GUS activity (Figure 3, Table 1). However, deletion of a further 15 bp (pGUS163) caused a marked reduction of seed GUS activity relative to pGUS148. Nevertheless, this still represents an approximate fivefold stimulation of pBll21.5 CaMV promoter activity in seeds (Figure 3, Table 1). A further decrease in CaMV promoter activity resulted from deletion of an extra 23 bp from the glutenin upstream sequences (pGUS186), giving rise to levels of seed GUS activity that were similar

Regulation of Storage Protein Gene Expression

B

1175

to or only slightly higher than those found in pBI121.5transformed seeds (Figure 3). Removal of another 47 bp (pGUS234) or 96 bp (pGUS283) resulted in a complete loss of stimulation of CaMV promoter activity in seeds (Figure 3). The activity of the CaMV A90 35S promoter in leaves was not significantly affected by the presence of any of these truncated promoter fragments (Table 1). These results suggest, therefore, that the region between 148 and 234 nucleotides upstream of the transcription start site of the HMW glutenin promoter contains c/s-acting sequences necessary for seed-specific transcription. To define more precisely the limits of these important sequences, we carried out a histochemical analysis on seeds containing pGUS148, pGUS163, pGUS186, and pGUS234. Seeds from pGUS145 and pGUS163 transformants exhibited endosperm-specific staining with X-gluc, as exemplified by pGUS45 (Figure 4A). Seeds from pGUS186 and pGUS234 transformants, however, exhibited a pattern of staining identical to that observed for pBI121.5 (Figure 4B). Therefore, deletion to -186 of the HMW glutenin promoter disrupts the element(s) required for endospermspecific expression. The ability of the pGUS163 insert to augment transcription in the endosperm suggests that most, if not all, of the control element resides 5' to the -163 deletion end point (see below). GUS expression directed by pGUS148 and pGUS163 throughout seed development was found to be essentially identical to that described for pGUS45 (Figure 5). DISCUSSION It has been shown that a 436-bp HMW glutenin promoter fragment containing the entire untranslated leader se-

Figure 4. Localization of Seed GUS Activity in Tobacco Plants Transformed with pGUS45 and pBI121.5. Seeds harvested at 21 DAA were sectioned and analyzed histochemically for GUS activity as described in Methods. (A) Cross-section of seed from a typical pGUS45-transformed tobacco plant. GUS activity was clearly visible in the endosperm after 1 hr to 2 hr incubation in X-gluc. Staining of the embryo was not observed even after prolonged incubation. (B) Section of seed from a typical pBI121.5-transformant. Incubation in X-gluc was for 6 hr, at which time staining of the embryo was clearly visible. Staining of isolated clusters of endosperm cells can also be seen. En, endosperm; Em, embryo.

Figure 5. Expression of GUS Activity in Developing Seeds from Individual Tobacco Plants Transformed with pGUS Plasmids. Seeds from an untransformed plant (•) and transformants containing pBI121.5 (O), pGUS45 (A), and pGUS45T (A) were collected at different time points after anthesis. GUS activity was assayed on approximately 100 seeds at each time point and normalized to the protein content of the sample. MU, 4-methylumbelliferone.

1 176

The Plant Cell

quence and 375 bp of DNA upstream from the transcription start site is sufficient for endosperm-specific transcription in transgenic tobacco (Colot et al., 1987; Robert et al., 1989). The results of experiments described here have enabled us to characterize further the elements necessary for the tissue-specific expression of HMW glutenins. By measuring the activity of various hybrid promoter-GUS fusions in transgenic tobacco plants, we were able to show that sequences required for directing endospermspecific expression reside within 345 bp upstream of the TATA box. Furthermore, we demonstrated that these sequences can functionally interact with a heterologous promoter in an orientation-independent and position-independent manner. These are characteristics of enhancer elements (Serfling et al., 1985; Jeang and Khoury, 1988) which, unlike upstream activation sites or upstream promoter elements, can function when placed downstream of the transcription start site (for reviews, see Maniatis et al., 1987; Stanway et al., 1987; Guarente, 1988). A number of cis-acting control elements have been identified that can function in either orientation upstream of plant genes (Fluhr et al., 1986; Nagy et al., 1987; Dean et al., 1989). Some of these elements, however, do not activate transcription when located downstream from the promoter (Timko et al., 1985). Apart from the CaMV 35s RNA enhancer (Nagy et al., 1987; Fang et al., 1989), only one other plant promoter element (the @-conglycininenhancer) has been reported to activate transcription when placed 3' to the transcription start site (Chen et al., 1988). Interestingly, GUS expression specified by the 345-bp promoter fragment was confined to the endosperm tissue of transgenic tobacco plants as in wheat despite the fact that tobacco seed storage proteins accumulate in both endosperm and embryo (Sano and Kawashima, 1983; Kuhlemeier et al., 1987). Furthermore, the time of appearance of GUS activity was similar to that of both glutenin synthesis in wheat and storage protein synthesis in tobacco (Erdelska, 1985; Bartels and Thompson, 1986; Kuhlemeier et al., 1987) in accordance with previous observations regarding the behavior of the HMW glutenin promoter in transgenic tobacco (Robert et al., 1989). There was a small but reproducible increase in GUS activity observed during development of pBll21.5-transformed seeds, presumably because of the GUS activity in the embryo shown in Figure 48. A similar pattern of expression with this promoter has been shown by Benfey et al. (1989). In all plants studied, GUS activity was seen to decline in seeds after 21 DAA. During wheat and tobacco seed development, storage protein synthesis decreases at the onset of seed drying and mRNA levels decline considerably (Bartels and Thompson, 1986). It is reasonable, therefore, to assume that the decrease in accumulation of GUS levels at around 24 DAA is due to similar controls over protein synthesis. However, the GUS levels were not maintained at the mid-developmentalpeak value but decreased during seed maturation, suggesting that the GUS enzyme is

unstable during seed drying in contrast to the behavior of chloramphenicol acetyltransferase, which remains at an elevated leve1 throughout the latter stages of seed development in transgenic tobacco (Colot et al., 1987; Robert et al., 1989). It should be noted that the relative rankings of the seed GUS activities among individual transformants remained constant irrespective of the developmental stage, as exemplified in Figure 5. This result has allowed us to make meaningful comparisons between GUS activities from different plants at the 30 DAA stage chosen (Figure 3 and Table 1). By testing successively smaller promoter fragments for their ability to confer endosperm-specific enhancement on the A90 CaMV promoter, we were able to define the 3' limits of the glutenin enhancer sequences. The decreased potency of the AI63 promoter fragment relative to the -148 deletion suggests that the 3' boundary of the control element resides between -1 48 and -1 63 nucleotides upstream from the transcription start site. However, it should be emphasized that the A I 63 promoter fragment still retains the ability to enhance transcription in a tissuespecific manner. Therefore, it might be argued that the decreased enhancement is due to a more indirect effect such as reduced accessibility of a binding site to a transacting factor or an unfavorable alignment of the enhancer sequences with respect to the CaMV TATA box. Complete elimination of endosperm-specific regulation does occur on deletion to position -1 86. Perusal of the -1 48 to -1 86 interval reveals severa1 DNA sequence motifs that may be relevant to HMW glutenin gene expression. These include a direct repeat of the pentanucleotide sequence TTGCT, a pair of GCTCC direct repeats, and a sequence possessing imperfect dyad symmetry. None of these sequences appears anywhere else in the HMW glutenin promoter region (Figure 2). Regarding the possible involvement of the direct repeats in the binding of transcription factors, it may be significant that one of each pair of these motifs is disrupted by the -163 deletion, resulting in a decrease in GUS expression in the endosperm. In the presence of the wheat promoter DNA, the activity of the A90 CamV promoter in the embryo appeared to be suppressed. The suppression was relieved to the -1 86 and -234 deletions, implying that the element that produces endosperm activity is also responsible for the suppression of expression in the embryo. When the CaMV -343 to -90 enhancer is added to the A90 CaMV promoter, the embryo expression is not reduced but gene expression is extended to the cotyledon end of the embryo also (Benfey et al., 1989). Therefore, the silencing effect of the wheat glutenin enhancer is not seen with all enhancers. Examinationof the DNA sequence for a number of other cereal prolamin genes has revealed a conserved sequence of about 30 bp lying approximately 300 bp upstream of the translation initiation codon (Forde et al., 1985; Kreis et

Regulation of Storage Protein Gene Expression

al., 1985). The “-300 element” is present upstream of the promoters for the B-hordein gene of barley and the a-gliadin, 7-gliadin, and low molecular weight glutenin genes of wheat (Kreis et al., 1986; Colot et al., 1989). As yet, a role has not been assigned to this sequence, although it is contained within a 160-bp region that is necessary for endosperm-specificexpression of low molecular weight glutenin (Colot et al., 1987). The element has the consensus sequence TGACATGTAAAGTGAATAAEGAGTCATG and incorporates two smaller conserved motifs (underlined). One motif is identical to the consensus binding site (ATGAC/GTCAT) for the yeast GCN4 protein (Hill et al., 1986) and the functionally equivalent transcription activators AP-1, Jun, and Fos (Pawson, 1987; Vogt et al., 1987; Struhl, 1989; Vogt and Bos, 1989). The other motif, TGTAAAG, is known as the -300 element core sequence and is also found in the corresponding position upstream of the coding sequences for the a-zeins, p-zeins, and y-zeins (Forde et al., 1985; Kreis et al., 1985, 1986; Thompson and Larkins, 1989). Upstream of the 19-kD a-zein genes, this core motif comprises part of a different conserved sequence that possesses dyad symmetry and binds a protein present in nuclear extracts from maize endosperm but not from maize seedling tissue (Maier et al., 1987, 1988). Perhaps, surprisingly, neither the -300 element nor the zein consensus sequence is present in the HMW glutenin promoter region. Although a sequence exhibiting poor homology to the -300 element has been identified 450 bp upstream of a Glu-Bl-2 gene (Halford et al., 1987), it lies outside of the region shown to be essential for the tissuespecific regulation of HMW glutenin gene expression (Colot et al., 1987; Robert et al., 1989). Nevertheless, a variant of the -300 element core sequence (TGCAAAG) is present in the important -148 to -1 86 intervalof the HMW glutenin promoter. However, this sequence is not disrupted by the -1 63 deletion and has homologs at -257 and -353 that remain unaffected by the “knockout” -1 86 deletion. Therefore, if this sequence does play a role in the regulation of HMW glutenin gene expression, it is likely to do so not in isolation, but in combination with other neighboring sequences such as the direct repeats. Indeed, it is becoming clear that many enhancer elements are composed of multiple short sequence motifs that bind combinations of transcriptionfactors to confer inducibility, tissue specificity, or general enhancement on promoters (Pfeifer et al., 1987; Schirm et al., 1987; Jones et al., 1988; Schüle et al., 1988; von der Ahe et al., 1988; Dynan, 1989). Alternatively, this motif may not be involved directly in the binding of regulatory proteins but has some other function in regulating HMW glutenin gene expression. In this respect, it is interesting that this sequence forms part of a more extensive A T-rich tract that may be intrinsically bent (Koo et al., 1986; Koo and Crothers, 1988). Bent DNA has been identified in the regulatory regions of a number of prokaryote and eukaryote genes (Poljak and

+

1177

Gralla, 1987; Umek and Kowalski, 1987; Bauer et al., 1988; lnokuchi et al., 1988). Further experiments are in progress to determine the precise role of these sequences.

METHODS

Vector Construction The plasmid vector pB1121.5 (Figure 1) was designed for the analysis of transcriptional regulatory signals and its construction will be described in detail elsewhere (R. Jefferson, A. Goldsbrough, and M. Bevan, manuscript in preparation). It is a derivative of the binary vector pBinl9 (Bevan, 1984) and carries the Escherichia coli uidA reporter gene encoding GUS (Jefferson et al., 1986,1987) under the transcriptionalcontrol of a truncated CaMV 355 RNA promoter. A polylinker sequence is located 90 bp upstream from the transcription start site and a transcription terminator is provided by the polyadenylationsignal of the nopaline synthase gene (nos) downstream from the GUS gene. Construction of HMW Glutenin Promoter-GUSFusions DNA fragments carrying 3‘ deletions of the HMW glutenin promoter were obtained by BAL-31 exonuclease or exonuclease III/Sl nuclease digestion of the two cloned GIu-D1-2 genes specifying subunits 10 and 12, respectively, before DNA sequence analysis (Thompson et al., 1985; A. Goldsbrough, D. Schnick, L. Robert, and R. Flavell, manuscript submitted). These DNA fragments were analyzed for the extent of 3’ deletion by polyacrylamide gel electrophoresis and finally by dideoxy sequencing in pUC9 or pUC19 using the universal primer (Sanger et al., 1977). The deletions originate within the HMW glutenin structural gene and extend through the TATA box, terminating 45,148,163,186, 234, and 283 nucleotides upstream from the transcriptioninitiation site (Figure 2). These fragments were excised from the pUC9 and pUCl9 derivatives using the Hindlll site located 375 nucleotides upstream of the transcription start site (Figure 2) and appropriate polylinker restriction sites adjacent to the deletion end points and subsequently inserted into the pB1121.5 polylinker. This gave rise to pGUS45, pGUSl48, pGUSl63, pGUSl86, pGUS234, and pGUS283, respectively, in which the truncated HMW glutenin promoter fragments are located upstream of the CaMV promoter in the correct orientation relative to the TATA box (Figure 1). The largest of these promoter fragments (containing the -45 deletion) was also inserted in the reverse orientation, and in duplicate in the normal orientation upstream from the truncated CaMV promoter to generate pGUS45R and pGUS45T, respectively. pGUS45D was constructed by insertion of this fragment in the normal orientation downstream of the terminator for GUS transcription. All plasmid constructions are shown in Figure 1. Plant Transformation pBll21.5-derived plasmids were mobilized from E. coli strain MC1022 (Casadaban and Cohen, 1980) into the nononcogenic Agrobacterium tumefaciens strain LBA4404 (Hoekema et al.,

1178

The Plant Cell

1983) using the E. coli strain HB1O1 (Boyer and Roulland-Dussoix, 1969) harboring pRK2013 (Figurski and Helinski, 1979) in a triparenta1 mating as described previously (Fraley et al., 1983). Sterile leaf discs of Nicotiana tabacum (cv Samsun) were inoculated for 20 min with a suspension of A. tumefaciens carrying the desired plasmid, then laid, adaxial side up, on shoot-inducing medium overlaid with 1 mL of a N. benthamiana cell suspension (Horsch et al., 1985). These plates contained MS medium (Murashige and Skoog, 1962) solidified with 8 g/L agar and supplemented with 30 g/L sucrose as a carbon source, 0.1 mg/L a-naphthelene acetic acid, and 1 g/L 6-benzylamino purine to promote shoot induction. After 2 days, the leaf discs were transferred to selection plates consisting of the same medium supplemented with 100 pg/mL kanamycin sulfate and 500 pg/mL carbenicillin. Shoots were transferred to MS medium without hormones and containing a reduced concentrationof carbenicillin (200 pg/mL). From a total of 500 leaf discs, 375 shoots were taken, of which 179 gave rise to rooted cuttings on kanamycin. All of the regenerated plants were transferred to soil and grown to maturity at the same time in the Same glasshouse. On flowering they were self-pollinated. Two of these plants exhibitedan unusual morphology and several others failed to produce seeds. These were eliminated from the analysis. GUS Assay GUS assays were performed essentially as described previously (Jefferson 1987; Jefferson et al., 1987). One hundred seeds or an individual leaf disc (diameter 10 mm) were grown in 1 mL Of extraction buffer (Jefferson, 1987) and the resulting tissue extracts cleared by centrifugationat 4000 rpm for 15 min. Reactions were carried out at 37OC in a 500-pL volume containing 50 gL of plant extract and 450 pL of assay buffer (Jefferson, 1987). At several intervals after initiation of the reaction, 50-pL portions were removed and mixed in a microtitre plate with 150 pL of 0.2 M Na2C03to stop the reaction. Fluorescence was measured using a Titertek Fluoroskan II (Flow Laboratories,Ltd.) calibrated against 1 pM 4-methylumbelliferone. Protein concentrations of plant extracts were determined by the dye-binding method of Bradford (1976) with a kit supplied by Bio-Rad Laboratories. Absorbance at 600 nm was measured in microtitre plates using a Titertek Multiskan Plus spectrophotometer. Histochemistry GUS enzyme activity in transgenic tobacco seeds was localized by histochemical staining with X-gluc (5-bromo-4-chloro-3-indolyl0-D-glucuronic acid) (Jefferson, 1987; Jefferson et al., 1987). Sections (55 pm) of 21-day-old seeds were made using a cryostat and transferred directly onto glass microscope slides. Staining was carried out by incubation in 50 mM NaH2P04(pH 7.0) containing 1 mg/mL X-gluc (Biosynth AG, 9422 Staad, Switzerland) at 37OC for 30 min to 12 hr. A fixation step was not included. ACKNOWLEDGMENTS We would like to thank Richard Jefferson and Andrez Kilian for guidance in the use of the GUS microassay procedure and Vincent

Colot for advice on GUS histochemistry.We are also grateful to Suzanne Sheerman for demonstrating the art of tissue culture and Andrew Goldsbrough for providing pB1121.5 and the Glu-Dl2 deletion clones. This work was supported by a grant from the European Communities Biotechnology Action Programme, Contract No, BAP-0106-UK. Received September 28, 1990; accepted October 12, 1990. REFERENCES

Bartels, D., and Thompson, R.D. (1986). Synthesis of mRNAs coding for abundant endosperm proteins during wheat grain development. Plant Sci. 46, 117-125. Bauer, B.F., Kar, E.G., Elford, R.M., and Holmes, W.M. (1988). Sequence determinants for promoter strength in the IeuV operon of Escherichia coli. Gene 63, 123-1 34. Benfey, P.N., Ren, L., and Chua, N.-H. (1989). The CaMV 35s enhancer contains at least two domains which can confer different developmentaland tissue-specific expression patterns. EMBO J. 8,2195-2202. Bevan, M. (1984). Binary Agrobacterium vectors for plant transformation. Nucl. Acids Res. 12, 8711-8721. Boyer, H.W., and Roulland-Dussoix, D. (1969). A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. MOI.Biol. 41, 459-472. Bradford, M.M. (1976). A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein dye-binding. Anal. Biochem. 72, 248-254. Casadaban, M.J., and Cohen, S.N. (1980). Analysis of gene control signals by DNA fusion and cloning Escherichia coli. J. MOI.Biol. 138, 179-207. Chen, 2.-L., Pan, N A . , and Beachy, R.N. (1988). A DNA sequence element that confers seed-specific enhancement to a constitutive promoter. EMBO J. 7, 297-302. Colot, V., Robert, L.S., Kavanagh, T.A., Bevan, M.W., and Thompson, R.D. (1987). Localization of sequences in wheat endosperm protein genes which confer tissue-specific expression in tobacco. EMBO J. 6,3559-3564. Colot, V., Bartels, D., Thompson, R., and Flavell, R. (1989). Molecular characterization of an active wheat LMW glutenin gene and its relation to other wheat and barley prolamin genes. MOI.Gen. Genet. 216, 81-90, Dean, C., Jones, J., Favreau, M., Dunsmuir, P., and Bedbrook, J. (1988). lnfluence of flanking sequences on variability in expression levels of an introduced gene in transgenic tobacco plants. Nucl. Acids Res. 16, 9267-9283. Dean, C., Favreau, M., Bedbrook, J., and Dunsmuir, P. (1989). Sequences 5' to translationstart regulateexpressionof petunia rbcS genes. Plant Cell 1, 209-21 5. Dynan, W.S. (1989). Modularity in promoters and enhancers. Cell 58, 1-4. Erdelska, O. (1985). Dynamics of the development of embryo and endosperm I. (Papaver somniferum, Nicotiana tabacum, Jasione monfana). Biologia 40, 17-30. Fang, R.-X., Nagy, F., Sivasubramaniam, S., and Chua, N.-H.

Regulation of Storage Protein Gene Expression

(1989). Multiple cis regulatory elements for maximal expression of the cauliflower mosaic virus 35s promoter in transgenic plants. Plant Cell 1, 141-1 50. Figurski, D.H., and Helinski, D.R. (1979). Replication of an origincontaining derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 75, 1648-1 652. Fluhr, R., Kuhlemeier, C., Nagy, F., and Chua, N.-H. (1986). Organ-specific and light-induced expression Of plant genes. Science, 232,1106-1 112. Forde, B.G., Heyworth, A., Pywell, J., and Kreis, M. (1985). Nucleotide sequence of a B1 hordein gene and the identification of possible upstream regulatory elements in endosperm storage protein genes from barley, wheat and maize. Nucl. Acids Res. 13,7327-7339. Fraley, R.T., Rogers, S.G., Horsch, R.B., Sanders, P.R., Flick, J.S., Adams, S.P., Bittner, M.L., Brand, L.A., Fink, C.L., Fry, J.S., Galluppi, G.R., Goldberg, S.B., Hoffmann, N.L., and Woo, S.C. (1983). Expression of bacterial genes in plant cells. Proc. Natl. Acad. Sci. USA 80, 4803-4807. Guarente, L. (1988). UASs and enhancers: Common mechanism of transcriptional activation in yeast and mammals. Cell 52, 303-305. Halford, N.G., Forde, J., Anderson, O.D., Greene, F.C., and Shewry, P.R. (1987). The nucleotide and deduced amino acid sequences of an HMW glutenin subunit gene from chromosome 1B of bread wheat (Triticumaestivum L.) and comparison with those of genes from chromosomes 1A and 1D. Theor. Appl. Genet. 75, 117-1 26. Heidecker, G., and Messing, J. (1986). Structural analysis of plant genes. Annu. Rev. Plant Physiol. 37, 439-466. Hill, D.E., Hope, I.A., Macke, J.P., and Struhl, K. (1986). Saturation mutagenesis of the yeast hisS regulatory site: Requirements for transcriptional induction and for binding by GCN4 activator protein. Science 234, 451-457. Hoekema, A., Hirsch, P.R., Hooykaas, P.J.J., and Schilperoort, R.A. (1983). A binary plant vector strategy based on separation of vir- and T-region of the Agrobacterium fumefaciens Ti-plasmid. Nature 303, 179-1 80. Horsch, R.B., Fry, J.E., Hoffmann, N.L., Eichholtz, D., Rogers, S.G., and Fraley, R.T. (1985). A simple and general method for transferring genes into plants. Science 227, 1229-1 231. Inokuchi, K., Nakayama, A., and Hishinuma, F. (1988). Sequence-directed bends of DNA helix axis at the upstream activation sites of a-cell-specific genes in yeast. Nucl. Acids Res. 16, 6693-671 1. Jeang, K.-T., and Khoury, G. (1988). The mechanistic role of enhancer elements in eukaryotic transcription. BioEssays 8, 104-1 07. Jefferson, R.A. (1987).The GUS gene fusion system. Plant MOI. Biol. Rep. 5, 387-405. Jefferson, R.A., Burgess, S.M., and Hirsh, D. (1986). p-Glucuronidase from Escherichiacoli as a gene fusion marker. Proc. Natl. Acad. Sci. USA 83,8447-8451. Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUS fusions: P-Glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901-3907. Jones, J.D.G., Dunsmuir, P., and Bedbrook, J. (1985). High leve1

1179

expression of introducedchimaeric genes in regenerated transformed plants. EMBO J. 4, 2411-2418. Jones, N.C., Rigby, P.W.J., and Ziff, E.B. (1988). Trans-acting protein factors and the regulation of eukaryotic transcription: Lessons from studies on DNA tumor viruses. Genes Dev. 2, 267-281. Kasarda, D.D., Bernadin, J.E., and Nimmo, C.C. (1976). Wheat protein. In Advances in Cereal Science and Technology, Vol. 1, Y. Pomeranz, ed (St. Paul, MN: Amer. Assoc. Cereal Chem.), pp. 158-236. Koo, H.-S., and Crothers, D.M. (1988). Calibration of DNA curvature and a unified description of sequence directed bending. Proc. Natl. Acad. Sci. USA 85, 1763-1767. Koo, H.-S., Wu, H.-M., and Crothers, D.M. (1986). DNA bending at adenine and thymine tracks. Nature 320, 501-506. Kovacs, B.J., and Butterworth, P.H.W. (1986). The effect Of changing distance between the TATA-box and Cap site by up to three base pairs on the selection of the transcriptional start site of a cloned eukaryotic gene in vitro and in vivo. Nucl. Acids Res. 14,2429-2441. Kreis, M., Shewry, P.R., Forde, B.G., Forde, J., and Miflin, B.J. (1985). Structure and evolution of seed storage proteins and their genes with particular reference to those of wheat, barley and rye. Oxf. Surv. Plant MOI.Cell. Biol. 2, 253-31 7. Kreis, M., Williamson, M.S., Forde, J., Schmitz, D., Clark, J., Buxton, B., Pywell, J., Marris, C., Henderson, J., Harris, N., Shewry, P.R., Forde, B.G., and Miflin, B.J. (1986). Differential gene expression in the developing barley endosperm. Philos. Trans. R. SOC.Lond. B 314,355-365. Kuhlemeier, C., Green, P.J., and Chua, N.-H. (1987). Regulation of gene expression in higher plants. Annu. Rev. Plant Physiol. 38,221-257. Maier, U.-G., Brown, J.W.S., Toloczyki, C., and Feix, G. (1987). Binding of a nuclear factor to a consensus sequence in the 5’ flanking region of zein genes from maize. EMBO J. 6, 17-22. Maier, U.-G., Brown, J.W.S., Schmitz, L.M., Schwall, M., Dietrich, G., and Feix, G. (1988). Mapping of tissue-dependent and independent protein binding sites to the 5’ upstream region of zein gene. MOI.Gen. Genet. 212, 241-245. Maniatis, T., Goodbourn, S., and Fischer, J.A. (1987). Regulation of inducible and tissue-specific gene expression. Science 236,1237-1 245. Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15, 473-497. Nagy, F., Morelli, G., Fraley, R.T., Rogers, S.G., and Chua, N.H. (1985). Photoregulatedexpressionof pea rbcS gene in leaves of transgenic plants. EMBO J. 4, 3063-3068. Nagy, F., Boutry, M., Hsu, M.-Y., Wong, M., and Chua, N.-H. (1987). The 5’-proximal region of the wheat Cab-7 gene contains a 268-bp enhancer-like sequence for phytochrome response. EMBO J. 6,2537-2542. Ow, D.W., Jacobs, J.D., and Howell, S.H. (1987). Functional regions of the cauliflower mosaic virus 35s RNA promoter determined by use of firefly luciferase gene as a reporter of promoter activity. Proc. Natl. Acad. Sci. USA 84, 4870-4874. Pawson, T. (1987). Transcription factors as oncogenes. Trends Genet. 3, 333-334.

1180

The Plant Cell

Payne, P.I., Holt, L.M., Jackson, E.A., and Law, C.N. (1984). Wheat storage proteins: Their genetics and their potential for manipulation by plant breeding. Philos. Trans. R. SOC.Lond. B 304,359-371. Pfeifer, K., Arcangioll, B., and Guarente, L. (1987).Yeast HAP7 activator competes with the factor RC2 for binding to upstream activation site UASl of the CYC7 gene. Cell 49, 9-18. Poljak, L.G., and Gralla, J.D. (1987). The SV40 termination region exhibits an altered helical DNA conformation. Nucl. Acids Res. 15,5433-5442. Poulsen, C., and Chua, N.-H. (1988). Dissection of 5’ upstream sequences for selective expression of the Nicotiana plumbaginifolia rbcS-8B gene. MOI.Gen. Genet. 214, 16-23. Robert, L.S., Thompson, R.D., and Flavell, R.B. (1989). Tissuespecific expression of a wheat high molecular weight glutenin gene in transgenic tobacco. Plant Cell 1, 569-578. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74,5463-5466. Sano, M., and Kawashima, N. (1983). lsolation and partia1 characterizatibn of major seed protein from Nicotiana tabacum and accumulation during development. Agric. Eiol. Chem. 47, 1305-1 31O. Schirm, S., Jiricny, J., and Schaffner, W. (1987). The SV40 enhancer can be dissected into multiple segments, each with a different cell type specificity. Genes Dev. 1, 65-74. Schiile, R., Muller, M., Kaltschmidt, C., and Renkawitz, R. (1988). Many transcription factors interact synergistically with steroid receptors. Science 242, 1418-1 420. Serfling, E., Jasin, M., and Schaffner, W. (1985). Enhancers and eukaryotic gene transcription. Trends Genet. 1, 224-230. Soave, C., and Salamini, F. (1984). The role of structural and regulatory genes in the development of maize. Dev. Genet. 5, 1-25.

Stanway, C., Kingsman, A.J., and Kingsman, S.M. (1987). The control of transcriptionin Saccharomycescerevisiae. BioEssays 7, 62-67. Struhl, K. (1989). Helix-turn-helix,zinc-finger, and leucine-zipper motifs for eukaryotic transcriptionalregulatory proteins. Trends Biochem. Sci. 14, 137-140. Sugiyama, T., Rafalski, A., Peterson, D., and SOM, D. (1985). A wheat HMW glutenin subunit gene reveals a highly repeated structure. Nucl. Acids Res. 13, 8729-8737. Thompson, G.A., and Larkins, B.A. (1989). Structural elements regulating zein gene expression. BioEssays 10, 108-1 13. Thompson, R.D., Bartels, D., and Harberd, N.P. (1985). Nucleotide sequence of a gene from chromosome 1D of wheat encoding a HMW-glutenin subunit. Nucl. Acids Res. 13, 6833-6846. Timko, M.P., Kausch, A.P., Castresana, C., Fassler, J., HerreraEstrella, L., Van den Broeck, G., Van Montagu, M., Schell, J., and Cashmore, A.R. (1985). Light regulation of plant gene expression by an upstream enhancer-like element. Nature 318, 579-582. Umek, R.M., and Kowalski, D. (1987). Yeast regulatorysequence preferentially adopt a non-B confirmation in supercoiled DNA. Nucl. Acids Res. 15, 4467-4480. Vogt, P.K., and Bos, T.J. (1989). The oncogene jun and nuclear signalling. Trends Biochem. Sci. 14, 172-1 75. Vogt, P.K., Bos, T.J., and Doolittle, R.F. (1987). Homology between the DNA binding domain of the GCN4 regulatory protein of yeast and the carboxyl-terminal region of a protein coded for by the oncogene jun. Proc. Natl. Acad. Sci. USA 84, 3316-331 9. von der Ahe, D., Pearson, D., Nakagawa, J.4, Rajput, B., and Nagamine, Y. (1988). Multiple nuclear factors interact with promoter sequences of the urokinase-type plasminogen activator gene. Nucl. Acids Res. 16, 7527-7544.

Identification of an enhancer element for the endosperm-specific expression of high molecular weight glutenin. M S Thomas and R B Flavell Plant Cell 1990;2;1171-1180 DOI 10.1105/tpc.2.12.1171 This information is current as of January 12, 2015 Permissions

https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298 X

eTOCs

Sign up for eTOCs at: http://www.plantcell.org/cgi/alerts/ctmain

CiteTrack Alerts

Sign up for CiteTrack Alerts at: http://www.plantcell.org/cgi/alerts/ctmain

Subscription Information

Subscription Information for The Plant Cell and Plant Physiology is available at: http://www.aspb.org/publications/subscriptions.cfm

© American Society of Plant Biologists ADVANCING THE SCIENCE OF PLANT BIOLOGY